CN114196692A

CN114196692A - Adeno-associated virus expression vector and construction, virus preparation and cell marking methods thereof

Info

Publication number: CN114196692A
Application number: CN202111315069.XA
Authority: CN
Inventors: 林坤章; 韩增鹏; 骆能松; 徐富强
Original assignee: Shenzhen Institute of Advanced Technology of CAS
Current assignee: Shenzhen Institute of Advanced Technology of CAS
Priority date: 2021-11-08
Filing date: 2021-11-08
Publication date: 2022-03-18
Also published as: WO2023077621A1

Abstract

The application discloses a construction method of an adeno-associated virus expression vector, which comprises the following steps: obtaining a first gene sequence and a second gene sequence, wherein the first gene sequence comprises a nuclear localization protein gene sequence, a color development protein gene sequence and a receptor protein gene sequence; introducing a restriction enzyme site into the first gene sequence, and performing restriction enzyme treatment on the first gene sequence and the second gene sequence; wherein the second gene sequence carries a restriction enzyme site; and connecting the first gene sequence and the second gene sequence after enzyme digestion treatment to obtain the adeno-associated virus expression vector. The application also discloses a preparation method of the adeno-associated virus, a cell marking method and an expression vector. Through the mode, the application can realize the marking and positioning of the specific type neurons of the whole brain in the specific brain area.

Description

Adeno-associated virus expression vector and construction, virus preparation and cell marking methods thereof

Technical Field

The application relates to the field of genetic engineering, in particular to an adeno-associated virus expression vector and construction, virus preparation and cell marking methods thereof.

Background

The brain is the most important central mechanism of human body, and the neural network is the material basis of brain work, and the abnormality of the neural network often causes various neurological diseases. An efficient retroactively labeled tool viral vector can manipulate the upstream neural network transmitted to a specific brain region for imaging, which is crucial in neural circuit structure and function resolution. The known high-performance retromarker viruses are mainly AAV2-Retro (Neuron,2016,92(2):372-382.) and RV- Δ G (N2cG) (Neurosci Bull,2020,36(3): 202-216.). AAV2-Retro, however, is brain-region selective, it primarily infects cortical neurons, RV- Δ G (N2cG), although it can broadly retroactively label neural networks, it fails to achieve the specificity of retroactively labeled neurons. Known highly effective retrograde labeling tool viruses do not enable retrograde labeling of whole brain specific types of neurons received for specific brain regions.

Disclosure of Invention

The application mainly aims to provide a construction method of an adeno-associated virus expression vector, a preparation method of an adeno-associated virus, a cell marking method and a virus expression vector.

In order to solve the above technical problem, the first technical solution adopted by the present application is: a method for constructing an adeno-associated virus expression vector is provided, which comprises the following steps: obtaining a first gene sequence and a second gene sequence, wherein the first gene sequence comprises a nuclear localization protein gene sequence, a color development protein gene sequence and a receptor protein gene sequence; introducing a restriction enzyme site into the first gene sequence, and performing restriction enzyme treatment on the first gene sequence and the second gene sequence; wherein the second gene sequence carries a restriction enzyme site; and connecting the first gene sequence and the second gene sequence after enzyme digestion treatment to obtain the adeno-associated virus expression vector.

In order to solve the above technical problem, the second technical solution adopted by the present application is: a method of preparing an adenovirus, the method comprising: obtaining an adeno-associated virus expression vector as described in the first embodiment; carrying out cell culture on the adeno-associated virus expression vector to obtain adeno-associated virus; wherein the adeno-associated virus is rAAV-hSyn-DIO-H2B-EGFP-T2A-TVA-WPRE-hGHpolyA virus.

In order to solve the above technical problem, the third technical solution adopted by the present application is: there is provided a method of cell labeling, the method comprising: obtaining the adeno-associated virus obtained in the second technical scheme, injecting the adeno-associated virus and SAD-B19-delta G-DsRed virus into organisms, and realizing cell positioning marks on partial regions of the organisms after full expression; wherein, the cells in the partial area comprise specific type neurons in the upstream brain area.

In order to solve the above technical problem, a fourth technical solution adopted by the present application is: provides an expression vector, the expression vector is an adeno-associated virus expression vector obtained by using the construction method in the first technical scheme, and the adeno-associated virus expression vector comprises a H2B-EGFP-T2A-TVA gene sequence.

The beneficial effect of this application is: different from the prior art, the recombinant adeno-associated virus expression vector is obtained by shearing the nuclear localization protein gene, the color protein gene and the receptor protein gene into the adeno-associated virus expression vector. The expression vector assists ENVA-RV-delta G-DsRed to realize the marking of the whole brain specific type neurons of a specific brain region because the expression vector contains a receptor protein gene.

