CN114213550A - CAR-T cell secreting and expressing PD-1 and GM-CSF antibodies and application thereof - Google Patents

CAR-T cell secreting and expressing PD-1 and GM-CSF antibodies and application thereof Download PDF

Info

Publication number
CN114213550A
CN114213550A CN202210040555.3A CN202210040555A CN114213550A CN 114213550 A CN114213550 A CN 114213550A CN 202210040555 A CN202210040555 A CN 202210040555A CN 114213550 A CN114213550 A CN 114213550A
Authority
CN
China
Prior art keywords
gly
leu
ser
car
thr
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN202210040555.3A
Other languages
Chinese (zh)
Other versions
CN114213550B (en
Inventor
肖海蓉
许晓椿
刘庆喜
魏卿
任倩影
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Shenzhen Boya Perception Pharmaceutical Co ltd
Original Assignee
Sinica Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Sinica Ltd filed Critical Sinica Ltd
Publication of CN114213550A publication Critical patent/CN114213550A/en
Application granted granted Critical
Publication of CN114213550B publication Critical patent/CN114213550B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0634—Cells from the blood or the immune system
    • C12N5/0636—T lymphocytes
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/52—Cytokines; Lymphokines; Interferons
    • C07K14/521—Chemokines
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/52—Cytokines; Lymphokines; Interferons
    • C07K14/54—Interleukins [IL]
    • C07K14/5418—IL-7
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70503—Immunoglobulin superfamily
    • C07K14/7051—T-cell receptor (TcR)-CD3 complex
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/24—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against cytokines, lymphokines or interferons
    • C07K16/243—Colony Stimulating Factors
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2803—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2803—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
    • C07K16/2818—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily against CD28 or CD152
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/02—Fusion polypeptide containing a localisation/targetting motif containing a signal sequence
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/03—Fusion polypeptide containing a localisation/targetting motif containing a transmembrane segment
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Immunology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • Zoology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Toxicology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Microbiology (AREA)
  • Cell Biology (AREA)
  • Hematology (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention relates to CAR-T cells secreting PD-1, GM-CSF antibodies and uses thereof. In particular, in one aspect, the invention relates to a chimeric antigen receptor comprising: an antigen binding domain as a first signal, a transmembrane domain, an intracellular transduction domain as a second signal, and a fourth signal domain that secretes anti-PD-1, anti-GM-CSF scFv neutralizing PD-1, GM-CSF. The invention also relates to a recombinant plasmid, CAR-T cells capable of secreting antibodies expressing IL-7, CCL17 factor and/or PD-1, GM-CSF, methods for the preparation of these CAR-T cells and their use in the preparation of cell therapeutics for the treatment of tumors. The cell therapeutic agent of the present invention has excellent technical effects as described in the specification.