Drawings

In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the drawings needed to be used in the description of the embodiments will be briefly introduced below, and it is obvious that the drawings in the following description are only some embodiments of the present invention, and it is obvious for those skilled in the art to obtain other drawings based on these drawings without creative efforts.

FIG. 1 is a map of an embodiment of an adeno-associated viral expression vector of the present application;

FIG. 2 is a schematic flow chart of an embodiment of the method for constructing an adeno-associated virus expression vector according to the present invention;

FIG. 3 is a schematic flow chart of a method for constructing an adeno-associated viral expression vector according to another embodiment of the present invention;

FIG. 4 is a schematic flow chart of an embodiment of the method for producing adeno-associated virus according to the present invention;

FIG. 5 is a schematic flow chart of an embodiment of the cell labeling method of the present application;

FIG. 6 is a graph of the fluorescence intensity produced by the adeno-associated virus expression vector of the present invention and ENVA-RV- Δ G-DsRed after infecting neurons.

Detailed Description

The technical solutions in the embodiments of the present application will be clearly and completely described below with reference to the drawings in the embodiments of the present application, and it is obvious that the described embodiments are only a part of the embodiments of the present application, and not all of the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present application.

The terms "first", "second", etc. in this application are used to distinguish between different objects and not to describe a particular order. Furthermore, the terms "include" and "have," as well as any variations thereof, are intended to cover non-exclusive inclusions. For example, a process, method, system, article, or apparatus that comprises a list of steps or elements is not limited to only those steps or elements listed, but may alternatively include other steps or elements not listed, or inherent to such process, method, article, or apparatus.

Reference herein to "an embodiment" means that a particular feature, structure, or characteristic described in connection with the embodiment can be included in at least one embodiment of the application. The appearances of the phrase in various places in the specification are not necessarily all referring to the same embodiment, nor are separate or alternative embodiments mutually exclusive of other embodiments. It is explicitly and implicitly understood by one skilled in the art that the embodiments described herein can be combined with other embodiments.

As shown in FIG. 1, FIG. 1 is a map of an embodiment of the adeno-associated virus expression vector of the present invention. The gene sequence of the adeno-associated virus expression vector is pAAV-hSyn-DIO-H2B-EGFP-T2A-TVA-WPRE-hGH polyA.

FIG. 2 is a schematic flow chart of an embodiment of the method for constructing an adeno-associated virus expression vector according to the present invention, as shown in FIG. 2. The method comprises the following steps:

s11: obtaining a first gene sequence and a second gene sequence.

The first gene sequence comprises a nuclear localization protein gene sequence, a color development protein gene sequence and a receptor protein gene sequence. In this example, the nuclear localization protein gene sequence is histone, H2B protein gene sequence, and the gene sequence is as shown in SEQ ID NO: 2, the chromogenic protein gene sequence is an enhanced green fluorescent protein and EGFP protein gene sequence, and the gene sequence is shown as SEQ ID NO: 3, the gene sequence of the receptor protein is avian leukosis virus receptor and TVA protein gene sequence, and the gene sequence is shown as SEQ ID NO: 5, respectively. The first gene sequence can also comprise a gene sequence of a short peptide with a self-cutting function, the gene sequence can be a T2A gene sequence, and the gene sequence is shown as SEQ ID NO: 4, respectively. The first gene sequence is shown as SEQ ID NO: 1 is shown. The EGFP protein gene sequence is added with GCCACC which is a Kozak sequence. This sequence has an important role in the initiation of translation. The second gene sequence is an adenovirus-associated vector pAAV-hSyn-DIO-EGFP-WPRE-hGH polyA.

S12: and introducing a restriction enzyme site into the first gene sequence, and performing restriction enzyme treatment on the first gene sequence and the second gene sequence.

NheI enzyme cutting sites and AscI enzyme cutting sites are introduced at two ends of the first gene sequence for subsequent gene cutting and connection. The second gene sequence already carries NheI enzyme cutting site and AscI enzyme cutting site for connecting with the first gene sequence after enzyme cutting. After NheI enzyme digestion and AscI enzyme digestion are carried out on the first gene sequence, gel running recovery is carried out to prevent the cut sticky ends from interfering the connection of target fragments.

S13: and connecting the first gene sequence and the second gene sequence after enzyme digestion treatment to obtain the adeno-associated virus expression vector.

And (3) connecting the first gene sequence and the second gene sequence after enzyme digestion treatment by using T4 ligase to obtain the required adeno-associated virus expression vector. The adeno-associated virus expression vector in the embodiment is pAAV-hSyn-DIO-H2B-EGFP-T2A-TVA-WPRE-hGH polyA. The gene sequence is shown as SEQ ID NO: and 6.