Description

CAR-T cell secreting and expressing PD-1 and GM-CSF antibodies and application thereof
Technical Field
The invention belongs to the technical field of biology, and particularly relates to a CD19-CAR-T cell secreting IL-7 and CCL-17 factors, anti-PD-1 and anti-GM-CSFscFv for secreting and neutralizing PD-1 and GM-CSF, a preparation method and application of the CD19-CAR-T cell, in particular to application of the CD19-CAR-T cell in preparing a therapeutic agent for treating tumors.
Technical Field
The first gene therapy product, kymeriah, was approved by the U.S. Food and Drug Administration (FDA) in 2017 at month 8 and is well suited for the treatment of some children and young patients with Acute Lymphoblastic Leukemia (ALL). Kymeriah is a genetically modified autologous T cell immunotherapy, namely chimeric antigen receptor T (CAR-T) immunotherapy. CAR-T immunotherapy is a cellular immunotherapy based on chimeric antigen receptors, where the CAR-T gene sequence encoding the chimeric antigen receptor is introduced into T cells by in vitro gene transduction techniques, resulting in tumor-specific T cells that can bind the target antigen. Most common CARs include a segment of antigen recognition, such as the single chain variable segment (scFv) of a monoclonal antibody (mAb), and the TCR zeta chain, which activates the intracellular signaling domain of T cells.
The CAR-T cell targeting CD19 has shown remarkable effect in preclinical and clinical situations, and the prior research shows that IL-7 can prolong the survival ability of immune cells, and can also stimulate the proliferation of mature T cells, so IL-7 factor can enhance the survival time of immune cells in vivo and the anti-tumor effect; CCL-17, also known as thymus and activation-regulated chemokines, is capable of increasing the ability of endogenous immune cells to aggregate into tumor cells, further enhancing the anti-tumor effect of immune cells. However, this therapy is limited by its associated toxic side effects, such as cytokine release syndrome and neurotoxicity. The cytokine syndrome mainly refers to the condition that in the process of the action of immune cells and tumor cells, a large amount of cytokines are released so as to cause further linkage reaction, such as high fever and chill, dyspnea, blood coagulation disorder and the like caused by excessive inflammation, and symptoms such as headache, confusion, cognitive change, language disorder and the like caused by neurotoxicity, which finally endanger life. Recently, studies have shown that monocytes and macrophages promote CRS and neurotoxicity progression after CAR-T cell therapy, and that neutralizing the giant cell colony stimulating factor (GM-CSF) can slow CRS and neurotoxicity after CAR-T cell therapy without inhibiting CAR-T function (Sterner RM, Sakemura R, Cox MJ. GM-CSF inhibition of cell kinase synthesis and neuroinflammation processes CAR-T cell function in xenographs. blood.2019Feb 14; 133(7):697-709.doi: 10.1182/blood-2018-10-881. Epub2018Nov 21.). The RNA interference technology is utilized to efficiently knock down GM-CSF in CAR-T cells or secrete anti-GM-CSF scFv for expression and neutralization of GM-CSF, so that the generation and development of cytokine release syndrome and neurotoxicity are prevented or slowed down, and the safety of CAR-T therapy is improved.
In the aspect of CAR-T cell treatment of tumor, tumor microenvironment and immune response play an important role, in order to eliminate tumor cells, the autoimmune system needs to be activated, the activation and expansion of immune cells become key factors for tumor elimination, and immune cells such as T cells are inhibited by immune checkpoint molecules in the tumor microenvironment, such as programmed death receptor (PD-1), PD-1 can down regulate the response of the immune system to human cells in the body, and regulate the immune system and promote self-tolerance by inhibiting T cell inflammatory activity, and prevent autoimmune disease from generating, but can also bind to transduction inhibitory signals, such as PDL-1 ligand-induced cell death (AICD) generation, and limit the persistence of immune cells or CAR-T cells in the body. The PD-1 immune checkpoint is blocked by the PD-1 antibody, thereby repairing the function of the CAR-T cell.
Thus, there remains a need in the art for improved methods of tumor treatment, such as for example, for CD19-CAR-T cells secreting IL-7 and CCL-17 factor, and anti-PD-1 and anti-GM-CSFscFv that neutralize PD-1 and GM-CSF, with superior properties.
Disclosure of Invention
The invention aims to improve the method for treating tumors, for example, to provide a CD19-CAR-T cell which secretes IL-7 and CCL-17 factors with excellent performance, and secretes anti-PD-1 and anti-GM-CSFscFv for neutralizing PD-1 and GM-CSF.
The CAR-T cells made by the present invention may also be referred to as CD19-CAR-T cells.
Aiming at the actual requirements of the current CAR-T technology, the invention provides the construction of the CD19 CAR expression plasmid co-expressing IL-7 and CCL17, so that not only IL-7 can be secreted out of T cells, but also CCL-17 can recruit peripheral blood immune cells to the greatest extent, and the tumor cell killing capacity of CAR-T is further improved. In order to enhance the killing effect and reduce CRS and neurotoxic side effects, plasmids secreting anti-PD-1 and anti-GM-CSFscFv for neutralizing PD-1 and GM-CSF are constructed at the same time.
In order to achieve the purpose, the invention adopts the following technical scheme:
in a first aspect, the present invention provides a chimeric antigen receptor comprising:
a) an antigen binding domain as a first signal,
b) A transmembrane domain,
c) An intracellular transduction domain as a second signal, and
d) a third signal domain that expresses IL-7 and CCL-17 cytokines.
The chimeric antigen receptor according to the first aspect of the invention comprises an amino acid sequence shown in sequence 2.
In a second aspect, the present invention also provides a recombinant plasmid having a nucleotide sequence as shown in sequence 1.
In a third aspect, the invention also provides a CAR-T cell capable of secreting an antibody expressing IL-7, CCL17 factor and/or PD-1, GM-CSF.
A CAR-T cell according to the third aspect of the invention transfected with a vector expressing a chimeric antigen receptor sequence according to any of the invention.
In a fourth aspect, the invention further provides a method of making a CAR-T cell, comprising the steps of:
(1) plasmid synthesis:
synthesizing CAR-19-1 plasmid by using vector pLVX-EF1a-IRES-PGK-puro, wherein the plasmid is composed of CD19 single-chain variable region, CD8a hinge region, CD8a transmembrane region, 4-1BB signal, envelope signal of CD3 zeta, IL-7, CCL17 sequence, and has the nucleotide sequence of sequence 1;
synthesizing CAR-19-2 plasmid using vector pLVX-EF1a-IRES-PGK-puro, the plasmid is composed of CD19 single-chain variable region, CD8a hinge region, CD8a transmembrane region, 4-1BB signal, and the encapsidation signal sequence of CD3 zeta, and has the nucleotide sequence described in sequence 3;
synthesizing a CAR-19-3 plasmid by using a vector pLVX-mCherry-C1, wherein the plasmid is composed of an anti-PD-1scFv single-chain variable region sequence and an anti-GM-CSF scFv single-chain variable region sequence and has a nucleotide sequence shown in a sequence 5;
(2) and (3) packaging the virus:
performing virus packaging by using an Invitrogen Lipofectamine 3000 transfection reagent, namely Lip3000, wherein a 293T culture medium is a DMEM-H culture medium added with 10% FBS, and a lentivirus packaging culture medium is an Opti-MEMI culture medium added with 1% GlutaMAX, 1mM sodium pyruvate and 5% FBS;
293T cells at 7X106The density of each cell/well was inoculated into a 10cm dish containing 12mL of lentivirus packaging medium and placed at 37 ℃ in 5% CO2Incubating the cells overnight under conditions until the 293T cell density reaches 95%;
the overnight incubated dishes were removed 6mL of lentivirus packaging medium per dish, 6mL of the liquid A-liquid B mixture was added to each dish, gently mixed to achieve uniform distribution, and placed at 37 ℃ in 5% CO2Incubating under the condition for transfection; after 6 hours of transfection, the 293T culture medium is replaced for continuous incubation;
24 hours after transfection, 12mL of cell supernatant was collected and 12mL of pre-warmed 293T medium was added and continued at 37 ℃ with 5% CO2Incubating under the condition for transfection;
collecting cell supernatant for the second time after 54 hours of transfection, and mixing the cell supernatant with the supernatant collected for the first time to obtain cell supernatant;
centrifuging the cell supernatant collected in the previous step at 2000rpm for 10 minutes at room temperature, removing cell debris precipitate, and filtering the supernatant with a 0.45 μm filter to obtain virus supernatant;
mixing the virus supernatant and the concentrated reagent according to the volume ratio of 5:1, incubating for 2h at 4 ℃, and then centrifuging at 4 ℃ until a precipitate (off-white) is formed at the bottom of a centrifugal tube;
carefully removing the supernatant, adding a proper volume of DMEM to resuspend and precipitate to obtain a lentivirus concentrated solution, and measuring the virus titer of the lentivirus concentrated solution;
(3) t cell preparation:
add biotin-labeled CD8 antibody to an EP tube containing 1mL of whole blood and mix for 30 minutes at room temperature;
adding 150 μ L of microvesicle to the whole blood 1mL, mixing at room temperature for 20 minutes, binding microvesicle to antibody-labeled cells, and centrifuging;
gently transferring the white microbubble layer into another 2mL EP tube by using a 200 μ L pipette, washing the microbubbles attached to the tube wall and the pipette tip by using 500 μ L microbubble buffer, merging into the EP tube, and incubating at room temperature for 30 min; the microbubble buffer is an aqueous solution comprising: potassium chloride 200mg/L, potassium dihydrogen phosphate 200mg/L, sodium chloride 8000mg/L, disodium hydrogen phosphate heptahydrate 2160mg/L, 1% human serum albumin, 2mM EDTA;
breaking bubble with ultrasonic wave, centrifuging, collecting cell precipitate, and making into CD8 as T cell+T cells, which are flow cytometrically identified;
(4) t cell activation, transduction and expansion:
collecting CD8+T cells at 5x105Each cell/mL was inoculated in a 24-well/6-well plate, stimulated with activation medium for 24-48 hours, followed by viral transduction by addition of lentiviral concentrate (MOI 10) and transduction medium, and 24-48 hours later switched to maintenance medium; when expanded to 6-8 days, CAR-T cells were harvested.
The method according to the fourth aspect of the present invention, wherein the solution A-solution B mixed solution is obtained by mixing solution A and solution B, and incubating at room temperature for 15 min; preparing solution A: returning the Opti-MEMI serum-reduced culture medium to room temperature, and uniformly mixing 1.5ml of Opti-MEMI and 41 mu L of Lip3000 in a 10cm dish to obtain solution A; preparing liquid B: mix 1.5ml of Opti-MEMI, 35. mu.L of P3000 Enhancer, and 12. mu.g of plasmid mixture to obtain solution B. (in the case of the transduction type CAR-1 ═ CAR-19-1) + (CAR-19-3) the plasmid ratio of the plasmid mixture is pmd2.g: pSPAX2 (CAR-19-1/CAR-19-3) ═ 1:3 (4/3), in the case of the transduction type CAR-2 ═ CAR-19-2) + (CAR-19-3) the plasmid ratio of the plasmid mixture is pmd2.g: pSPAX2 (CAR-19-2/CAR-19-3) ═ 1:3 (3.5/3), in the case of the transduction type CAR-3 ═ CAR (CAR-19-2) the plasmid ratio of the plasmid mixture is pmd2.g: pSPAX2: CAR-19-2 ═ 1:3:3.5, in the case of the transduction type CAR-4 ═ plasmid (CAR-19-1) the ratio of pmd 2: ps pax2: CAR-19-2 ═ 1:3:3.5, and in the case of the transduction type-4 ═ plasmid-19 (ps-19-1): 3:4).
The method according to the fourth aspect of the invention, wherein the activation Medium is X-VIVOTM15Medium comprising 30ng/mL anti-CD3 and 20ng/mL CD 28; the transduction Medium was X-VIVOTM15Medium containing 200U/mL IL-2 and 5. mu.g/mL Polybrene; the maintenance Medium was X-VIVOTM15Medium containing 200U/mL IL-2.
The method according to the fourth aspect of the present invention, wherein the microbubble buffer used in the preparation of the T cells is an aqueous solution comprising: potassium chloride 200mg/L, potassium dihydrogen phosphate 200mg/L, sodium chloride 8000mg/L, disodium hydrogen phosphate heptahydrate 2160mg/L, 1% human serum albumin (HAS), 2mM EDTA, sodium tartrate 25mg/L, proline 120 mg/L. As described herein, it was surprisingly found that CD8 was present in T cells obtained after treatment with a microvesicle buffer comprising both sodium tartrate and proline+The proportion of T cells to total mononuclear cells after sorting was significantly higher than without the addition of both reagents.
A method according to a fourth aspect of the invention has the operating steps as described in examples 1 to 4.
In a fifth aspect, the present invention provides a chimeric antigen receptor comprising:
a) an antigen binding domain as a first signal,
b) A transmembrane domain,
c) An intracellular transduction domain which functions as a second signal,
d) A third signal domain expressing IL-7 and CCL-17 cytokines, and
e) secretion neutralizes the fourth signal domain of the anti-PD-1, anti-GM-CSF scFv of PD-1, GM-CSF.
The chimeric antigen receptor according to the fifth aspect of the invention comprises a nucleotide sequence shown in sequence 1.
The chimeric antigen receptor according to the fifth aspect of the invention comprises an amino acid sequence shown in sequence 2.
The chimeric antigen receptor according to the fifth aspect of the invention comprises a nucleotide sequence shown in sequence 5.
The chimeric antigen receptor according to the fifth aspect of the invention comprises an amino acid sequence shown in sequence 6.
The chimeric antigen receptor according to the fifth aspect of the invention comprises nucleotide sequences shown in sequence 1 and sequence 5.
The chimeric antigen receptor according to the fifth aspect of the invention comprises amino acid sequences shown in sequence 2 and sequence 6.
In a sixth aspect, the present invention also provides a recombinant plasmid having the nucleotide sequence shown in sequence 1.
The sixth aspect of the invention also provides a recombinant plasmid, which has the nucleotide sequence shown as the sequence 5.
The sixth aspect of the invention also provides a recombinant plasmid, which comprises nucleotide sequences shown in sequence 1 and sequence 5.
In a seventh aspect, the present invention also provides a recombinant plasmid, which has the amino acid sequence shown in sequence 2.
The seventh aspect of the present invention also provides a recombinant plasmid, which has the amino acid sequence shown as sequence 6.
The seventh aspect of the invention also provides a recombinant plasmid, which comprises the amino acid sequences shown in the sequence 2 and the sequence 6.
In an eighth aspect, the invention also provides a CAR-T cell capable of secreting an antibody expressing IL-7, CCL17 factor and/or PD-1, GM-CSF.
A CAR-T cell according to the eighth aspect of the invention transfected with a chimeric antigen receptor sequence according to any of the invention.
In a ninth aspect, the invention further provides a method of making a CAR-T cell, for example a CAR-T cell of the eighth aspect of the invention, comprising the steps of:
(1) plasmid synthesis:
synthesizing a CAR-19-1 plasmid using a vector pLVX-EF1a-IRES-PGK-puro, the plasmid being composed of a CD19 single-chain variable region, a CD8a hinge region, a CD8a transmembrane region, a 4-1BB signal, an envelope signal of CD3 zeta, an IL-7, CCL17 sequence, and having a nucleotide sequence set forth in sequence 1 and an amino acid sequence set forth in sequence 2;
synthesizing CAR-19-2 plasmid by using vector pLVX-EF1a-IRES-PGK-puro, wherein the plasmid is composed of CD19 single-chain variable region, CD8a hinge region, CD8a transmembrane region, 4-1BB signal, and coating signal sequence of CD3 zeta, and has the nucleotide sequence described in sequence 3 and the amino acid sequence described in sequence 4;
synthesizing a CAR-19-3 plasmid by using a vector pLVX-mCherry-C1, wherein the plasmid is composed of an anti-PD-1scFv single-chain variable region sequence, an anti-GM-CSF scFv single-chain variable region sequence and has a nucleotide sequence shown in a sequence 5 and an amino acid sequence shown in a sequence 6;
(2) and (3) packaging the virus:
performing virus packaging by using an Invitrogen Lipofectamine 3000 transfection reagent, namely Lip3000, wherein a 293T culture medium is a DMEM-H culture medium added with 10% FBS, and a lentivirus packaging culture medium is an Opti-MEMI culture medium added with 1% GlutaMAX, 1mM sodium pyruvate and 5% FBS;
293T cells at 7X106The density of each cell/well was inoculated into a 10cm dish containing 12mL of lentivirus packaging medium and placed at 37 ℃ in 5% CO2Incubating the cells overnight under conditions until the 293T cell density reaches 95%;
the overnight incubated dishes were removed 6mL of lentivirus packaging medium per dish, 6mL of the liquid A-liquid B mixture was added to each dish, gently mixed to achieve uniform distribution, and placed at 37 ℃ in 5% CO2Incubating under the condition for transfection; 293T culture was changed 6 hours after transfectionContinuously incubating the culture medium;
24 hours after transfection, 12mL of cell supernatant was collected and 12mL of pre-warmed 293T medium was added and continued at 37 ℃ with 5% CO2Incubating under the condition for transfection;
collecting cell supernatant for the second time after 54 hours of transfection, and mixing the cell supernatant with the supernatant collected for the first time to obtain cell supernatant;
centrifuging the cell supernatant collected in the previous step at 2000rpm for 10 minutes at room temperature, removing cell debris precipitate, and filtering the supernatant with a 0.45 μm filter to obtain virus supernatant;
mixing the virus supernatant and the concentrated reagent according to the volume ratio of 5:1, incubating for 2h at 4 ℃, and then centrifuging at 4 ℃ until a precipitate (off-white) is formed at the bottom of a centrifugal tube;
carefully removing the supernatant, adding a proper volume of DMEM to resuspend and precipitate to obtain a lentivirus concentrated solution, and measuring the virus titer of the lentivirus concentrated solution;
(3) t cell preparation:
add biotin-labeled CD8 antibody to an EP tube containing 1mL of whole blood and mix for 30 minutes at room temperature;
adding 150 μ L of microvesicle to the whole blood 1mL, mixing at room temperature for 20 minutes, binding microvesicle to antibody-labeled cells, and centrifuging;
gently transferring the white microbubble layer into another 2mL EP tube by using a 200 μ L pipette, washing the microbubbles attached to the tube wall and the pipette tip by using 500 μ L microbubble buffer, merging into the EP tube, and incubating at room temperature for 30 min; the microbubble buffer is an aqueous solution comprising: potassium chloride 200mg/L, potassium dihydrogen phosphate 200mg/L, sodium chloride 8000mg/L, disodium hydrogen phosphate heptahydrate 2160mg/L, 1% human serum albumin, 2mM EDTA;
breaking bubble with ultrasonic wave, centrifuging, collecting cell precipitate, and making into CD8 as T cell+T cells, which are flow cytometrically identified;
(4) t cell activation, transduction and expansion:
collecting CD8+T cells at 5x105The individual cells/mL were seeded in 24-well/6-well plates and stimulated 24-48 with activation mediumThen adding lentivirus concentrated solution (MOI 10) and a transduction culture medium to perform virus transduction, and changing to a maintenance culture medium after 24-48 hours; when expanded to 6-8 days, CAR-T cells were harvested.
The method according to the fourth aspect of the present invention, wherein the solution A-solution B mixed solution is obtained by mixing solution A and solution B, and incubating at room temperature for 15 min; preparing solution A: returning the Opti-MEMI serum-reduced culture medium to room temperature, and uniformly mixing 1.5ml of Opti-MEMI and 41 mu L of Lip3000 in a 10cm dish to obtain solution A; preparing liquid B: mix 1.5ml of Opti-MEMI, 35. mu.L of P3000 Enhancer, and 12. mu.g of plasmid mixture to obtain solution B. (in the case of the transduction type CAR-1 ═ CAR-19-1) + (CAR-19-3) the plasmid ratio of the plasmid mixture is pmd2.g: pSPAX2 (CAR-19-1/CAR-19-3) ═ 1:3 (4/3), in the case of the transduction type CAR-2 ═ CAR-19-2) + (CAR-19-3) the plasmid ratio of the plasmid mixture is pmd2.g: pSPAX2 (CAR-19-2/CAR-19-3) ═ 1:3 (3.5/3), in the case of the transduction type CAR-3 ═ CAR (CAR-19-2) the plasmid ratio of the plasmid mixture is pmd2.g: pSPAX2: CAR-19-2 ═ 1:3:3.5, in the case of the transduction type CAR-4 ═ plasmid (CAR-19-1) the ratio of pmd 2: ps pax2: CAR-19-2 ═ 1:3:3.5, and in the case of the transduction type-4 ═ plasmid-19 (ps-19-1): 3:4).
The method according to the ninth aspect of the invention, wherein the activation Medium is X-VIVOTM15Medium comprising 30ng/mL anti-CD3 and 20ng/mL CD 28; the transduction Medium was X-VIVOTM15Medium containing 200U/mL IL-2 and 5. mu.g/mL Polybrene; the maintenance Medium was X-VIVOTM15Medium containing 200U/mL IL-2.
The method according to the ninth aspect of the present invention, wherein the microbubble buffer used in the preparation of the T cells is an aqueous solution comprising: 200mg/L potassium chloride, 200mg/L potassium dihydrogen phosphate, 8000mg/L sodium chloride, 2160mg/L disodium hydrogen phosphate heptahydrate, 1% human serum albumin (HAS), 2mM EDTA, 25mg/L potassium tartrate and 120mg/L proline. As described herein, it was surprisingly found that CD8 was present in T cells obtained after treatment with a microvesicle buffer comprising both potassium tartrate and proline+The proportion of T cells to total mononuclear cells after sorting was significantly higher than without the addition of both reagents.
A method according to a ninth aspect of the present invention has the steps as described in examples 1 to 4.
The tenth aspect of the invention also provides the use of a CAR-T cell, for example a CAR-T cell according to the third aspect of the invention and/or the eighth aspect of the invention, in the preparation of a cell therapeutic for the treatment of a tumour.
In an eleventh aspect, the present invention provides a chimeric antigen receptor comprising:
a) an antigen binding domain as a first signal,
b) A transmembrane domain,
c) An intracellular transduction domain as a second signal, and
e) secretion neutralizes the fourth signal domain of the anti-PD-1, anti-GM-CSF scFv of PD-1, GM-CSF.
The chimeric antigen receptor according to the eleventh aspect of the invention comprises a nucleotide sequence shown in sequence 3.
The chimeric antigen receptor according to the eleventh aspect of the invention comprises an amino acid sequence shown in sequence 4.
The chimeric antigen receptor according to the eleventh aspect of the invention comprises a nucleotide sequence shown in sequence No. 5.
The chimeric antigen receptor according to the eleventh aspect of the invention comprises an amino acid sequence shown in sequence 6.
The chimeric antigen receptor according to the eleventh aspect of the invention comprises a nucleotide sequence shown in sequence 3 and a nucleotide sequence shown in sequence 5.
The chimeric antigen receptor according to the eleventh aspect of the invention comprises a nucleotide sequence shown in sequence 4 and an amino acid sequence shown in sequence 6.
In a twelfth aspect, the invention also provides a recombinant plasmid, which has the nucleotide sequence shown as the sequence 3.
The twelfth aspect of the invention also provides a recombinant plasmid, which has the nucleotide sequence shown as the sequence 5.
The twelfth aspect of the invention also provides a recombinant plasmid, which comprises the nucleotide sequences shown in the sequence 3 and the sequence 5.
In a twelfth aspect, the invention also provides a recombinant plasmid, which has the amino acid sequence shown as the sequence 4.
The twelfth aspect of the invention also provides a recombinant plasmid, which has the amino acid sequence shown as the sequence 6.
The twelfth aspect of the invention also provides a recombinant plasmid, which comprises the amino acid sequences shown in the sequence 4 and the sequence 6.
In a thirteenth aspect, the invention also provides a CAR-T cell capable of secreting an antibody expressing IL-7, CCL17 factor and/or PD-1, GM-CSF.
A CAR-T cell according to the fourteenth aspect of the invention transfected with a chimeric antigen receptor sequence according to any of the invention.
In a ninth aspect, the invention further provides a method of making a CAR-T cell, for example a CAR-T cell of the fourteenth aspect of the invention, comprising the steps of:
(1) plasmid synthesis:
synthesizing a CAR-19-1 plasmid using a vector pLVX-EF1a-IRES-PGK-puro, the plasmid being composed of a CD19 single-chain variable region, a CD8a hinge region, a CD8a transmembrane region, a 4-1BB signal, an envelope signal of CD3 zeta, an IL-7, CCL17 sequence, and having a nucleotide sequence set forth in sequence 1 and an amino acid sequence set forth in sequence 2;
synthesizing CAR-19-2 plasmid by using vector pLVX-EF1a-IRES-PGK-puro, wherein the plasmid is composed of CD19 single-chain variable region, CD8a hinge region, CD8a transmembrane region, 4-1BB signal, and coating signal sequence of CD3 zeta, and has the nucleotide sequence described in sequence 3 and the amino acid sequence described in sequence 4;
synthesizing a CAR-19-3 plasmid by using a vector pLVX-mCherry-C1, wherein the plasmid is composed of an anti-PD-1scFv single-chain variable region sequence, an anti-GM-CSF scFv single-chain variable region sequence and has a nucleotide sequence shown in a sequence 5 and an amino acid sequence shown in a sequence 6;
(2) and (3) packaging the virus:
performing virus packaging by using an Invitrogen Lipofectamine 3000 transfection reagent, namely Lip3000, wherein a 293T culture medium is a DMEM-H culture medium added with 10% FBS, and a lentivirus packaging culture medium is an Opti-MEMI culture medium added with 1% GlutaMAX, 1mM sodium pyruvate and 5% FBS;
293T cells at 7X106The density of each cell/well was inoculated into a 10cm dish containing 12mL of lentivirus packaging medium and placed at 37 ℃ in 5% CO2Incubating the cells overnight under conditions until the 293T cell density reaches 95%;
the overnight incubated dishes were removed 6mL of lentivirus packaging medium per dish, 6mL of the liquid A-liquid B mixture was added to each dish, gently mixed to achieve uniform distribution, and placed at 37 ℃ in 5% CO2Incubating under the condition for transfection; after 6 hours of transfection, the 293T culture medium is replaced for continuous incubation;
24 hours after transfection, 12mL of cell supernatant was collected and 12mL of pre-warmed 293T medium was added and continued at 37 ℃ with 5% CO2Incubating under the condition for transfection;
collecting cell supernatant for the second time after 54 hours of transfection, and mixing the cell supernatant with the supernatant collected for the first time to obtain cell supernatant;
centrifuging the cell supernatant collected in the previous step at 2000rpm for 10 minutes at room temperature, removing cell debris precipitate, and filtering the supernatant with a 0.45 μm filter to obtain virus supernatant;
mixing the virus supernatant and the concentrated reagent according to the volume ratio of 5:1, incubating for 2h at 4 ℃, and then centrifuging at 4 ℃ until a precipitate (off-white) is formed at the bottom of a centrifugal tube;
carefully removing the supernatant, adding a proper volume of DMEM to resuspend and precipitate to obtain a lentivirus concentrated solution, and measuring the virus titer of the lentivirus concentrated solution;
(3) t cell preparation:
add biotin-labeled CD8 antibody to an EP tube containing 1mL of whole blood and mix for 30 minutes at room temperature;
adding 150 μ L of microvesicle to the whole blood 1mL, mixing at room temperature for 20 minutes, binding microvesicle to antibody-labeled cells, and centrifuging;
gently transferring the white microbubble layer into another 2mL EP tube by using a 200 μ L pipette, washing the microbubbles attached to the tube wall and the pipette tip by using 500 μ L microbubble buffer, merging into the EP tube, and incubating at room temperature for 30 min; the microbubble buffer is an aqueous solution comprising: potassium chloride 200mg/L, potassium dihydrogen phosphate 200mg/L, sodium chloride 8000mg/L, disodium hydrogen phosphate heptahydrate 2160mg/L, 1% human serum albumin, 2mM EDTA;
breaking bubble with ultrasonic wave, centrifuging, collecting cell precipitate, and making into CD8 as T cell+T cells, which are flow cytometrically identified;
(4) t cell activation, transduction and expansion:
collecting CD8+T cells at 5x105Each cell/mL was inoculated in a 24-well/6-well plate, stimulated with activation medium for 24-48 hours, followed by viral transduction by addition of lentiviral concentrate (MOI 10) and transduction medium, and 24-48 hours later switched to maintenance medium; when expanded to 6-8 days, CAR-T cells were harvested.
The method according to the fourteenth aspect of the present invention, wherein the liquid A-liquid B mixed solution is obtained by mixing liquid A and liquid B, and incubating at room temperature for 15 min; preparing solution A: returning the Opti-MEMI serum-reduced culture medium to room temperature, and uniformly mixing 1.5ml of Opti-MEMI and 41 mu L of Lip3000 in a 10cm dish to obtain solution A; preparing liquid B: mix 1.5ml of Opti-MEMI, 35. mu.L of P3000 Enhancer, and 12. mu.g of plasmid mixture to obtain solution B. (the plasmid ratio of the plasmid mixture in the case of transduction type CAR-2 ═ CAR-19-2) + (CAR-19-3) pmd2.g: pSPAX2 (CAR-19-2/CAR-19-3) ═ 1:3 (3.5/3)).
The method according to the fourteenth aspect of the invention, wherein the activation Medium is X-VIVOTM15Medium comprising 30ng/mL anti-CD3 and 20ng/mL CD 28; the transduction Medium was X-VIVOTM15Medium containing 200U/mL IL-2 and 5. mu.g/mL Polybrene; the maintenance Medium was X-VIVOTM15Medium containing 200U/mL IL-2.
The method according to the fourteenth aspect of the present invention, wherein the microbubble buffer used in the preparation of the T cells is an aqueous solution comprising: potassium chloride 200mg/L, potassium dihydrogen phosphate 200mg/L, sodium chloride 8000mg/L, disodium hydrogen phosphate heptahydrate 2160mg/L, 1% human serum albumin (HAS), 2mM EDTA, potassium sodium tartrate 25mg/L, proline 120 mg/L. As described herein, it was surprisingly found that CD8 was present in T cells obtained after treatment with a microvesicle buffer comprising both potassium sodium tartrate and proline+Ratio of T cells to total mononuclear cells after sortingThe case is significantly higher than the case without the addition of both reagents.
A method according to a fourteenth aspect of the present invention has the operation steps as described in examples 1 to 4.
The fifteenth aspect of the invention also provides the use of a CAR-T cell, for example a CAR-T cell according to the third aspect of the invention and/or the eighth aspect of the invention and/or the thirteenth aspect of the invention, in the preparation of a cell therapeutic for the treatment of a tumour.
Various aspects of the present invention exhibit superior technical effects.
Detailed Description
The following examples, which are intended to be illustrative only and not limiting, and which are intended to be commercially available as reagents and materials with no specific description.
Some of the main experimental materials used in the present invention include: Endo-Free Plasmid Maxi Kit (Omega), NaCl, peptone, EDTA, NaoH, yeast powder (Shanghai Biotech Co., Ltd.), competent Stbl3 (gold Biotech Co., Ltd.), lip3000 transfection reagent (containing P3000 Enhancer), Opti-MEM serum-reduced medium, sodium pyruvate, DMEM-H, calcein AM (ThermoFisher), DiI cell membrane fluorescent probe (meilunbio), HIV-1P24 protein rapid test card, lentivirus titer (HIV P24) ELISA test reagent (Orlon), Polybrene (syngeneic gene), biogeok TM lentivirus concentration Kit (syngeneic gene), Millipore disposable needle 0.45 μm (Millipore), 96, 24-well plate, 6-well plate, 10CM, T25 culture bottle, T75 culture bottle, 5ml, 10ml LORI-25 pipette (Corythro) and pipette (Biochemical) 29-Biotechnology), and pipette (Biochemical pipette 25-Biochemical) and pipette (Biochemical pipette 25) and Biochemical pipette (Biochemical) Ultra-LEAF Purified anti-mouse CD3 epsilon (Biolegend), IL-2(Peprotech), BD PharmingenTMBiotin Mouse Anti-Human CD8、PerCP-CyTM5.5Mouse Anti-Human CD8(BD), lentiviral vector (vast Ling Bio), sequence Synthesis (general purpose organism), GM-CSF ELISA kit (Abcam). The remaining common reagents and materials are commercially available.