FIG. 3 is a schematic flow chart of another embodiment of the method for constructing an adeno-associated virus expression vector according to the present invention, as shown in FIG. 3. This embodiment is a further extension of step S13.

S131: and transforming a connecting product obtained by connecting the first gene sequence and the second gene sequence after enzyme digestion treatment into escherichia coli StbI3 competent cells, putting the escherichia coli StbI3 competent cells in a 35-degree incubator overnight, selecting a single clone for colony PCR identification, performing amplification culture and plasmid extraction on positive colonies, and performing double enzyme digestion verification and sequencing by using NheI and AscI to obtain the adeno-associated virus expression vector.

And transforming escherichia coli StbI3 competent cells by using a ligation product obtained by enzyme digestion treated H2B-GFP-T2A-TVA and pAAV-hSyn-DIO-H2B-EGFP-T2A-TVA-WPRE-hGH polyA, detecting plasmids after amplification culture, and obtaining plasmids with correct sequencing as required adeno-associated virus expression vectors pAAV-hSyn-DIO-H2B-EGFP-T2A-TVA-WPRE-hGH polyA.

FIG. 4 is a schematic flow chart of an embodiment of the method for producing adeno-associated virus according to the present invention, as shown in FIG. 4. The method comprises the following steps:

s21: and obtaining the adeno-associated virus expression vector.

The adeno-associated virus expression vector obtained according to the method of the above example, namely plasmid pAAV-hSyn-DIO-H2B-EGFP-T2A-TVA-WPRE-hGH polyA, was obtained.

S22: and (3) carrying out cell culture on the adeno-associated virus expression vector to obtain the adeno-associated virus.

And (3) carrying out cell culture on the plasmid carrying the target gene segment, the capsid plasmid and the helper plasmid together. Specifically, plasmid pAAV-hSyn-DIO-H2B-EGFP-T2A-TVA-WPRE-hGHpolyA, AAV serotype PHP. eB capsid plasmid pUCmini-iCAP-PHP. eB and adenovirus element Helper plasmid pAd-Helper transfect HEK-293T cells together according to the number of plasmid molecules 1:1: 1.

Supernatants and pellets were collected 72 hours after transfection. The collected HEK-293T cell pellet containing AAV virions was resuspended in lysate, and subjected to repeated freeze-thawing in liquid nitrogen and 37 ℃ water bath, followed by digestion with Benzonase nuclease (Sigma, E1014-25KU) at 37 ℃ for 1 hour. Mixing the supernatant treated by nuclease and the cell culture supernatant, adding PEG8000 (Solibao, 214B0310) and 0.5mol/L NaCl solution, mixing, standing at 4 deg.C for 16h, centrifuging to give up supernatant, and dissolving with 10mL PBS buffer solution to obtain virus supernatant concentrate. Adding 15%, 25%, 40% and 58% iodixanol solution into a Beckmann ultracentrifuge tube in sequence to prepare a density gradient, adding 10mL of virus supernatant concentrate, filling the centrifuge tube with PBS, and sealing. The tubes were placed in a Beckmann ultracentrifuge (rotor of Ti 70) and centrifuged at 64000rpm for 2 hours at 18 ℃. After the centrifugation was completed, the solution was sucked up with a syringe to recover a 40% iodixanol separation layer. Dialyzing the absorbed rAAV-containing solution in 40% iodixanol layer with a dialysis bag in PBS buffer solution at 4 deg.C for 16h, filtering the dialyzed virus solution with 0.22 μm filter membrane, sterilizing, adding into an ultrafiltration tube (Minipore, UFC910024), centrifuging, desalting, concentrating to volume of about 500 μ L, adding Pluronic F68 deionizing surfactant (Thermo Fisher Scientific, 24040032) with final concentration of 0.001%, packaging, and storing in-80 deg.C refrigerator. Finally, the titer of the recombinant adeno-associated virus is detected by using a SYBR Green qPCR method, and the titer of the finally obtained rAAV-hSyn-DIO-H2B-EGFP-T2A-TVA-WPRE-hGH polyA virus can reach 1.1 multiplied by 10¹³VG/mL。

Fig. 5 is a schematic flow chart of an embodiment of the cell labeling method of the present application, as shown in fig. 5. The method comprises the following steps:

s31: and obtaining the adeno-associated virus.

Obtaining the adeno-associated virus rAAV-hSyn-DIO-H2B-EGFP-T2A-TVA-WPRE-hGH polyA obtained in the above embodiment.

S32: after the adeno-associated virus and SAD-B19-delta G-DsRed virus are injected into organism, the cell location marker of partial region of organism is realized after full expression.