Example 1: construction of recombinant plasmids
1. CAR-19-1 plasmid Synthesis:
the CAR-19-1 sequence is composed of a CD19 single-chain variable region, a CD8a hinge region, a CD8a transmembrane region, a 4-1BB signal, a CD3 zeta envelope signal, IL-7 and a CCL17 sequence, the vector used is pLVX-EF1a-IRES-PGK-puro, and the vector is synthesized by the general biological system (Anhui) limited company.
The CAR-19-1 nucleotide sequence is as follows (which may be referred to as sequence 1 in the present invention):
ATGGCCCTGCCCGTGACCGCTCTGCTGCTGCCACTGGCCCTGCTGCTGCACGCCGCTAGACCTGAGGTGAAGCTGCAGGAGTCCGGCCCTGGCCTGGTGGCTCCTTCCCAGTCCCTGAGCGTGACCTGTACAGTGTCCGGCGTGTCCCTGCCTGATTACGGCGTGTCCTGGATCAGGCAGCCTCCCAGAAAGGGCCTGGAGTGGCTGGGCGTGATCTGGGGCTCCGAGACAACCTACTACAATTCCGCCCTGAAGTCCAGGCTGACAATCATCAAGGACAATAGCAAGAGCCAGGTGTTTCTGAAGATGAACTCCCTGCAGACAGACGACACCGCCATCTACTACTGCGCCAAGCACTACTACTACGGCGGCTCCTACGCCATGGATTACTGGGGCCAGGGCACCAGCGTGACAGTGTCCTCCGGCGGCGGCGGAAGCGGAGGAGGAGGATCTGGCGGCGGCGGTTCCGATATCCAGATGACCCAGACAACAAGCAGCCTGTCCGCCTCCCTGGGCGACAGAGTGACCATCTCCTGCAGGGCCTCCCAGGACATCAGCAAGTACCTGAACTGGTACCAGCAGAAGCCCGATGGCACCGTGAAGCTGCTGATCTACCACACCTCCAGACTGCACTCCGGCGTGCCTTCCAGATTTTCCGGCTCCGGCAGCGGCACCGACTACAGCCTGACCATCAGCAACCTGGAGCAGGAGGACATCGCCACCTACTTTTGCCAGCAGGGCAATACCCTGCCTTACACCTTTGGCGGCGGCACAAAGCTGGAGATCACAAGGGCCGATGCCGCCCCCACAGTGAGCATCTTTCCCCCTAGCTCCAACGCCAAGCCCACAACAACCCCTGCCCCTAGACCCCCCACACCCGCTCCTACCATCGCCAGCCAGCCTCTGAGCCTGAGACCTGAGGCCTGTAGGCCCGCCGCCGGAGGAGCTGTTCACACAAGGGGCCTGGACTTTGCCTGCGACATCTACATCTGGGCCCCCCTGGCCGGCACCTGTGGAGTTCTGCTGCTGAGCCTGGTCATTACCAAGAGGGGCAGAAAGAAGCTGCTGTACATCTTCAAGCAGCCTTTCATGAGACCCGTGCAGACAACCCAGGAGGAGGACGGCTGCAGCTGCAGATTCCCTGAGGAGGAGGAGGGCGGCTGTGAGCTGAGGGTGAAGTTCTCCAGGAGCGCCGACGCCCCCGCCTACCAACAGGGACAGAATCAGCTGTACAATGAGCTGAACCTGGGCAGAAGAGAGGAGTACGACGTGCTGGACAAGAGGAGGGGCAGGGACCCTGAGATGGGCGGCAAGCCCCAGAGGAGGAAGAATCCCCAGGAGGGCCTGTACAATGAACTGCAGAAGGACAAGATGGCCGAGGCCTACAGCGAGATCGGCATGAAGGGCGAGAGGAGGAGAGGCAAGGGCCACGATGGCCTGTACCAGGGCCTGTCCACCGCCACAAAGGACACCTACGACGCCCTGCACATGCAGGCCCTGCCCCCAAGAGGAAGCGGAGCCACCAATTTCAGCCTGCTGAAGCAGGCCGGCGACGTGGAGGAGAACCCCGGACCTATGTTCCATGTTTCTTTTAGGTATATCTTTGGACTTCCTCCCCTGATCCTTGTTCTGTTGCCAGTAGCATCATCTGATTGTGATATTGAAGGTAAAGATGGCAAACAATATGAGAGTGTTCTAATGGTCAGCATCGATCAATTATTGGACAGCATGAAAGAAATTGGTAGCAATTGCCTGAATAATGAATTTAACTTTTTTAAAAGACATATCTGTGATGCTAATAAGGAAGGTATGTTTTTATTCCGTGCTGCTCGCAAGTTGAGGCAATTTCTTAAAATGAATAGCACTGGTGATTTTGATCTCCACTTATTAAAAGTTTCAGAAGGCACAACAATACTGTTGAACTGCACTGGCCAGGTTAAAGGAAGAAAACCAGCTGCCCTGGGTGAAGCCCAACCAACAAAGAGTTTGGAAGAAAATAAATCTTTAAAGGAACAGAAAAAACTGAATGACTTGTGTTTCCTAAAGAGACTATTACAAGAGATAAAAACTTGTTGGAATAAAATTTTGATGGGCACTAAAGAACACGGCTCCGGCGAAGGCAGAGGCTCTTTACTGACTTGTGGAGACGTGGAAGAGAACCCCGGTCCCATGGCCCCACTGAAGATGCTGGCCCTGGTCACCCTCCTCCTGGGGGCTTCTCTGCAGCACATCCACGCAGCTCGAGGGACCAATGTGGGCCGGGAGTGCTGCCTGGAGTACTTCAAGGGAGCCATTCCCCTTAGAAAGCTGAAGACGTGGTACCAGACATCTGAGGACTGCTCCAGGGATGCCATCGTTTTTGTAACTGTGCAGGGCAGGGCCATCTGTTCGGACCCCAACAACAAGAGAGTGAAGAATGCAGTTAAATACCTGCAAAGCCTTGAGAGGTCT
the amino acid sequence of CAR-19-1 expression (which may be referred to as sequence 2 in the present invention):
Met Ala Leu Pro Val Thr Ala Leu Leu Leu Pro Leu Ala Leu Leu Leu His Ala Ala Arg Pro Glu Val Lys Leu Gln Glu Ser Gly Pro Gly Leu Val Ala Pro Ser Gln Ser Leu Ser Val Thr Cys Thr Val Ser Gly Val Ser Leu Pro Asp Tyr Gly Val Ser Trp Ile Arg Gln Pro Pro Arg Lys Gly Leu Glu Trp Leu Gly Val Ile Trp Gly Ser Glu Thr Thr Tyr Tyr Asn Ser Ala Leu Lys Ser Arg Leu Thr Ile Ile Lys Asp Asn Ser Lys Ser Gln Val Phe Leu Lys Met Asn Ser Leu Gln Thr Asp Asp Thr Ala Ile Tyr Tyr Cys Ala Lys His Tyr Tyr Tyr Gly Gly Ser Tyr Ala Met Asp Tyr Trp Gly Gln Gly Thr Ser Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Asp Ile Gln Met Thr Gln Thr Thr Ser Ser Leu Ser Ala Ser Leu Gly Asp Arg Val Thr Ile Ser Cys Arg Ala Ser Gln Asp Ile Ser Lys Tyr Leu Asn Trp Tyr Gln Gln Lys Pro Asp Gly Thr Val Lys Leu Leu Ile Tyr His Thr Ser Arg Leu His Ser Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Tyr Ser Leu Thr Ile Ser Asn Leu Glu Gln Glu Asp Ile Ala Thr Tyr Phe Cys Gln Gln Gly Asn Thr Leu Pro Tyr Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Thr Arg Ala Asp Ala Ala Pro Thr Val Ser Ile Phe Pro Pro Ser Ser Asn Ala Lys Pro Thr Thr Thr Pro Ala Pro Arg Pro Pro Thr Pro Ala Pro Thr Ile Ala Ser Gln Pro Leu Ser Leu Arg Pro Glu Ala Cys Arg Pro Ala Ala Gly Gly Ala Val His Thr Arg Gly Leu Asp Phe Ala Cys Asp Ile Tyr Ile Trp Ala Pro Leu Ala Gly Thr Cys Gly Val Leu Leu Leu Ser Leu Val Ile Thr Lys Arg Gly Arg Lys Lys Leu Leu Tyr Ile Phe Lys Gln Pro Phe Met Arg Pro Val Gln Thr Thr Gln Glu Glu Asp Gly Cys Ser Cys Arg Phe Pro Glu Glu Glu Glu Gly Gly Cys Glu Leu Arg Val Lys Phe Ser Arg Ser Ala Asp Ala Pro Ala Tyr Gln Gln Gly Gln Asn Gln Leu Tyr Asn Glu Leu Asn Leu Gly Arg Arg Glu Glu Tyr Asp Val Leu Asp Lys Arg Arg Gly Arg Asp Pro Glu Met Gly Gly Lys Pro Gln Arg Arg Lys Asn Pro Gln Glu Gly Leu Tyr Asn Glu Leu Gln Lys Asp Lys Met Ala Glu Ala Tyr Ser Glu Ile Gly Met Lys Gly Glu Arg Arg Arg Gly Lys Gly His Asp Gly Leu Tyr Gln Gly Leu Ser Thr Ala Thr Lys Asp Thr Tyr Asp Ala Leu His Met Gln Ala Leu Pro Pro Arg Gly Ser Gly Ala Thr Asn Phe Ser Leu Leu Lys Gln Ala Gly Asp Val Glu Glu Asn Pro Gly Pro Met Phe His Val Ser Phe Arg Tyr Ile Phe Gly Leu Pro Pro Leu Ile Leu Val Leu Leu Pro Val Ala Ser Ser Asp Cys Asp Ile Glu Gly Lys Asp Gly Lys Gln Tyr Glu Ser Val Leu Met Val Ser Ile Asp Gln Leu Leu Asp Ser Met Lys Glu Ile Gly Ser Asn Cys Leu Asn Asn Glu Phe Asn Phe Phe Lys Arg His Ile Cys Asp Ala Asn Lys Glu Gly Met Phe Leu Phe Arg Ala Ala Arg Lys Leu Arg Gln Phe Leu Lys Met Asn Ser Thr Gly Asp Phe Asp Leu His Leu Leu Lys Val Ser Glu Gly Thr Thr Ile Leu Leu Asn Cys Thr Gly Gln Val Lys Gly Arg Lys Pro Ala Ala Leu Gly Glu Ala Gln Pro Thr Lys Ser Leu Glu Glu Asn Lys Ser Leu Lys Glu Gln Lys Lys Leu Asn Asp Leu Cys Phe Leu Lys Arg Leu Leu Gln Glu Ile Lys Thr Cys Trp Asn Lys Ile Leu Met Gly Thr Lys Glu His Gly Ser Gly Glu Gly Arg Gly Ser Leu Leu Thr Cys Gly Asp Val Glu Glu Asn Pro Gly Pro Met Ala Pro Leu Lys Met Leu Ala Leu Val Thr Leu Leu Leu Gly Ala Ser Leu Gln His Ile His Ala Ala Arg Gly Thr Asn Val Gly Arg Glu Cys Cys Leu Glu Tyr Phe Lys Gly Ala Ile Pro Leu Arg Lys Leu Lys Thr Trp Tyr Gln Thr Ser Glu Asp Cys Ser Arg Asp Ala Ile Val Phe Val Thr Val Gln Gly Arg Ala Ile Cys Ser Asp Pro Asn Asn Lys Arg Val Lys Asn Ala Val Lys Tyr Leu Gln Ser Leu Glu Arg Ser
2. CAR-19-2 plasmid Synthesis:
the CAR-19-2 sequence is composed of a CD19 single-chain variable region, a CD8a hinge region, a CD8a transmembrane region, a 4-1BB signal and a CD3 zeta envelope signal sequence, the vector is pLVX-EF1a-IRES-PGK-puro, and the vector is synthesized by general biological systems (Anhui) Inc.
The CAR-19-2 nucleotide sequence is as follows (which may be referred to as sequence 3 in the present invention):
ATGGCCCTGCCCGTGACCGCTCTGCTGCTGCCACTGGCCCTGCTGCTGCACGCCGCTAGACCTGAGGTGAAGCTGCAGGAGTCCGGCCCTGGCCTGGTGGCTCCTTCCCAGTCCCTGAGCGTGACCTGTACAGTGTCCGGCGTGTCCCTGCCTGATTACGGCGTGTCCTGGATCAGGCAGCCTCCCAGAAAGGGCCTGGAGTGGCTGGGCGTGATCTGGGGCTCCGAGACAACCTACTACAATTCCGCCCTGAAGTCCAGGCTGACAATCATCAAGGACAATAGCAAGAGCCAGGTGTTTCTGAAGATGAACTCCCTGCAGACAGACGACACCGCCATCTACTACTGCGCCAAGCACTACTACTACGGCGGCTCCTACGCCATGGATTACTGGGGCCAGGGCACCAGCGTGACAGTGTCCTCCGGCGGCGGCGGAAGCGGAGGAGGAGGATCTGGCGGCGGCGGTTCCGATATCCAGATGACCCAGACAACAAGCAGCCTGTCCGCCTCCCTGGGCGACAGAGTGACCATCTCCTGCAGGGCCTCCCAGGACATCAGCAAGTACCTGAACTGGTACCAGCAGAAGCCCGATGGCACCGTGAAGCTGCTGATCTACCACACCTCCAGACTGCACTCCGGCGTGCCTTCCAGATTTTCCGGCTCCGGCAGCGGCACCGACTACAGCCTGACCATCAGCAACCTGGAGCAGGAGGACATCGCCACCTACTTTTGCCAGCAGGGCAATACCCTGCCTTACACCTTTGGCGGCGGCACAAAGCTGGAGATCACAAGGGCCGATGCCGCCCCCACAGTGAGCATCTTTCCCCCTAGCTCCAACGCCAAGCCCACAACAACCCCTGCCCCTAGACCCCCCACACCCGCTCCTACCATCGCCAGCCAGCCTCTGAGCCTGAGACCTGAGGCCTGTAGGCCCGCCGCCGGAGGAGCTGTTCACACAAGGGGCCTGGACTTTGCCTGCGACATCTACATCTGGGCCCCCCTGGCCGGCACCTGTGGAGTTCTGCTGCTGAGCCTGGTCATTACCAAGAGGGGCAGAAAGAAGCTGCTGTACATCTTCAAGCAGCCTTTCATGAGACCCGTGCAGACAACCCAGGAGGAGGACGGCTGCAGCTGCAGATTCCCTGAGGAGGAGGAGGGCGGCTGTGAGCTGAGGGTGAAGTTCTCCAGGAGCGCCGACGCCCCCGCCTACCAACAGGGACAGAATCAGCTGTACAATGAGCTGAACCTGGGCAGAAGAGAGGAGTACGACGTGCTGGACAAGAGGAGGGGCAGGGACCCTGAGATGGGCGGCAAGCCCCAGAGGAGGAAGAATCCCCAGGAGGGCCTGTACAATGAACTGCAGAAGGACAAGATGGCCGAGGCCTACAGCGAGATCGGCATGAAGGGCGAGAGGAGGAGAGGCAAGGGCCACGATGGCCTGTACCAGGGCCTGTCCACCGCCACAAAGGACACCTACGACGCCCTGCACATGCAGGCCCTGCCCCCAAGA
the amino acid sequence of CAR-19-2 expression is as follows (which may be referred to as sequence 4 in the present invention):
Met Ala Leu Pro Val Thr Ala Leu Leu Leu Pro Leu Ala Leu Leu Leu His Ala Ala Arg Pro Glu Val Lys Leu Gln Glu Ser Gly Pro Gly Leu Val Ala Pro Ser Gln Ser Leu Ser Val Thr Cys Thr Val Ser Gly Val Ser Leu Pro Asp Tyr Gly Val Ser Trp Ile Arg Gln Pro Pro Arg Lys Gly Leu Glu Trp Leu Gly Val Ile Trp Gly Ser Glu Thr Thr Tyr Tyr Asn Ser Ala Leu Lys Ser Arg Leu Thr Ile Ile Lys Asp Asn Ser Lys Ser Gln Val Phe Leu Lys Met Asn Ser Leu Gln Thr Asp Asp Thr Ala Ile Tyr Tyr Cys Ala Lys His Tyr Tyr Tyr Gly Gly Ser Tyr Ala Met Asp Tyr Trp Gly Gln Gly Thr Ser Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Asp Ile Gln Met Thr Gln Thr Thr Ser Ser Leu Ser Ala Ser Leu Gly Asp Arg Val Thr Ile Ser Cys Arg Ala Ser Gln Asp Ile Ser Lys Tyr Leu Asn Trp Tyr Gln Gln Lys Pro Asp Gly Thr Val Lys Leu Leu Ile Tyr His Thr Ser Arg Leu His Ser Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Tyr Ser Leu Thr Ile Ser Asn Leu Glu Gln Glu Asp Ile Ala Thr Tyr Phe Cys Gln Gln Gly Asn Thr Leu Pro Tyr Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Thr Arg Ala Asp Ala Ala Pro Thr Val Ser Ile Phe Pro Pro Ser Ser Asn Ala Lys Pro Thr Thr Thr Pro Ala Pro Arg Pro Pro Thr Pro Ala Pro Thr Ile Ala Ser Gln Pro Leu Ser Leu Arg Pro Glu Ala Cys Arg Pro Ala Ala Gly Gly Ala Val His Thr Arg Gly Leu Asp Phe Ala Cys Asp Ile Tyr Ile Trp Ala Pro Leu Ala Gly Thr Cys Gly Val Leu Leu Leu Ser Leu Val Ile Thr Lys Arg Gly Arg Lys Lys Leu Leu Tyr Ile Phe Lys Gln Pro Phe Met Arg Pro Val Gln Thr Thr Gln Glu Glu Asp Gly Cys Ser Cys Arg Phe Pro Glu Glu Glu Glu Gly Gly Cys Glu Leu Arg Val Lys Phe Ser Arg Ser Ala Asp Ala Pro Ala Tyr Gln Gln Gly Gln Asn Gln Leu Tyr Asn Glu Leu Asn Leu Gly Arg Arg Glu Glu Tyr Asp Val Leu Asp Lys Arg Arg Gly Arg Asp Pro Glu Met Gly Gly Lys Pro Gln Arg Arg Lys Asn Pro Gln Glu Gly Leu Tyr Asn Glu Leu Gln Lys Asp Lys Met Ala Glu Ala Tyr Ser Glu Ile Gly Met Lys Gly Glu Arg Arg Arg Gly Lys Gly His Asp Gly Leu Tyr Gln Gly Leu Ser Thr Ala Thr Lys Asp Thr Tyr Asp Ala Leu His Met Gln Ala Leu Pro Pro Arg
3. CAR-19-3 plasmid Synthesis:
the CAR-19-3 sequence is composed of an anti-PD-1scFv single-chain variable region and an anti-GM-CSF scFv single-chain variable region, the vector is pLVX-mCherry-C1, and the vector is synthesized by general biological systems (Anhui) Inc.
The CAR-19-3 nucleotide sequence is as follows (which may be referred to as sequence 5 in the present invention):
ATGGCCCTGCCTGTGACCGCCCTGCTGCTGCCACTGGCCCTGCTGCTCCACGCCGCTAGACCTCAGGTGCAGCTGGTGCAGTCCGGCGTGGAGGTGAAGAAGCCCGGCGCCTCCGTGAAGGTGTCCTGCAAGGCCTCCGGCTACACCTTTACAAATTACTACATGTACTGGGTGAGGCAGGCCCCCGGCCAGGGACTGGAATGGATGGGCGGCATCAATCCCTCCAATGGCGGCACAAACTTTAACGAGAAGTTTAAGAACAGGGTGACCCTGACCACCGATAGCTCCACCACAACAGCCTACATGGAGCTGAAGTCCCTGCAGTTCGATGATACCGCCGTGTACTACTGTGCCAGGAGGGACTACAGGTTTGATATGGGCTTCGATTACTGGGGCCAGGGCACCACCGTGACCGTGTCCTCCGGCGGAGGCGGAAGCGGAGGAGGAGGAAGCGGCGGAGGCGGTAGCGAGATCGTGCTGACACAGAGCCCTGCCACACTGTCCCTGTCCCCTGGCGAGAGAGCCACCCTGAGCTGCAGAGCCTCCAAGGGCGTGAGCACCTCCGGCTACAGCTACCTGCACTGGTACCAGCAGAAGCCCGGCCAGGCCCCCAGGCTGCTGATCTACCTGGCCTCCTACCTGGAGTCCGGCGTGCCCGCTAGATTCTCCGGCTCCGGCAGCGGCACCGATTTTACCCTGACAATCTCCAGCCTGGAGCCTGAGGACTTCGCCGTGTACTATTGTCAGCACTCCAGGGATCTGCCTCTGACCTTTGGCGGCGGCACCAAGGTGGAGATCAAGGGCTCCGGCGCCACAAACTTTAGCCTGCTGAAGCAGGCCGGCGACGTGGAGGAGAACCCTGGCCCACAGGTGCAGCTCGTGCAGTCCGGAGCCGAGGTGAAGAAACCCGGCGCCAGCGTGAAGGTGAGCTGCAAGGCCAGCGGCTACACCTTCACCGGCTACTACATGCACTGGGTGAGACAGGCCCCCGGACAGGGCCTGGAGTGGATGGGATGGATCAATCCTAACAGCGGCGGCACCAATTACGCCCAGAAGTTCCAGGGCAGGGTGACAATGACAAGGGATACCTCCATCAGCACCGCCTACATGGAACTGAGCAGGCTGAGAAGCGACGACACAGCCGTGTACTACTGCGTGAGAAGAGATAGGTTTCCCTACTACTTTGATTACTGGGGACAGGGCACCCTGGTGACCGTGAGCTCCGGCGGAGGAGGCTCCGGAGGAGGAGGTAGCGGCGGAGGAGGATCTGAGATCGTGCTCACCCAGTCCCCCGCCACCCTGTCCGTGTCCCCTGGAGAGAGGGCCACACTGAGCTGTAGAGCCTCCCAGAGCATCGGCTCCAATCTGGCCTGGTACCAGCAAAAGCCTGGCCAGGCCCCAAGGGTGCTGATCTACTCCACCTCCTCCAGGGCCACAGGCATCACAGATAGGTTTAGCGGCTCCGGCTCCGGAACCGATTTCACCCTGACCATCAGCAGACTGGAGCCCGAGGACTTCGCTGTGTACTACTGCCAGCAGTTTAATAGATCCCCCCTGACCTTCGGCGGCGGCACAAAGGTGGAGATTAAG
the amino acid sequence of CAR-19-3 expression is as follows (which may be referred to as sequence 6 in the present invention):
Met Ala Leu Pro Val Thr Ala Leu Leu Leu Pro Leu Ala Leu Leu Leu His Ala Ala Arg Pro Gln Val Gln Leu Val Gln Ser Gly Val Glu Val Lys Lys Pro Gly Ala Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asn Tyr Tyr Met Tyr Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met Gly Gly Ile Asn Pro Ser Asn Gly Gly Thr Asn Phe Asn Glu Lys Phe Lys Asn Arg Val Thr Leu Thr Thr Asp Ser Ser Thr Thr Thr Ala Tyr Met Glu Leu Lys Ser Leu Gln Phe Asp Asp Thr Ala Val Tyr Tyr Cys Ala Arg Arg Asp Tyr Arg Phe Asp Met Gly Phe Asp Tyr Trp Gly Gln Gly Thr Thr Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Glu Ile Val Leu Thr Gln Ser Pro Ala Thr Leu Ser Leu Ser Pro Gly Glu Arg Ala Thr Leu Ser Cys Arg Ala Ser Lys Gly Val Ser Thr Ser Gly Tyr Ser Tyr Leu His Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Arg Leu Leu Ile Tyr Leu Ala Ser Tyr Leu Glu Ser Gly Val Pro Ala Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Glu Pro Glu Asp Phe Ala Val Tyr Tyr Cys Gln His Ser Arg Asp Leu Pro Leu Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys Gly Ser Gly Ala Thr Asn Phe Ser Leu Leu Lys Gln Ala Gly Asp Val Glu Glu Asn Pro Gly Pro Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Gly Tyr Tyr Met His Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met Gly Trp Ile Asn Pro Asn Ser Gly Gly Thr Asn Tyr Ala Gln Lys Phe Gln Gly Arg Val Thr Met Thr Arg Asp Thr Ser Ile Ser Thr Ala Tyr Met Glu Leu Ser Arg Leu Arg Ser Asp Asp Thr Ala Val Tyr Tyr Cys Val Arg Arg Asp Arg Phe Pro Tyr Tyr Phe Asp Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Glu Ile Val Leu Thr Gln Ser Pro Ala Thr Leu Ser Val Ser Pro Gly Glu Arg Ala Thr Leu Ser Cys Arg Ala Ser Gln Ser Ile Gly Ser Asn Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Arg Val Leu Ile Tyr Ser Thr Ser Ser Arg Ala Thr Gly Ile Thr Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Arg Leu Glu Pro Glu Asp Phe Ala Val Tyr Tyr Cys Gln Gln Phe Asn Arg Ser Pro Leu Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys
example 2: virus package
The virus packaging was performed using Invitrogen Lipofectamine 3000 transfection reagent (Lip3000), and the experimental procedures were essentially performed with reference to the transfection reagent instructions.
1. 293T Medium configuration
The culture medium was DMEM-H supplemented with 10% FBS. (DMEM-H was DMEM medium supplemented with 4.5g/L glucose and 110mg/L sodium pyruvate).
2. And (3) slow virus packaging culture medium preparation:
the medium was Opti-MEMI, supplemented with 1% GlutaMAX, sodium pyruvate (1mM), 5% FBS. (Opti-MEMI medium is Gibco product).
3. And (3) slow virus packaging:
A) 293T cells at 7X106The density of each cell/well was inoculated into a 10cm dish containing 12mL of lentivirus packaging medium and placed at 37 ℃ in 5% CO2Cells were incubated under conditions overnight.
B) And (3) performing transfection when the density of 293T cells reaches 95%, wherein the transfection method comprises the following steps:
preparing solution A: firstly, recovering an Opti-MEMI serum-reducing culture medium to room temperature, and uniformly mixing 1.5ml of Opti-MEMI and 41 mu L of Lip3000 in a 10cm dish to obtain a solution A for later use;
preparing liquid B: mixing 1.5ml of Opti-MEMI, 35 mu L of P3000 Enhancer and 12 mu g of plasmid mixture to obtain solution B for later use; (in the case of the transduction type CAR-1 ═ CAR-19-1) + (CAR-19-3) the plasmid ratio of the plasmid mixture is pmd2.g: pSPAX2 (CAR-19-1/CAR-19-3) ═ 1:3 (4/3), in the case of the transduction type CAR-2 ═ CAR-19-2) + (CAR-19-3) the plasmid ratio of the plasmid mixture is pmd2.g: pSPAX2 (CAR-19-2/CAR-19-3) ═ 1:3 (3.5/3), in the case of the transduction type CAR-3 ═ CAR (CAR-19-2) the plasmid ratio of the plasmid mixture is pmd2.g: pSPAX2: CAR-19-2 ═ 1:3:3.5, in the case of the transduction type CAR-4 ═ plasmid (CAR-19-1) the ratio of pmd 2: ps pax2: CAR-19-2 ═ 1:3:3.5, and in the case of the transduction type-4 ═ plasmid-19 (ps-19-1): 3:4, PMD2.G, pSPAX2, pLVX-EF1a-IRES-PGK-puro and pLVX-mCherry-C1 are all products of vast Ling Bio Inc
Transferring the solution A to the solution B, mixing well, and incubating at room temperature for 15min to obtain a solution A-solution B mixed solution;
step A) overnight incubated dishes were removed 6mL of lentivirus packaging medium per dish, then 6mL of liquid A-liquid B mixture was added to each dish, gently mixed to distribute the mixture evenly, and placed at 37 ℃ with 5% CO2Incubating under the condition for transfection; after 6 hours of transfection, 293T medium was replaced and incubation continued.
C) 24 hours after transfection, 12mL of cell supernatant was collected and 12mL of pre-warmed 293T medium was added and continued at 37 ℃ with 5% CO2Transfection was performed by incubation under conditions.
D) Cell supernatants were collected a second time 54 hours after transfection and mixed with the first collected supernatant to obtain cell supernatants.
4. And (3) slow virus concentration:
A) the cell supernatant collected in the previous step was centrifuged at 2000rpm for 10 minutes at room temperature to remove cell debris precipitate, and the supernatant was filtered using a 0.45 μm filter to obtain a virus supernatant.
B) Mixing the virus supernatant and the concentrated reagent according to the volume ratio of 5:1, and standing at 4 ℃ for 2 h.
C) The incubated mixture was centrifuged at 4000g for 30min at 4 ℃ with an off-white precipitate at the bottom of the tube.
D) The supernatant was carefully removed and an appropriate volume of DMEM was added to resuspend the pellet as a lentivirus concentrate, (and as required for the experiment) and virus was aliquoted and the virus titer was determined and stored at-80 ℃.
By the inventionThe titer of the virus obtained in this example was determined by the method as follows: 5.74x106TU/ml。
5. Methods for virus titer testing:
the present invention can determine the virus titer as follows.
A) HT1080 cells were inoculated into a 96-well plate containing 100. mu.L of a culture medium at 7000 cells/well, and were cultured for 4 to 5 hours and then transduced, wherein the HT1080 cell culture medium was DMEM-H to which 10% FBS, 1% GlutaMAX, 10. mu.g/mL Polybrene, and 200nM sodium pyruvate were added.
B) Diluting virus liquid: 15mL of fresh medium was first mixed with 12. mu.L of 10mg/mL Polybrene reagent (final concentration 8. mu.g/mL) and vortexed to mix well as a dilution. Subsequently, for each virus sample, 135. mu.L of the medium prepared in the previous step, i.e., the dilution, was added to 16 wells of a 96-well round bottom plate in a 4-well x 4-well format. mu.L of concentrated lentivirus suspension was added to each well of the first row in a total volume of 150. mu.L, and the remaining three rows of cells were diluted sequentially at a ratio of 1: 10.
C) Transduction of cells: the medium in HT1080 cells was removed, 100 μ L of the prepared dilution was transferred to each corresponding well, the plates were centrifuged at 2000rpm for 30 minutes at room temperature, and the plates were incubated overnight.
D) The medium containing the virus supernatant was removed, replaced with fresh HT1080 medium (without Polybrene reagent), and the percentage of GFP positive cells was analyzed using flow cytometry after three days of incubation.
E) Titer (TU/mL) calculation formula (appropriate dilution factor determined from percentage of GFP positive cells) is as follows:
titer (F × C/V) × D, where F ═ percentage of GFP positive cells, C ═ number of cells per well at the time of transduction, V ═ volume of bacterial suspension (mL), D ═ lentiviral dilution factor, and appropriate lentiviral dilution factor was selected for subsequent transduction experiments.
Example 3: t cell preparation
1. T cell preparation
A) To an EP tube containing 1mL of whole blood, an antibody (20. mu.L, CD8 biotin antibody, biotin-labeled CD8 antibody, product BD, cat. No. 555365) was added and mixed with a rotary suspension apparatus at room temperature for 30 minutes. Experimental whole blood was collected from 8 healthy male volunteers (age 26-33, weight 58-71 kg) and T cells were prepared.
B) To 1mL of the whole blood described above, 150. mu.L of microvesicles (streptavidin, streptavidin-labeled, ThermoGene product) was added, and the mixture was mixed with a rotary suspension apparatus at room temperature for 20 minutes to bind the microvesicles to the antibody-labeled cells.
C) Cells were centrifuged at 400Xg for 5 minutes.
D) The white microbubble layer was gently transferred to another 2mL EP tube using a 200. mu.L pipette. Microbubbles attached to the wall and tip of the tube were washed with 500 μ L of microbubble buffer, incorporated into the EP tube, and incubated at room temperature for 30 min. (the microbubble buffer is an aqueous solution containing potassium chloride 200mg/L, potassium dihydrogen phosphate 200mg/L, sodium chloride 8000mg/L, disodium hydrogen phosphate heptahydrate 2160mg/L, 1% human serum albumin, and 2mM EDTA).
E) The target cells were recovered by breaking the bleb with 400W power ultrasound (2 times ultrasound for 1 second each).
F) Centrifuging at 1000rpm for 10min, collecting cell precipitate, and making into T cell.
+2. Flow cytometry identification of CD8T cells
A) Washing the sorted T cells with PBS, and diluting the T cells with PBS to a concentration of 1.2-1.4 x106Individual cells/mL range.
B) 100 μ L of cell suspension was taken and 2 μ L of anti-CD8 (PerCP-Cy) was addedTM5.5Mouse Anti-Human CD8) and mixed well.
C) Incubating at 4 deg.C for 20min, washing with PBS, resuspending and precipitating with 200 μ L PBS, detecting on machine, and identifying CD8+T cells.
The following example operations described in this paragraph are performed in addition. Example 3 a: reference is made to "1, T cell preparation" of example 3, except that wherein the microbubble buffer used in step D) is an aqueous solution comprising: potassium chloride 200mg/L, potassium dihydrogen phosphate 200mg/L, sodium chloride 8000mg/L, heptachlorDisodium hydrogen phosphate 2160mg/L, 1% human serum albumin (HAS), 2mM EDTA, 25mg/L sodium tartrate, and 120mg/L proline, and the obtained T cells can be identified to be CD8 by the same method+T cells. Example 3 b: reference is made to "1, T cell preparation" of example 3, except that wherein the microbubble buffer used in step D) is an aqueous solution comprising: potassium chloride 200mg/L, potassium dihydrogen phosphate 200mg/L, sodium chloride 8000mg/L, disodium hydrogen phosphate heptahydrate 2160mg/L, 1% human serum albumin (HAS), 2mM EDTA, and sodium tartrate 25mg/L, and identifying CD8 by the same method for the obtained T cells+T cells. Example 3 c: reference is made to "1, T cell preparation" of example 3, except that wherein the microbubble buffer used in step D) is an aqueous solution comprising: potassium chloride 200mg/L, potassium dihydrogen phosphate 200mg/L, sodium chloride 8000mg/L, disodium hydrogen phosphate heptahydrate 2160mg/L, 1% human serum albumin (HAS), 2mM EDTA, proline 120mg/L, and identifying CD8 by the same method for the obtained T cells+T cells. The T cells obtained in example 3 and examples 3a to 3c were used in the assay from whole blood of 8 healthy male volunteers, and the results were as follows: CD8 before sorting+The proportion (%) of T cells to peripheral blood mononuclear cells was 6.38 ± 1.31, CD8 after sorting in example 3+Proportion (%) of T cells to total mononuclear cells after sorting was 61.47 ± 9.24 ×, CD8 after sorting in example 3a+The proportion (%) of T cells to total mononuclear cells after sorting was 86.35 ± 10.51, example 3b CD8 after sorting+Proportion (%) of T cells to total mononuclear cells after sorting 58.84 ± 8.47 ·, example 3c CD8 after sorting+The proportion of T cells to total mononuclear cells after sorting (%). 63.73 ± 11.53, wherein is p compared to group a of example 3<0.01. From this result, it can be seen that CD8 was present in T cells obtained after treatment with a microvesicle buffer containing both sodium tartrate and proline+The proportion of T cells to total mononuclear cells after sorting was significantly higher than without the addition of both reagents.
The following example operations described in this paragraph are performed in addition. Example 31 a: reference is made to "1, T cell preparation" of example 3, except that wherein the microbubble buffer used in step D) is an aqueous solution comprising: potassium chloride 200mg/L, potassium dihydrogen phosphate 200mg/L, sodium chloride 8000mg/L, phosphorus heptahydrateDisodium hydrogen phosphate 2160mg/L, 1% human serum albumin (HAS), 2mM EDTA, potassium tartrate 25mg/L, proline 120mg/L, and identifying CD8 by the same method for the obtained T cells+T cells. Example 31 b: reference is made to "1, T cell preparation" of example 3, except that wherein the microbubble buffer used in step D) is an aqueous solution comprising: potassium chloride 200mg/L, potassium dihydrogen phosphate 200mg/L, sodium chloride 8000mg/L, disodium hydrogen phosphate heptahydrate 2160mg/L, 1% human serum albumin (HAS), 2mM EDTA, and potassium tartrate 25mg/L, and identifying the obtained T cell CD8 by the same method+T cells. The T cells prepared in example 31a and example 31b were tested from whole blood of 8 healthy male volunteers and the results were as follows: example 31a post-sort CD8+The proportion (%) of T cells to total mononuclear cells after sorting was 87.64 ± 9.38, example 31b CD8 after sorting+The proportion (%) of T cells to total mononuclear cells after sorting was 56.46 ± 9.76 ═ p < 0.01 compared to the previous example 3a group.
The following example operations described in this paragraph are performed in addition. Example 32 a: reference is made to "1, T cell preparation" of example 3, except that wherein the microbubble buffer used in step D) is an aqueous solution comprising: potassium chloride 200mg/L, potassium dihydrogen phosphate 200mg/L, sodium chloride 8000mg/L, disodium hydrogen phosphate heptahydrate 2160mg/L, 1% human serum albumin (HAS), 2mM EDTA, potassium sodium tartrate 25mg/L, proline 120mg/L, and identifying the obtained T cell CD8 by the same method+T cells. Example 32 b: reference is made to "1, T cell preparation" of example 3, except that wherein the microbubble buffer used in step D) is an aqueous solution comprising: potassium chloride 200mg/L, potassium dihydrogen phosphate 200mg/L, sodium chloride 8000mg/L, disodium hydrogen phosphate heptahydrate 2160mg/L, 1% human serum albumin (HAS), 2mM EDTA, and potassium sodium tartrate 25mg/L, and identifying the obtained T cell CD8 by the same method+T cells. The T cells prepared in example 32a and example 32b were tested from whole blood of 8 healthy male volunteers and the results were as follows: example 32a post-sort CD8+The proportion (%) of T cells to total mononuclear cells after sorting was 88.27 ± 11.04, example 32b CD8 after sorting+The proportion of T cells to total mononuclear cells after sorting (%). 55.82 ± 9.24 ·, where · is relative to the preceding oneThe example 3a group comparison, p < 0.01, is described.
Example 4: t cell activation, transduction and expansion:
1. CAR-T cell preparation
Reference is made to the documents of Milone MC, Lamers CH (Milone MC, Fish JD, Carpento C, et al. Chimeric receivers relating CD137signal transmission domains both expressed in a sub-virtual 0f T cells and expressed in an interactive effective in a visual [ J ] Mol Ther, 2009, 17 (8): 1453-64; Lamers CH, van Steenbergen-Langeveld S, et al. T cell receivers-expressed T cells to linear motion turbines: T cell processing beyond optical cell firm. hum genes metals. Dec. (25) (6: 57-57. doi: 10.1089/201420142014). Briefly described as follows:
CD8 collected from example 3+T cells at 5x105Each cell/mL was inoculated into a 24-well plate, stimulated with an activating Medium (X-votm 15Medium containing 30ng/mL anti-CD3 and 20ng/mL CD28) for 24-48 hours, followed by addition of the lentivirus concentrate (MOI 10) obtained in example 2 and a transduction Medium (X-votm 15Medium containing 200U/mL IL-2 and 5 μ g/mL lpolybrene) for virus transduction, and 24-48 hours later changed to a maintenance Medium (X-votm 15Medium containing 200U/mL IL-2); when expanded to 6-8 days, CAR-T cells were harvested. CAR-T cell detection and subsequent killing experiments were also performed.
2. CAR-T cell transfection efficiency test:
CAR-19-1 and CAR-19-2 are fluorescence labeled with green color, CAR-19-3 is fluorescence labeled with red color, and transfection efficiency was measured by using FITC channel and PE channel of flow cytometer, and the results are shown in the following table.
Table: different kinds of CAR-T cell transduction efficiency
Transduction type Efficiency of transduction
CAR-1＝(CAR-19-1)+(CAR-19-3) 26％
CAR-2＝(CAR-19-2)+(CAR-19-3) 32％
CAR-3＝(CAR-19-2) 48％
CAR-4＝(CAR-19-1) 41％
3. ELISA to verify whether CAR-T cells secrete anti-PD-1, GM-CSF, IL-7 and CCL-17:
A) keeping CAR-1, CAR-2, CAR-3, CAR-4 cells and culture supernatant in a sterile centrifuge tube (effective target ratio is 5: 1), centrifuging at 4 deg.C for 10min at 1000 Xg, packaging the supernatant into small EP tubes, and storing at-20 deg.C (2-8 deg.C for 24 hr), avoiding repeated freeze thawing, adjusting cell precipitation (2-4) x106cells used 1mL Trizol lysate per tube for 10min (4 ℃) and stored at-80 for use.
B) ELISA was performed to determine whether CAR-T cells secreted anti-PD-1, GM-CSF, IL-7 and CCL-17, following the Abcam's corresponding ELISA Kit instructions (anti-PD-1 detection now coated: a double-antibody sandwich ELISA method is used, an enzyme label plate is coated by using humanized PD-1 recombinant protein, a goat anti-human IgG (H & L) secondary antibody with an HRP label is used for detection, a commercial PD-1 antibody is used as a standard substance, and the expression quantity of the PD-1 antibody secreted by the T cells after gene modification is quantitatively detected after a sample to be detected is diluted by 5 times.
The method is briefly described as follows:
a) preparing a sample and a standard substance according to the instruction;
b) adding 50 mu L of standard substance and sample into a pore plate;
c) add 50. mu.L of Antibody Cocktai to each well;
d) incubating at room temperature for 60 min;
e) washing three times by using 350 mu L of 1xWash Buffer each time;
f) adding 100 μ L of TMB Development solution to each well, and incubating for 10 min;
g) reading the OD value at 450nm by using an enzyme-linked immunosorbent assay (ELISA) after adding 100 mu L of Stop Solution into each hole;
h) the concentrations of anti-PD-1, GM-CSF, IL-7 and CCL-17 were calculated according to the specification, and the results are shown in the following table.
Table: the secretion amounts of anti-PD-1, GM-CSF, IL-7 and CCL-17 of different CAR-T cells
CAR-1 CAR-2 CAR-3 CAR-4 T(Control)
Anti-PD-1 8800pg/ml 9200pg/m1 15pg/ml 30pg/ml 40pg/ml
GM-CSF 175pg/ml 190pg/m1 800pg/ml 860pg/m1 720pg/ml
IL-7 1380pg/ml 110pg/ml 110pg/ml 1450pg/ml 105pg/ml
CCL-17 1200pg/ml 110pg/ml 120pg/ml 1100pg/ml 120pg/ml
4. CAR-T cell killing experiment:
A) the human acute B lymphocyte leukemia cell line Raji is taken as a positive target cell, and effector cells are respectively as follows:
CAR-1＝(CAR-19-1)+(CAR-19-3)；
CAR-2＝(CAR-19-2)+(CAR-19-3)；
CAR-3＝(CAR-19-2)；
CAR-4＝(CAR-19-1)。
at 2x104Inoculating the cells/mL of target cells (pre-stained with 1 μ M Calcein-AM) in a 96-well plate at a concentration of 100 μ L/well, adding each group of effector cells according to an effective target ratio (5: 1), setting 3 multiple wells, incubating at 37 ℃ for 10 hours with 5% CO2, centrifuging (1000rpm/min, 5min), and detecting; the maximum release hole is set to add lysis solution (2.5% Trit)onX-100), adding PBS into the spontaneous release hole, processing, and scanning and reading the fluorescence value by a microplate reader. Cytotoxicity was calculated for each group of effector cells according to the following disclosure:
percent specific lysis is (experimental fluorescence value-spontaneous release fluorescence value)/(maximum release fluorescence value-spontaneous release fluorescence value) x 100%.
The results are shown in the following table.
Table: different kinds of CAR-T cell killing efficiency (percentage of specific lysis)
Figure BDA0003470029220000191
According to the results, the 4 CAR-T cells prepared by the method disclosed by the invention have excellent cell killing effect, and the CAR-T cells prepared by the method disclosed by the invention can be used for treating tumors.