Adeno-associated virus was injected into 3 month old VGAT-Cre transgenic mice (The Jackson Laboratory) via tail vein, and The injection amount per mouse was 4X 10¹¹VG. After the virus was expressed for 3 weeks, EnvARVG-packaged SAD-B19- Δ G-DsRed virus (i.e., ENVA-RV- Δ G-DsRed) was injected into the Ventral Tegmental Area (VTA) region at a titer of 5 × 10⁷IU/mL, 150nL each. After 1 week of expression again, the cells were observed for localization.

The relevant observation procedure may be to inject 0.5mL of 1% sodium pentobarbital-0.9% sodium chloride Solution into the abdominal cavity of the mouse for anesthesia, and to perform heart perfusion using Phosphate Buffered Saline (PBS) and 4% Paraformaldehyde Solution (PFA) and to strip the brain tissue. Mouse brain tissue is fixed by PFA solution overnight, dehydrated by 30% sucrose-PBS solution, fully embedded by tissue embedding medium and cut into brain slices with the thickness of 40 μm by a freezing microtome, and imaged and observed by an Olympus VS120 slide scanning microscope. rAAV-hSyn-DIO-H2B-EGFP-T2A-TVA-WPRE-hGH polyA can assist ENVA-RV-delta G-DsRed to infect specific types of neurons in situ cells and efficiently retrogradely infect upstream brain regions, including lateral globus pallidus (GPe), lateral subthalamic region (LHA), medial anterior region (MPO), mesencephalic nucleus (MRN), nucleus accumbens (NAc), Perimidbrain Aqueductal Gray (PAG), central pono gray (PCG), posterior subthalamic nucleus (PH), caudad lateral ventral nucleus (PRNC), reticular nucleus of Pono (PRNR), Vestibular Nucleus (VNC), Zonate (ZI), and the like.

As shown in FIG. 6, FIG. 6 is a graph showing the fluorescence intensity of neurons infected with the adeno-associated virus expression vector and ENVA-RV- Δ G-DsRed of the present invention.

As can be seen, blue fluorescence is a signal for staining of nuclei by DAPI. The green fluorescence is a cell signal marked by rAAV-hSyn-DIO-H2B-EGFP-T2A-TVA-WPRE-hGH polyA virus. The red fluorescence is a cell signal infected by ENVA-RV-delta G-DsRed, and is labeled together with green fluorescence, which indicates that rAAV-hSyn-DIO-H2B-EGFP-T2A-TVA-WPRE-hGH polyA virus can assist ENVA-RV-delta G-DsRed in infecting upstream specific type neurons.

In summary, through the implementation of the above examples, the recombinant adeno-associated virus expression vector is obtained by splicing the nuclear localization protein gene, the chromoprotein gene and the receptor protein gene into the adeno-associated virus expression vector. The expression vector assists ENVA-RV-delta G-DsRed to realize the marking of the whole brain specific type neurons of a specific brain region because the expression vector contains a receptor protein gene.

In the several embodiments provided in the present application, it should be understood that the disclosed method and apparatus may be implemented in other manners. For example, the above-described device embodiments are merely illustrative, and for example, the division of the modules or units is only one logical division, and other divisions may be realized in practice, for example, a plurality of units or components may be combined or integrated into another system, or some features may be omitted, or not executed.

The units described as separate parts may or may not be physically separate, and parts displayed as units may or may not be physical units, may be located in one place, or may be distributed on a plurality of network units. Some or all of the units can be selected according to actual needs to achieve the purpose of the embodiment.

In addition, functional units in the embodiments of the present application may be integrated into one processing unit, or each unit may exist alone physically, or two or more units may be integrated into one unit. The integrated unit can be realized in a form of hardware, and can also be realized in a form of a software functional unit.

The integrated units in the other embodiments described above may be stored in a computer-readable storage medium if they are implemented in the form of software functional units and sold or used as separate products. Based on such understanding, the technical solution of the present application may be substantially implemented or contributed by the prior art, or all or part of the technical solution may be embodied in a software product, which is stored in a storage medium and includes instructions for causing a computer device (which may be a personal computer, a server, a network device, or the like) or a processor (processor) to execute all or part of the steps of the method according to the embodiments of the present application. And the aforementioned storage medium includes: a U-disk, a removable hard disk, a Read-Only Memory (ROM), a Random Access Memory (RAM), a magnetic disk or an optical disk, and other various media capable of storing program codes.

The above description is only an example of the present application and is not intended to limit the scope of the present application, and all modifications of equivalent structures and equivalent processes, which are made by the contents of the specification and the drawings, or which are directly or indirectly applied to other related technical fields, are intended to be included within the scope of the present application.

SEQUENCE LISTING

<110> Shenzhen advanced technology research institute of Chinese academy of sciences

<120> adeno-associated virus expression vector and construction, virus preparation and cell marking method thereof

<130> 6

<160> 6

<170> PatentIn version 3.5

<210> 1

<211> 1658

<212> DNA

<213> Artificial sequence

<400> 1

GCTAGCATGCCAGAGCCAGCGAAGTCTGCTCCCGCCCCGAAAAAGGGCTCCAAGAAGGCGGTGACTAAGGCGCAGAAGAAAGGCGGCAAGAAGCGCAAGCGCAGCCGCAAGGAGAGCTATTCCATCTATGTGTACAAGGTTCTGAAGCAGGTCCACCCTGACACCGGCATTTCGTCCAAGGCCATGGGCATCATGAATTCGTTTGTGAACGACATTTTCGAGCGCATCGCAGGTGAGGCTTCCCGCCTGGCGCATTACAACAAGCGCTCGACCATCACCTCCAGGGAGATCCAGACGGCCGTGCGCCTGCTGCTGCCTGGGGAGTTGGCCAAGCACGCCGTGTCCGAGGGTACTAAGGCCATCACCAAGTACACCAGCGCTAAGGATCCACCGGTCGCCACCATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGGAGGGCAGAGGAAGTCTGCTAACATGCGGTGACGTCGAGGAGAATCCTGGCCCAATCGATGCGCGGCTGCTGCCCGCGCTGCTGCTGCTGCTGCTGCCCGGTAACGTGACCGGTAACGGGTCCGGTAACGGTTCTTTGTCCCGTTGCCCCCCCGGTCAGTTCCGCTGCTCGGAGCCGCCCGGTGCCCACGGGGAGTGTTACCCGCAGGACTGGCTGTGCGACGGACACCCCGACTGCGACGACGGGCGGGACGAGTGGGGCTGCGGGACCAGCGCGATCCCCGCGGTGCCCACGGACAACGGCACAGAGGCTCCCACTGCCCCTGCTCCTGGACGTGCTCTGCCAGCCAGGAATCACGGCCGCATGTGGATGCTGATCACTGCAGTGCTCCTGTGCTGCCTGGTAGCTGTGGGTGGTATCGCTGCATGGGGGAAGTCCAAAGCAAAAAGCAGGTCTGACATCTTCAGTCTTGAAAGCGCATCCAAGGAGCTGCTGGTGCCTGACAAGAGCCAGGCAGACTTGTTCTCCTAAGGCGCGCC

<210> 2

<211> 378

<212> DNA

<213> Artificial sequence

<400> 2

ATGCCAGAGCCAGCGAAGTCTGCTCCCGCCCCGAAAAAGGGCTCCAAGAAGGCGGTGACTAAGGCGCAGAAGAAAGGCGGCAAGAAGCGCAAGCGCAGCCGCAAGGAGAGCTATTCCATCTATGTGTACAAGGTTCTGAAGCAGGTCCACCCTGACACCGGCATTTCGTCCAAGGCCATGGGCATCATGAATTCGTTTGTGAACGACATTTTCGAGCGCATCGCAGGTGAGGCTTCCCGCCTGGCGCATTACAACAAGCGCTCGACCATCACCTCCAGGGAGATCCAGACGGCCGTGCGCCTGCTGCTGCCTGGGGAGTTGGCCAAGCACGCCGTGTCCGAGGGTACTAAGGCCATCACCAAGTACACCAGCGCTAAG

<210> 3

<211> 717

<212> DNA

<213> Artificial sequence

<400> 3

ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAG

<210> 4

<211> 54

<212> DNA

<213> Artificial sequence

<400> 4

GAGGGCAGAGGAAGTCTGCTAACATGCGGTGACGTCGAGGAGAATCCTGGCCCA

<210> 5

<211> 477

<212> DNA

<213> Artificial sequence

<400> 5

ATCGATGCGCGGCTGCTGCCCGCGCTGCTGCTGCTGCTGCTGCCCGGTAACGTGACCGGTAACGGGTCCGGTAACGGTTCTTTGTCCCGTTGCCCCCCCGGTCAGTTCCGCTGCTCGGAGCCGCCCGGTGCCCACGGGGAGTGTTACCCGCAGGACTGGCTGTGCGACGGACACCCCGACTGCGACGACGGGCGGGACGAGTGGGGCTGCGGGACCAGCGCGATCCCCGCGGTGCCCACGGACAACGGCACAGAGGCTCCCACTGCCCCTGCTCCTGGACGTGCTCTGCCAGCCAGGAATCACGGCCGCATGTGGATGCTGATCACTGCAGTGCTCCTGTGCTGCCTGGTAGCTGTGGGTGGTATCGCTGCATGGGGGAAGTCCAAAGCAAAAAGCAGGTCTGACATCTTCAGTCTTGAAAGCGCATCCAAGGAGCTGCTGGTGCCTGACAAGAGCCAGGCAGACTTGTTCTCCTAA