The present invention is illustrated in detail by the examples described above, but the present invention is not limited to the details described above, i.e., it is not intended that the present invention be implemented by relying on the details described above. It should be understood by those skilled in the art that any modification of the present invention, equivalent substitutions of the raw materials of the product of the present invention, addition of auxiliary components, selection of specific modes, etc., are within the scope and disclosure of the present invention.
Sequence listing
<110> Oncology Boya Gene technology (Tianjin) Co., Ltd
<120> CAR-T cells secreting PD-1, GM-CSF antibodies and uses thereof
<130> Y21041y-XXC2114jq
<150> 2021111579465
<151> 2021-09-30
<160> 6
<170> SIPOSequenceListing 1.0
<210> 1
<211> 2451
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
atggccctgc ccgtgaccgc tctgctgctg ccactggccc tgctgctgca cgccgctaga 60
cctgaggtga agctgcagga gtccggccct ggcctggtgg ctccttccca gtccctgagc 120
gtgacctgta cagtgtccgg cgtgtccctg cctgattacg gcgtgtcctg gatcaggcag 180
cctcccagaa agggcctgga gtggctgggc gtgatctggg gctccgagac aacctactac 240
aattccgccc tgaagtccag gctgacaatc atcaaggaca atagcaagag ccaggtgttt 300
ctgaagatga actccctgca gacagacgac accgccatct actactgcgc caagcactac 360
tactacggcg gctcctacgc catggattac tggggccagg gcaccagcgt gacagtgtcc 420
tccggcggcg gcggaagcgg aggaggagga tctggcggcg gcggttccga tatccagatg 480
acccagacaa caagcagcct gtccgcctcc ctgggcgaca gagtgaccat ctcctgcagg 540
gcctcccagg acatcagcaa gtacctgaac tggtaccagc agaagcccga tggcaccgtg 600
aagctgctga tctaccacac ctccagactg cactccggcg tgccttccag attttccggc 660
tccggcagcg gcaccgacta cagcctgacc atcagcaacc tggagcagga ggacatcgcc 720
acctactttt gccagcaggg caataccctg ccttacacct ttggcggcgg cacaaagctg 780
gagatcacaa gggccgatgc cgcccccaca gtgagcatct ttccccctag ctccaacgcc 840
aagcccacaa caacccctgc ccctagaccc cccacacccg ctcctaccat cgccagccag 900
cctctgagcc tgagacctga ggcctgtagg cccgccgccg gaggagctgt tcacacaagg 960
ggcctggact ttgcctgcga catctacatc tgggcccccc tggccggcac ctgtggagtt 1020
ctgctgctga gcctggtcat taccaagagg ggcagaaaga agctgctgta catcttcaag 1080
cagcctttca tgagacccgt gcagacaacc caggaggagg acggctgcag ctgcagattc 1140
cctgaggagg aggagggcgg ctgtgagctg agggtgaagt tctccaggag cgccgacgcc 1200
cccgcctacc aacagggaca gaatcagctg tacaatgagc tgaacctggg cagaagagag 1260
gagtacgacg tgctggacaa gaggaggggc agggaccctg agatgggcgg caagccccag 1320
aggaggaaga atccccagga gggcctgtac aatgaactgc agaaggacaa gatggccgag 1380
gcctacagcg agatcggcat gaagggcgag aggaggagag gcaagggcca cgatggcctg 1440
taccagggcc tgtccaccgc cacaaaggac acctacgacg ccctgcacat gcaggccctg 1500
cccccaagag gaagcggagc caccaatttc agcctgctga agcaggccgg cgacgtggag 1560
gagaaccccg gacctatgtt ccatgtttct tttaggtata tctttggact tcctcccctg 1620
atccttgttc tgttgccagt agcatcatct gattgtgata ttgaaggtaa agatggcaaa 1680
caatatgaga gtgttctaat ggtcagcatc gatcaattat tggacagcat gaaagaaatt 1740
ggtagcaatt gcctgaataa tgaatttaac ttttttaaaa gacatatctg tgatgctaat 1800
aaggaaggta tgtttttatt ccgtgctgct cgcaagttga ggcaatttct taaaatgaat 1860
agcactggtg attttgatct ccacttatta aaagtttcag aaggcacaac aatactgttg 1920
aactgcactg gccaggttaa aggaagaaaa ccagctgccc tgggtgaagc ccaaccaaca 1980
aagagtttgg aagaaaataa atctttaaag gaacagaaaa aactgaatga cttgtgtttc 2040
ctaaagagac tattacaaga gataaaaact tgttggaata aaattttgat gggcactaaa 2100
gaacacggct ccggcgaagg cagaggctct ttactgactt gtggagacgt ggaagagaac 2160
cccggtccca tggccccact gaagatgctg gccctggtca ccctcctcct gggggcttct 2220
ctgcagcaca tccacgcagc tcgagggacc aatgtgggcc gggagtgctg cctggagtac 2280
ttcaagggag ccattcccct tagaaagctg aagacgtggt accagacatc tgaggactgc 2340
tccagggatg ccatcgtttt tgtaactgtg cagggcaggg ccatctgttc ggaccccaac 2400
aacaagagag tgaagaatgc agttaaatac ctgcaaagcc ttgagaggtc t 2451
<210> 2
<211> 817
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 2
Met Ala Leu Pro Val Thr Ala Leu Leu Leu Pro Leu Ala Leu Leu Leu
1 5 10 15
His Ala Ala Arg Pro Glu Val Lys Leu Gln Glu Ser Gly Pro Gly Leu
20 25 30
Val Ala Pro Ser Gln Ser Leu Ser Val Thr Cys Thr Val Ser Gly Val
35 40 45
Ser Leu Pro Asp Tyr Gly Val Ser Trp Ile Arg Gln Pro Pro Arg Lys
50 55 60
Gly Leu Glu Trp Leu Gly Val Ile Trp Gly Ser Glu Thr Thr Tyr Tyr
65 70 75 80
Asn Ser Ala Leu Lys Ser Arg Leu Thr Ile Ile Lys Asp Asn Ser Lys
85 90 95
Ser Gln Val Phe Leu Lys Met Asn Ser Leu Gln Thr Asp Asp Thr Ala
100 105 110
Ile Tyr Tyr Cys Ala Lys His Tyr Tyr Tyr Gly Gly Ser Tyr Ala Met
115 120 125
Asp Tyr Trp Gly Gln Gly Thr Ser Val Thr Val Ser Ser Gly Gly Gly
130 135 140
Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Asp Ile Gln Met
145 150 155 160
Thr Gln Thr Thr Ser Ser Leu Ser Ala Ser Leu Gly Asp Arg Val Thr
165 170 175
Ile Ser Cys Arg Ala Ser Gln Asp Ile Ser Lys Tyr Leu Asn Trp Tyr
180 185 190
Gln Gln Lys Pro Asp Gly Thr Val Lys Leu Leu Ile Tyr His Thr Ser
195 200 205
Arg Leu His Ser Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly
210 215 220
Thr Asp Tyr Ser Leu Thr Ile Ser Asn Leu Glu Gln Glu Asp Ile Ala
225 230 235 240
Thr Tyr Phe Cys Gln Gln Gly Asn Thr Leu Pro Tyr Thr Phe Gly Gly
245 250 255
Gly Thr Lys Leu Glu Ile Thr Arg Ala Asp Ala Ala Pro Thr Val Ser
260 265 270
Ile Phe Pro Pro Ser Ser Asn Ala Lys Pro Thr Thr Thr Pro Ala Pro
275 280 285
Arg Pro Pro Thr Pro Ala Pro Thr Ile Ala Ser Gln Pro Leu Ser Leu
290 295 300
Arg Pro Glu Ala Cys Arg Pro Ala Ala Gly Gly Ala Val His Thr Arg
305 310 315 320
Gly Leu Asp Phe Ala Cys Asp Ile Tyr Ile Trp Ala Pro Leu Ala Gly
325 330 335
Thr Cys Gly Val Leu Leu Leu Ser Leu Val Ile Thr Lys Arg Gly Arg
340 345 350
Lys Lys Leu Leu Tyr Ile Phe Lys Gln Pro Phe Met Arg Pro Val Gln
355 360 365
Thr Thr Gln Glu Glu Asp Gly Cys Ser Cys Arg Phe Pro Glu Glu Glu
370 375 380
Glu Gly Gly Cys Glu Leu Arg Val Lys Phe Ser Arg Ser Ala Asp Ala
385 390 395 400
Pro Ala Tyr Gln Gln Gly Gln Asn Gln Leu Tyr Asn Glu Leu Asn Leu
405 410 415
Gly Arg Arg Glu Glu Tyr Asp Val Leu Asp Lys Arg Arg Gly Arg Asp
420 425 430
Pro Glu Met Gly Gly Lys Pro Gln Arg Arg Lys Asn Pro Gln Glu Gly
435 440 445
Leu Tyr Asn Glu Leu Gln Lys Asp Lys Met Ala Glu Ala Tyr Ser Glu
450 455 460
Ile Gly Met Lys Gly Glu Arg Arg Arg Gly Lys Gly His Asp Gly Leu
465 470 475 480
Tyr Gln Gly Leu Ser Thr Ala Thr Lys Asp Thr Tyr Asp Ala Leu His
485 490 495
Met Gln Ala Leu Pro Pro Arg Gly Ser Gly Ala Thr Asn Phe Ser Leu
500 505 510
Leu Lys Gln Ala Gly Asp Val Glu Glu Asn Pro Gly Pro Met Phe His
515 520 525
Val Ser Phe Arg Tyr Ile Phe Gly Leu Pro Pro Leu Ile Leu Val Leu
530 535 540
Leu Pro Val Ala Ser Ser Asp Cys Asp Ile Glu Gly Lys Asp Gly Lys
545 550 555 560
Gln Tyr Glu Ser Val Leu Met Val Ser Ile Asp Gln Leu Leu Asp Ser
565 570 575
Met Lys Glu Ile Gly Ser Asn Cys Leu Asn Asn Glu Phe Asn Phe Phe
580 585 590
Lys Arg His Ile Cys Asp Ala Asn Lys Glu Gly Met Phe Leu Phe Arg
595 600 605
Ala Ala Arg Lys Leu Arg Gln Phe Leu Lys Met Asn Ser Thr Gly Asp
610 615 620
Phe Asp Leu His Leu Leu Lys Val Ser Glu Gly Thr Thr Ile Leu Leu
625 630 635 640
Asn Cys Thr Gly Gln Val Lys Gly Arg Lys Pro Ala Ala Leu Gly Glu
645 650 655
Ala Gln Pro Thr Lys Ser Leu Glu Glu Asn Lys Ser Leu Lys Glu Gln
660 665 670
Lys Lys Leu Asn Asp Leu Cys Phe Leu Lys Arg Leu Leu Gln Glu Ile
675 680 685
Lys Thr Cys Trp Asn Lys Ile Leu Met Gly Thr Lys Glu His Gly Ser
690 695 700
Gly Glu Gly Arg Gly Ser Leu Leu Thr Cys Gly Asp Val Glu Glu Asn
705 710 715 720
Pro Gly Pro Met Ala Pro Leu Lys Met Leu Ala Leu Val Thr Leu Leu
725 730 735
Leu Gly Ala Ser Leu Gln His Ile His Ala Ala Arg Gly Thr Asn Val
740 745 750
Gly Arg Glu Cys Cys Leu Glu Tyr Phe Lys Gly Ala Ile Pro Leu Arg
755 760 765
Lys Leu Lys Thr Trp Tyr Gln Thr Ser Glu Asp Cys Ser Arg Asp Ala
770 775 780
Ile Val Phe Val Thr Val Gln Gly Arg Ala Ile Cys Ser Asp Pro Asn
785 790 795 800
Asn Lys Arg Val Lys Asn Ala Val Lys Tyr Leu Gln Ser Leu Glu Arg
805 810 815
Ser
<210> 3
<211> 1509
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
atggccctgc ccgtgaccgc tctgctgctg ccactggccc tgctgctgca cgccgctaga 60
cctgaggtga agctgcagga gtccggccct ggcctggtgg ctccttccca gtccctgagc 120
gtgacctgta cagtgtccgg cgtgtccctg cctgattacg gcgtgtcctg gatcaggcag 180
cctcccagaa agggcctgga gtggctgggc gtgatctggg gctccgagac aacctactac 240
aattccgccc tgaagtccag gctgacaatc atcaaggaca atagcaagag ccaggtgttt 300
ctgaagatga actccctgca gacagacgac accgccatct actactgcgc caagcactac 360
tactacggcg gctcctacgc catggattac tggggccagg gcaccagcgt gacagtgtcc 420
tccggcggcg gcggaagcgg aggaggagga tctggcggcg gcggttccga tatccagatg 480
acccagacaa caagcagcct gtccgcctcc ctgggcgaca gagtgaccat ctcctgcagg 540
gcctcccagg acatcagcaa gtacctgaac tggtaccagc agaagcccga tggcaccgtg 600
aagctgctga tctaccacac ctccagactg cactccggcg tgccttccag attttccggc 660
tccggcagcg gcaccgacta cagcctgacc atcagcaacc tggagcagga ggacatcgcc 720
acctactttt gccagcaggg caataccctg ccttacacct ttggcggcgg cacaaagctg 780
gagatcacaa gggccgatgc cgcccccaca gtgagcatct ttccccctag ctccaacgcc 840
aagcccacaa caacccctgc ccctagaccc cccacacccg ctcctaccat cgccagccag 900
cctctgagcc tgagacctga ggcctgtagg cccgccgccg gaggagctgt tcacacaagg 960
ggcctggact ttgcctgcga catctacatc tgggcccccc tggccggcac ctgtggagtt 1020
ctgctgctga gcctggtcat taccaagagg ggcagaaaga agctgctgta catcttcaag 1080
cagcctttca tgagacccgt gcagacaacc caggaggagg acggctgcag ctgcagattc 1140
cctgaggagg aggagggcgg ctgtgagctg agggtgaagt tctccaggag cgccgacgcc 1200
cccgcctacc aacagggaca gaatcagctg tacaatgagc tgaacctggg cagaagagag 1260
gagtacgacg tgctggacaa gaggaggggc agggaccctg agatgggcgg caagccccag 1320
aggaggaaga atccccagga gggcctgtac aatgaactgc agaaggacaa gatggccgag 1380
gcctacagcg agatcggcat gaagggcgag aggaggagag gcaagggcca cgatggcctg 1440
taccagggcc tgtccaccgc cacaaaggac acctacgacg ccctgcacat gcaggccctg 1500
cccccaaga 1509
<210> 4
<211> 503
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 4
Met Ala Leu Pro Val Thr Ala Leu Leu Leu Pro Leu Ala Leu Leu Leu
1 5 10 15
His Ala Ala Arg Pro Glu Val Lys Leu Gln Glu Ser Gly Pro Gly Leu
20 25 30
Val Ala Pro Ser Gln Ser Leu Ser Val Thr Cys Thr Val Ser Gly Val
35 40 45
Ser Leu Pro Asp Tyr Gly Val Ser Trp Ile Arg Gln Pro Pro Arg Lys
50 55 60
Gly Leu Glu Trp Leu Gly Val Ile Trp Gly Ser Glu Thr Thr Tyr Tyr
65 70 75 80
Asn Ser Ala Leu Lys Ser Arg Leu Thr Ile Ile Lys Asp Asn Ser Lys
85 90 95
Ser Gln Val Phe Leu Lys Met Asn Ser Leu Gln Thr Asp Asp Thr Ala
100 105 110
Ile Tyr Tyr Cys Ala Lys His Tyr Tyr Tyr Gly Gly Ser Tyr Ala Met
115 120 125
Asp Tyr Trp Gly Gln Gly Thr Ser Val Thr Val Ser Ser Gly Gly Gly
130 135 140
Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Asp Ile Gln Met
145 150 155 160
Thr Gln Thr Thr Ser Ser Leu Ser Ala Ser Leu Gly Asp Arg Val Thr
165 170 175
Ile Ser Cys Arg Ala Ser Gln Asp Ile Ser Lys Tyr Leu Asn Trp Tyr
180 185 190
Gln Gln Lys Pro Asp Gly Thr Val Lys Leu Leu Ile Tyr His Thr Ser
195 200 205
Arg Leu His Ser Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly
210 215 220
Thr Asp Tyr Ser Leu Thr Ile Ser Asn Leu Glu Gln Glu Asp Ile Ala
225 230 235 240
Thr Tyr Phe Cys Gln Gln Gly Asn Thr Leu Pro Tyr Thr Phe Gly Gly
245 250 255
Gly Thr Lys Leu Glu Ile Thr Arg Ala Asp Ala Ala Pro Thr Val Ser
260 265 270
Ile Phe Pro Pro Ser Ser Asn Ala Lys Pro Thr Thr Thr Pro Ala Pro
275 280 285
Arg Pro Pro Thr Pro Ala Pro Thr Ile Ala Ser Gln Pro Leu Ser Leu
290 295 300
Arg Pro Glu Ala Cys Arg Pro Ala Ala Gly Gly Ala Val His Thr Arg
305 310 315 320
Gly Leu Asp Phe Ala Cys Asp Ile Tyr Ile Trp Ala Pro Leu Ala Gly
325 330 335
Thr Cys Gly Val Leu Leu Leu Ser Leu Val Ile Thr Lys Arg Gly Arg
340 345 350
Lys Lys Leu Leu Tyr Ile Phe Lys Gln Pro Phe Met Arg Pro Val Gln
355 360 365
Thr Thr Gln Glu Glu Asp Gly Cys Ser Cys Arg Phe Pro Glu Glu Glu
370 375 380
Glu Gly Gly Cys Glu Leu Arg Val Lys Phe Ser Arg Ser Ala Asp Ala
385 390 395 400
Pro Ala Tyr Gln Gln Gly Gln Asn Gln Leu Tyr Asn Glu Leu Asn Leu
405 410 415
Gly Arg Arg Glu Glu Tyr Asp Val Leu Asp Lys Arg Arg Gly Arg Asp
420 425 430
Pro Glu Met Gly Gly Lys Pro Gln Arg Arg Lys Asn Pro Gln Glu Gly
435 440 445
Leu Tyr Asn Glu Leu Gln Lys Asp Lys Met Ala Glu Ala Tyr Ser Glu
450 455 460
Ile Gly Met Lys Gly Glu Arg Arg Arg Gly Lys Gly His Asp Gly Leu
465 470 475 480
Tyr Gln Gly Leu Ser Thr Ala Thr Lys Asp Thr Tyr Asp Ala Leu His
485 490 495
Met Gln Ala Leu Pro Pro Arg
500
<210> 5
<211> 1590
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
atggccctgc ctgtgaccgc cctgctgctg ccactggccc tgctgctcca cgccgctaga 60
cctcaggtgc agctggtgca gtccggcgtg gaggtgaaga agcccggcgc ctccgtgaag 120
gtgtcctgca aggcctccgg ctacaccttt acaaattact acatgtactg ggtgaggcag 180
gcccccggcc agggactgga atggatgggc ggcatcaatc cctccaatgg cggcacaaac 240
tttaacgaga agtttaagaa cagggtgacc ctgaccaccg atagctccac cacaacagcc 300
tacatggagc tgaagtccct gcagttcgat gataccgccg tgtactactg tgccaggagg 360
gactacaggt ttgatatggg cttcgattac tggggccagg gcaccaccgt gaccgtgtcc 420
tccggcggag gcggaagcgg aggaggagga agcggcggag gcggtagcga gatcgtgctg 480
acacagagcc ctgccacact gtccctgtcc cctggcgaga gagccaccct gagctgcaga 540
gcctccaagg gcgtgagcac ctccggctac agctacctgc actggtacca gcagaagccc 600
ggccaggccc ccaggctgct gatctacctg gcctcctacc tggagtccgg cgtgcccgct 660
agattctccg gctccggcag cggcaccgat tttaccctga caatctccag cctggagcct 720
gaggacttcg ccgtgtacta ttgtcagcac tccagggatc tgcctctgac ctttggcggc 780
ggcaccaagg tggagatcaa gggctccggc gccacaaact ttagcctgct gaagcaggcc 840
ggcgacgtgg aggagaaccc tggcccacag gtgcagctcg tgcagtccgg agccgaggtg 900
aagaaacccg gcgccagcgt gaaggtgagc tgcaaggcca gcggctacac cttcaccggc 960
tactacatgc actgggtgag acaggccccc ggacagggcc tggagtggat gggatggatc 1020
aatcctaaca gcggcggcac caattacgcc cagaagttcc agggcagggt gacaatgaca 1080
agggatacct ccatcagcac cgcctacatg gaactgagca ggctgagaag cgacgacaca 1140
gccgtgtact actgcgtgag aagagatagg tttccctact actttgatta ctggggacag 1200
ggcaccctgg tgaccgtgag ctccggcgga ggaggctccg gaggaggagg tagcggcgga 1260
ggaggatctg agatcgtgct cacccagtcc cccgccaccc tgtccgtgtc ccctggagag 1320
agggccacac tgagctgtag agcctcccag agcatcggct ccaatctggc ctggtaccag 1380
caaaagcctg gccaggcccc aagggtgctg atctactcca cctcctccag ggccacaggc 1440
atcacagata ggtttagcgg ctccggctcc ggaaccgatt tcaccctgac catcagcaga 1500
ctggagcccg aggacttcgc tgtgtactac tgccagcagt ttaatagatc ccccctgacc 1560
ttcggcggcg gcacaaaggt ggagattaag 1590
<210> 6
<211> 530
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 6
Met Ala Leu Pro Val Thr Ala Leu Leu Leu Pro Leu Ala Leu Leu Leu
1 5 10 15
His Ala Ala Arg Pro Gln Val Gln Leu Val Gln Ser Gly Val Glu Val
20 25 30
Lys Lys Pro Gly Ala Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr
35 40 45
Thr Phe Thr Asn Tyr Tyr Met Tyr Trp Val Arg Gln Ala Pro Gly Gln
50 55 60
Gly Leu Glu Trp Met Gly Gly Ile Asn Pro Ser Asn Gly Gly Thr Asn
65 70 75 80
Phe Asn Glu Lys Phe Lys Asn Arg Val Thr Leu Thr Thr Asp Ser Ser
85 90 95
Thr Thr Thr Ala Tyr Met Glu Leu Lys Ser Leu Gln Phe Asp Asp Thr
100 105 110
Ala Val Tyr Tyr Cys Ala Arg Arg Asp Tyr Arg Phe Asp Met Gly Phe
115 120 125
Asp Tyr Trp Gly Gln Gly Thr Thr Val Thr Val Ser Ser Gly Gly Gly
130 135 140
Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Glu Ile Val Leu
145 150 155 160
Thr Gln Ser Pro Ala Thr Leu Ser Leu Ser Pro Gly Glu Arg Ala Thr
165 170 175
Leu Ser Cys Arg Ala Ser Lys Gly Val Ser Thr Ser Gly Tyr Ser Tyr
180 185 190
Leu His Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Arg Leu Leu Ile
195 200 205
Tyr Leu Ala Ser Tyr Leu Glu Ser Gly Val Pro Ala Arg Phe Ser Gly
210 215 220
Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Glu Pro
225 230 235 240
Glu Asp Phe Ala Val Tyr Tyr Cys Gln His Ser Arg Asp Leu Pro Leu
245 250 255
Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys Gly Ser Gly Ala Thr
260 265 270
Asn Phe Ser Leu Leu Lys Gln Ala Gly Asp Val Glu Glu Asn Pro Gly
275 280 285
Pro Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly
290 295 300
Ala Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Gly
305 310 315 320
Tyr Tyr Met His Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp
325 330 335
Met Gly Trp Ile Asn Pro Asn Ser Gly Gly Thr Asn Tyr Ala Gln Lys
340 345 350
Phe Gln Gly Arg Val Thr Met Thr Arg Asp Thr Ser Ile Ser Thr Ala
355 360 365
Tyr Met Glu Leu Ser Arg Leu Arg Ser Asp Asp Thr Ala Val Tyr Tyr
370 375 380
Cys Val Arg Arg Asp Arg Phe Pro Tyr Tyr Phe Asp Tyr Trp Gly Gln
385 390 395 400
Gly Thr Leu Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly
405 410 415
Gly Ser Gly Gly Gly Gly Ser Glu Ile Val Leu Thr Gln Ser Pro Ala
420 425 430
Thr Leu Ser Val Ser Pro Gly Glu Arg Ala Thr Leu Ser Cys Arg Ala
435 440 445
Ser Gln Ser Ile Gly Ser Asn Leu Ala Trp Tyr Gln Gln Lys Pro Gly
450 455 460
Gln Ala Pro Arg Val Leu Ile Tyr Ser Thr Ser Ser Arg Ala Thr Gly
465 470 475 480
Ile Thr Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu
485 490 495
Thr Ile Ser Arg Leu Glu Pro Glu Asp Phe Ala Val Tyr Tyr Cys Gln
500 505 510
Gln Phe Asn Arg Ser Pro Leu Thr Phe Gly Gly Gly Thr Lys Val Glu
515 520 525
Ile Lys
530