<210> 6

<211> 6456

<212> DNA

<213> Artificial sequence

<400> 6

CCTGCAGGCAGCTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCGGGCGTCGGGCGACCTTTGGTCGCCCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCTGCGGCCGCACGCGTGTGTCTAGACTGCAGAGGGCCCTGCGTATGAGTGCAAGTGGGTTTTAGGACCAGGATGAGGCGGGGTGGGGGTGCCTACCTGACGACCGACCCCGACCCACTGGACAAGCACCCAACCCCCATTCCCCAAATTGCGCATCCCCTATCAGAGAGGGGGAGGGGAAACAGGATGCGGCGAGGCGCGTGCGCACTGCCAGCTTCAGCACCGCGGACAGTGCCTTCGCCCCCGCCTGGCGGCGCGCGCCACCGCCGCCTCAGCACTGAAGGCGCGCTGACGTCACTCGCCGGTCCCCCGCAAACTCCCCTTCCCGGCCACCTTGGTCGCGTCCGCGCCGCCGCCGGCCCAGCCGGACCGCACCACGCGAGGCGCGAGATAGGGGGGCACGGGCGCGACCATCTGCGCTGCGGCGCCGGCGACTCAGCGCTGCCTCAGTCTGCGGTGGGCAGCGGAGGAGTCGTGTCGTGCCTGAGAGCGCAGTCGAGAAGGATCCTCTAGAGTCGACTCCGGAATAACTTCGTATAGGATACTTTATACGAAGTTATGCAGAATGGTAGCTGGATTGTAGCTGCTATTAGCAATATGAAACCTCTTAATAACTTCGTATAGCATACATTATACGAAGTTATGGCGCGCCTTAGGAGAACAAGTCTGCCTGGCTCTTGTCAGGCACCAGCAGCTCCTTGGATGCGCTTTCAAGACTGAAGATGTCAGACCTGCTTTTTGCTTTGGACTTCCCCCATGCAGCGATACCACCCACAGCTACCAGGCAGCACAGGAGCACTGCAGTGATCAGCATCCACATGCGGCCGTGATTCCTGGCTGGCAGAGCACGTCCAGGAGCAGGGGCAGTGGGAGCCTCTGTGCCGTTGTCCGTGGGCACCGCGGGGATCGCGCTGGTCCCGCAGCCCCACTCGTCCCGCCCGTCGTCGCAGTCGGGGTGTCCGTCGCACAGCCAGTCCTGCGGGTAACACTCCCCGTGGGCACCGGGCGGCTCCGAGCAGCGGAACTGACCGGGGGGGCAACGGGACAAAGAACCGTTACCGGACCCGTTACCGGTCACGTTACCGGGCAGCAGCAGCAGCAGCAGCGCGGGCAGCAGCCGCGCATCGATTGGGCCAGGATTCTCCTCGACGTCACCGCATGTTAGCAGACTTCCTCTGCCCTCCTTGTACAGCTCGTCCATGCCGAGAGTGATCCCGGCGGCGGTCACGAACTCCAGCAGGACCATGTGATCGCGCTTCTCGTTGGGGTCTTTGCTCAGGGCGGACTGGGTGCTCAGGTAGTGGTTGTCGGGCAGCAGCACGGGGCCGTCGCCGATGGGGGTGTTCTGCTGGTAGTGGTCGGCGAGCTGCACGCTGCCGTCCTCGATGTTGTGGCGGATCTTGAAGTTCACCTTGATGCCGTTCTTCTGCTTGTCGGCCATGATATAGACGTTGTGGCTGTTGTAGTTGTACTCCAGCTTGTGCCCCAGGATGTTGCCGTCCTCCTTGAAGTCGATGCCCTTCAGCTCGATGCGGTTCACCAGGGTGTCGCCCTCGAACTTCACCTCGGCGCGGGTCTTGTAGTTGCCGTCGTCCTTGAAGAAGATGGTGCGCTCCTGGACGTAGCCTTCGGGCATGGCGGACTTGAAGAAGTCGTGCTGCTTCATGTGGTCGGGGTAGCGGCTGAAGCACTGCACGCCGTAGGTCAGGGTGGTCACGAGGGTGGGCCAGGGCACGGGCAGCTTGCCGGTGGTGCAGATGAACTTCAGGGTCAGCTTGCCGTAGGTGGCATCGCCCTCGCCCTCGCCGGACACGCTGAACTTGTGGCCGTTTACGTCGCCGTCCAGCTCGACCAGGATGGGCACCACCCCGGTGAACAGCTCCTCGCCCTTGCTCACCATGGTGGCGACCGGTGGATCCTTAGCGCTGGTGTACTTGGTGATGGCCTTAGTACCCTCGGACACGGCGTGCTTGGCCAACTCCCCAGGCAGCAGCAGGCGCACGGCCGTCTGGATCTCCCTGGAGGTGATGGTCGAGCGCTTGTTGTAATGCGCCAGGCGGGAAGCCTCACCTGCGATGCGCTCGAAAATGTCGTTCACAAACGAATTCATGATGCCCATGGCCTTGGACGAAATGCCGGTGTCAGGGTGGACCTGCTTCAGAACCTTGTACACATAGATGGAATAGCTCTCCTTGCGGCTGCGCTTGCGCTTCTTGCCGCCTTTCTTCTGCGCCTTAGTCACCGCCTTCTTGGAGCCCTTTTTCGGGGCGGGAGCAGACTTCGCTGGCTCTGGCATGCTAGCATAACTTCGTATAAAGTATCCTATACGAAGTTATTTGCCTTAACCCAGAAATTATCACTGTTATTCTTTAGAATGGTGCAAAGAATAACTTCGTATAATGTATGCTATACGAAGTTATGAATTCGATATCAAGCTTATCGATAATCAACCTCTGGATTACAAAATTTGTGAAAGATTGACTGGTATTCTTAACTATGTTGCTCCTTTTACGCTATGTGGATACGCTGCTTTAATGCCTTTGTATCATGCTATTGCTTCCCGTATGGCTTTCATTTTCTCCTCCTTGTATAAATCCTGGTTGCTGTCTCTTTATGAGGAGTTGTGGCCCGTTGTCAGGCAACGTGGCGTGGTGTGCACTGTGTTTGCTGACGCAACCCCCACTGGTTGGGGCATTGCCACCACCTGTCAGCTCCTTTCCGGGACTTTCGCTTTCCCCCTCCCTATTGCCACGGCGGAACTCATCGCCGCCTGCCTTGCCCGCTGCTGGACAGGGGCTCGGCTGTTGGGCACTGACAATTCCGTGGTGTTGTCGGGGAAATCATCGTCCTTTCCTTGGCTGCTCGCCTATGTTGCCACCTGGATTCTGCGCGGGACGTCCTTCTGCTACGTCCCTTCGGCCCTCAATCCAGCGGACCTTCCTTCCCGCGGCCTGCTGCCGGCTCTGCGGCCTCTTCCGCGTCTTCGCCTTCGCCCTCAGACGAGTCGGATCTCCCTTTGGGCCGCCTCCCCGCATCGATACCGAGCGCTGCTCGAGAGATCTACGGGTGGCATCCCTGTGACCCCTCCCCAGTGCCTCTCCTGGCCCTGGAAGTTGCCACTCCAGTGCCCACCAGCCTTGTCCTAATAAAATTAAGTTGCATCATTTTGTCTGACTAGGTGTCCTTCTATAATATTATGGGGTGGAGGGGGGTGGTATGGAGCAAGGGGCAAGTTGGGAAGACAACCTGTAGGGCCTGCGGGGTCTATTGGGAACCAAGCTGGAGTGCAGTGGCACAATCTTGGCTCACTGCAATCTCCGCCTCCTGGGTTCAAGCGATTCTCCTGCCTCAGCCTCCCGAGTTGTTGGGATTCCAGGCATGCATGACCAGGCTCAGCTAATTTTTGTTTTTTTGGTAGAGACGGGGTTTCACCATATTGGCCAGGCTGGTCTCCAACTCCTAATCTCAGGTGATCTACCCACCTTGGCCTCCCAAATTGCTGGGATTACAGGCGTGAACCACTGCTCCCTTCCCTGTCCTTCTGATTTTGTAGGTAACCACGTGCGGACCGAGCGGCCGCAGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGCAGCTGCCTGCAGGGGCGCCTGATGCGGTATTTTCTCCTTACGCATCTGTGCGGTATTTCACACCGCATACGTCAAAGCAACCATAGTACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTTGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGGCTATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAACGCGAATTTTAACAAAATATTAACGTTTACAATTTTATGGTGCACTCTCAGTACAATCTGCTCTGATGCCGCATAGTTAAGCCAGCCCCGACACCCGCCAACACCCGCTGACGCGCCCTGACGGGCTTGTCTGCTCCCGGCATCCGCTTACAGACAAGCTGTGACCGTCTCCGGGAGCTGCATGTGTCAGAGGTTTTCACCGTCATCACCGAAACGCGCGAGACGAAAGGGCCTCGTGATACGCCTATTTTTATAGGTTAATGTCATGATAATAATGGTTTCTTAGACGTCAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTATTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGT

Claims

1. A method for constructing an adeno-associated virus expression vector, the method comprising:

obtaining a first gene sequence and a second gene sequence, wherein the first gene sequence comprises a nuclear localization protein gene sequence, a color development protein gene sequence and a receptor protein gene sequence;

introducing a restriction enzyme site into the first gene sequence, and performing restriction enzyme treatment on the first gene sequence and the second gene sequence; wherein the second gene sequence carries the enzyme cleavage site;

and connecting the first gene sequence and the second gene sequence after enzyme digestion treatment to obtain the adeno-associated virus expression vector.