Claims (10)

1. A chimeric antigen receptor comprising:
a) an antigen binding domain as a first signal,
b) A transmembrane domain,
c) An intracellular transduction domain as a second signal, and
e) secretion neutralizes the fourth signal domain of the anti-PD-1, anti-GM-CSF scFv of PD-1, GM-CSF.
2. The chimeric antigen receptor according to claim 1, which comprises the amino acid sequence shown in sequence 4, or which comprises the amino acid sequence shown in sequence 6.
3. The chimeric antigen receptor according to claim 1, which comprises the amino acid sequences shown in seq id nos 4 and 6.
4. A recombinant plasmid having a nucleotide sequence shown as sequence 3, or having a nucleotide sequence shown as sequence 5, or comprising nucleotide sequences shown as sequence 3 and sequence 5.
5. A CAR-T cell capable of secreting an antibody expressing IL-7, CCL17 factor and/or PD-1, GM-CSF.
6. A CAR-T cell according to claim 5 which is transfected with a chimeric antigen receptor sequence according to any of claims 1 to 3.
7. A method of making the CAR-T cell of claim 5 or 6, comprising the steps of:
(1) plasmid synthesis:
synthesizing CAR-19-1 plasmid by using vector pLVX-EF1a-IRES-PGK-puro, wherein the plasmid is composed of CD19 single-chain variable region, CD8a hinge region, CD8a transmembrane region, 4-1BB signal, envelope signal of CD3 zeta, IL-7, CCL17 sequence, and has the nucleotide sequence of sequence 1;
synthesizing CAR-19-2 plasmid using vector pLVX-EF1a-IRES-PGK-puro, the plasmid is composed of CD19 single-chain variable region, CD8a hinge region, CD8a transmembrane region, 4-1BB signal, and the encapsidation signal sequence of CD3 zeta, and has the nucleotide sequence described in sequence 3;
synthesizing a CAR-19-3 plasmid by using a vector pLVX-mCherry-C1, wherein the plasmid is composed of an anti-PD-1scFv single-chain variable region sequence and an anti-GM-CSF scFv single-chain variable region sequence and has a nucleotide sequence shown in a sequence 5;
(2) and (3) packaging the virus:
performing virus packaging by using an Invitrogen Lipofectamine 3000 transfection reagent, namely Lip3000, wherein a 293T culture medium is a DMEM-H culture medium added with 10% FBS, and a lentivirus packaging culture medium is an Opti-MEMI culture medium added with 1% GlutaMAX, 1mM sodium pyruvate and 5% FBS;
293T cells at 7X106Density of individual cells/well seeded on12mL of lentivirus packaging medium in a 10cm petri dish at 37 deg.C with 5% CO2Incubating the cells overnight under conditions until the 293T cell density reaches 95%;
the overnight incubated dishes were removed 6mL of lentivirus packaging medium per dish, 6mL of the liquid A-liquid B mixture was added to each dish, gently mixed to achieve uniform distribution, and placed at 37 ℃ in 5% CO2Incubating under the condition for transfection; after 6 hours of transfection, the 293T culture medium is replaced for continuous incubation;
24 hours after transfection, 12mL of cell supernatant was collected and 12mL of pre-warmed 293T medium was added and continued at 37 ℃ with 5% CO2Incubating under the condition for transfection;
collecting cell supernatant for the second time after 54 hours of transfection, and mixing the cell supernatant with the supernatant collected for the first time to obtain cell supernatant;
centrifuging the cell supernatant collected in the previous step at 2000rpm for 10 minutes at room temperature, removing cell debris precipitate, and filtering the supernatant with a 0.45 μm filter to obtain virus supernatant;
mixing the virus supernatant and the concentrated reagent according to the volume ratio of 5:1, incubating for 2h at 4 ℃, and then centrifuging at 4 ℃ until a precipitate (off-white) is formed at the bottom of a centrifugal tube;
carefully removing the supernatant, adding a proper volume of DMEM to resuspend and precipitate to obtain a lentivirus concentrated solution, and measuring the virus titer of the lentivirus concentrated solution;
(3) t cell preparation:
add biotin-labeled CD8 antibody to an EP tube containing 1mL of whole blood and mix for 30 minutes at room temperature;
adding 150 μ L of microvesicle to the whole blood 1mL, mixing at room temperature for 20 minutes, binding microvesicle to antibody-labeled cells, and centrifuging;
gently transferring the white microbubble layer into another 2mL EP tube by using a 200 muL pipette gun, washing the microbubbles attached to the tube wall and the pipette head by using 500 muL microbubble buffer solution, merging the microbubbles into the EP tube, and incubating for 30min at room temperature; the microbubble buffer is an aqueous solution comprising: potassium chloride 200mg/L, potassium dihydrogen phosphate 200mg/L, sodium chloride 8000mg/L, disodium hydrogen phosphate heptahydrate 2160mg/L, 1% human serum albumin, 2mM EDTA;
breaking bubble with ultrasonic wave, centrifuging, collecting cell precipitate, and making into CD8 as T cell+T cells, which are flow cytometrically identified;
(4) t cell activation, transduction and expansion:
collecting CD8+T cells at 5x105The individual cells/mL were seeded in 24/6 well plates and stimulated with activation medium for 24-48 hours, followed by viral transduction by addition of lentiviral concentrate (MOI =10) and transduction medium, and 24-48 hours later switched to maintenance medium; when expanded to 6-8 days, CAR-T cells were harvested.
8. The method according to claim 7, wherein the solution A-solution B is prepared by mixing solution A and solution B, and incubating at room temperature for 15 min; preparing solution A: restoring the Opti-MEMI serum-reducing culture medium to room temperature, and uniformly mixing 1.5ml of Opti-MEMI and 41 mu L of Lip3000 in a 10cm dish to obtain solution A; preparing liquid B: mixing 1.5ml of Opti-MEMI, 35 mu L of P3000 Enhancer and 12 mu g of plasmid mixture to obtain solution B; for example, the plasmid ratio of the plasmid mixture is pmd2.g: pSPAX2: (CAR-19-2/CAR-19-3) =1:3 (3.5/3).
9. The method of claim 7, wherein: the activation Medium was X-VIVOTM15Medium containing 30ng/mL anti-CD3 and 20ng/mL CD 28; the transduction Medium was X-VIVOTM15Medium containing 200U/mL IL-2 and 5 μ g/mL Polybrene; the maintenance Medium is X-VIVOTM15Medium containing 200U/mL IL-2; alternatively, the microbubble buffer is an aqueous solution comprising: potassium chloride 200mg/L, potassium dihydrogen phosphate 200mg/L, sodium chloride 8000mg/L, disodium hydrogen phosphate heptahydrate 2160mg/L, 1% human serum albumin (HAS), 2mM EDTA, potassium sodium tartrate 25mg/L, proline 120 mg/L.
10. Use of a CAR-T cell according to claim 5 or 6 in the manufacture of a cell therapeutic for the treatment of a tumour.
CN202210040555.3A 2021-09-30 2022-01-14 CAR-T cells secreting PD-1, GM-CSF antibodies and uses thereof Active CN114213550B (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN202111157946 2021-09-30
CN2021111579465 2021-09-30