2. The method of claim 1,

enzyme cutting sites introduced at two ends of the first gene sequence are NheI enzyme cutting sites and AscI enzyme cutting sites respectively.

3. The method of claim 2, wherein the first and second gene sequences after the ligase comprise:

and using T4 ligase to connect the first gene sequence and the second gene sequence after enzyme digestion treatment.

4. The method of claim 2,

the nuclear localization protein is histone, and the gene sequence of the nuclear localization protein is shown as SEQ ID NO: 2, the chromogenic protein is green fluorescent protein, and the gene sequence of the chromogenic protein is shown as SEQ ID NO: 3, the receptor protein is an avian leukemia virus receptor, and the gene sequence of the receptor protein is shown as SEQ ID NO: 5, respectively.

5. The method of claim 4, wherein the first gene sequence is H2B-EGFP-T2A-TVA and the gene sequence is as set forth in SEQ ID NO: 1, wherein H2B is the histone, EGFP is the green fluorescent protein, TVA is the avian leukosis virus receptor, T2A is a short peptide with self-cutting function, and the gene sequence is shown as SEQ ID NO: 4, respectively.

6. The method of claim 4,

the second gene sequence is pAAV-hSyn-DIO-EGFP-WPRE-hGH polyA, the adeno-associated virus expression vector is pAAV-hSyn-DIO-H2B-EGFP-T2A-TVA-WPRE-hGH polyA, and the gene sequence is shown in SEQ ID NO: and 6.

7. The method of claim 6, wherein the obtaining the adeno-associated virus expression vector by ligating the first gene sequence and the second gene sequence after the enzyme digestion comprises:

and transforming a connecting product obtained by connecting the first gene sequence and the second gene sequence after enzyme digestion treatment into escherichia coli StbI3 competent cells, putting the escherichia coli StbI3 competent cells in a 35-degree incubator overnight, selecting a single clone for colony PCR identification, performing amplification culture and plasmid extraction on positive colonies, and performing double enzyme digestion verification and sequencing by using NheI and AscI to obtain the adeno-associated virus expression vector.

8. A method for producing an adeno-associated virus, comprising the steps of,

obtaining the adeno-associated virus expression vector obtained by the method according to any one of claims 1 to 7;

carrying out cell culture on the adeno-associated virus expression vector to obtain adeno-associated virus;

wherein the adeno-associated virus is rAAV-hSyn-DIO-H2B-EGFP-T2A-TVA-WPRE-hGH polyA virus.

9. The method of claim 8, wherein the cell culturing the adeno-associated virus expression vector comprises:

and (3) carrying out cell culture on the plasmid containing the adeno-associated virus expression vector, the capsid plasmid and the helper plasmid.

10. The method of claim 9, wherein the cell culturing the plasmid comprising the adeno-associated virus expression vector, the capsid plasmid, and the helper plasmid comprises:

plasmids containing the adeno-associated virus expression vector, capsid plasmids, and helper plasmids were expressed as plasmid molecules 1:1:1 co-transfecting HEK-293T cells;

the capsid plasmid is AAV capsid plasmid pUCmini-iCAP-PHP.eB of serotype PHP.eB, and the Helper plasmid is adenovirus element Helper plasmid pAd-Helper.

11. The method of claim 8,

the titer of the adeno-associated virus is 1.1 × 10¹³VG/mL of rAAV-hSyn-DIO-H2B-EGFP-T2A-TVA-WPRE-hGH polyA virus.

12. A method for labeling a cell, characterized in that,

obtaining an adeno-associated virus obtained by the production method according to any one of claims 8 to 11;

injecting the adeno-associated virus and SAD-B19-delta G-DsRed virus into an organism, and realizing cell positioning marking on a partial region of the organism after full expression;

wherein the cells of the partial region comprise neurons of a specific type in the upper brain region.

13. An expression vector characterized in that,

the expression vector is the adeno-associated virus expression vector obtained by the construction method according to any one of claims 1 to 7;

the adeno-associated virus expression vector comprises an H2B-EGFP-T2A-TVA gene sequence.