Publications (2)

Publication Number Publication Date
CN114213550A true CN114213550A (en) 2022-03-22
CN114213550B CN114213550B (en) 2023-08-22

Family

ID=80708221

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202210040555.3A Active CN114213550B (en) 2021-09-30 2022-01-14 CAR-T cells secreting PD-1, GM-CSF antibodies and uses thereof

Country Status (1)

Country Link
CN (1) CN114213550B (en)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109971712A (en) * 2017-12-28 2019-07-05 上海细胞治疗研究院 Selectively targeted CD19 antigen and high level stablize the CAR-T cell and purposes of expression PD-1 antibody
CN110760001A (en) * 2019-07-29 2020-02-07 浙江启新生物技术有限公司 Construction and application of chimeric antigen receptor T cell secreted by GM-CSF knockdown and neutralizing single-chain antibody thereof

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109971712A (en) * 2017-12-28 2019-07-05 上海细胞治疗研究院 Selectively targeted CD19 antigen and high level stablize the CAR-T cell and purposes of expression PD-1 antibody
CN110760001A (en) * 2019-07-29 2020-02-07 浙江启新生物技术有限公司 Construction and application of chimeric antigen receptor T cell secreted by GM-CSF knockdown and neutralizing single-chain antibody thereof

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
HONG LUO等: "Coexpression of IL7 and CCL21 Increases Efficacy of CAR-T Cells in Solid Tumors without Requiring Preconditioned Lymphodepletion", 《CLIN CANCER RES》, vol. 26, no. 20, pages 5494 - 5505, XP055921328, DOI: 10.1158/1078-0432.CCR-20-0777 *
赵恺等: "嵌合抗原受体T细胞的结构演变及展望", 《中华血液学杂志》, vol. 41, no. 11, pages 964 - 968 *

Also Published As

Publication number Publication date
CN114213550B (en) 2023-08-22

Similar Documents

Publication Publication Date Title
JP7116126B2 (en) Truncated epidermal growth factor receptor (EGFRt) for transduced T cell selection
CN107982538B (en) Pharmaceutical composition and application thereof
CN110872577B (en) Modified immune cells and uses thereof
CN108384760B (en) Human T lymphocyte carrying CD20/CD19 bispecific chimeric antigen receptor and preparation method and application thereof
CN109942709B (en) anti-BCMA single domain antibody and application thereof
CN112048481B (en) Chimeric antigen receptor NK (natural killer) cell targeting CD19 and application thereof
CN107033248B (en) Chimeric antigen receptor for recognizing carcinoembryonic antigen and application thereof
CN111748044B (en) CD19 and PD-L1 double-target chimeric antigen receptor and application thereof
RU2770002C2 (en) Chimeric antigen receptor
CN113583143B (en) CAR-T cells and methods of making the same
CN109111525B (en) HLA-G chimeric antigen receptor, coding sequence, expression vector and application
CN112029729B (en) CD19 and CD22 double-target chimeric antigen receptor NK (natural killer) cell and application thereof
CN114478803B (en) Construction and application of novel bispecific chimeric antigen receptor
WO2020248486A1 (en) Method for preparing car-t that uses tcm as main effective ingredient and use thereof
CN112204133A (en) CAR NK cells
CN108753774A (en) Interfere CD19-CAR-T cells and its application of IL-6 expression
CN111848820A (en) CD19 and BCMA double-target chimeric antigen receptor and application thereof
WO2021259334A1 (en) Self-regulating chimeric antigen receptor and application thereof in tumor immunity
CN113735981B (en) CD19-CAR-T cell and preparation method thereof
CN111518217A (en) Chimeric antigen receptor targeting CD22 molecule
CN116254234A (en) Genetically modified K562 cells and application thereof in-vitro culture of NK cells
CN115925948B (en) anti-CD 22 nano antibody and application thereof
CN114149978B (en) Method for producing CAR-T cells
CN114213550B (en) CAR-T cells secreting PD-1, GM-CSF antibodies and uses thereof
CN110964112B (en) Humanized antibody for enhancing activity of anti-PSCA chimeric antigen receptor and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
TA01 Transfer of patent application right

Effective date of registration: 20230316

Address after: Room 1501, Building 10, Shenzhen Biomedical Innovation Industrial Park, No. 14, Jinhui Road, Jinsha Community, Kengzi Street, Pingshan District, Shenzhen, Guangdong 518122

Applicant after: Shenzhen Boya perception Pharmaceutical Co.,Ltd.

Address before: 300457 building a, Alexandria, No.3 Haitong street, Binhai New Area Development Zone, Tianjin Boya company

Applicant before: SINICA Ltd.

TA01 Transfer of patent application right
GR01 Patent grant
GR01 Patent grant