CN114196675A

CN114196675A - Antisense oligonucleotide targeting LINC00624 and application thereof in breast cancer treatment

Info

Publication number: CN114196675A
Application number: CN202111597010.4A
Authority: CN
Inventors: 修秉虬; 吴炅; 张琪; 迟亚云; 薛静彦; 张礼翼; 陈铭; 季玮儒
Original assignee: Fudan University Shanghai Cancer Center
Current assignee: Fudan University Shanghai Cancer Center
Priority date: 2021-12-24
Filing date: 2021-12-24
Publication date: 2022-03-18

Abstract

The invention belongs to the technical field of breast cancer treatment, and particularly discloses LINC 00624-targeted antisense oligonucleotide and application thereof in breast cancer treatment. The invention discovers a molecular marker LINC00624 of breast cancer drug resistance, obtains 5 antisense oligonucleotides (ASO1-5) capable of efficiently targeting and degrading LINC00624 in cells, and verifies that the 5 antisense oligonucleotides (ASO1-5) can inhibit breast cancer transplantable tumors by single or mixed use through intravenous injection verification of mice, thereby realizing single or combined use and enhancing the anti-cancer effect of the drug.

Description

Antisense oligonucleotide targeting LINC00624 and application thereof in breast cancer treatment

Technical Field

The invention belongs to the technical field of breast cancer treatment, and relates to LINC 00624-targeted antisense oligonucleotide and application thereof in breast cancer treatment.

Background

LINC00624 is a long non-coding RNA highly expressed in tumor cells. The data show a newly discovered long non-coding RNA. LINC00624 can inhibit intracellular RNA perception by stabilizing ADAR1, thereby reducing the activation of the interferon pathway and promoting drug resistance in breast cancer treatment. Meanwhile, the high expression of LINC00624 can reduce the curative effect of immunotherapy. The ASO can be used as a tool to interfere with LINC00624, and has a conversion value.

A large number of lncrnas that function as oncogenes have been identified in various tumors. In the related research of the breast cancer, the expression of a long-chain non-coding gene HOTAIR can promote the activity of a transcription factor of an Estrogen Receptor (ER), thereby promoting the drug resistance of tamoxifen. IncRNA from MaTAR 25(Mammary Tumor-Associated RNA 25, breast Tumor-Associated RNA 25) in mice promotes cell migration and invasion. The gene is knocked out, the growth and metastasis of the breast cancer of a mouse can be obviously inhibited, and the high expression of the human genome homologous product LINC01271 of the LncRNA is directly related to the malignant progression of the breast tumor. Therefore, the LncRNA has values as a breast cancer risk gene, a diagnosis marker, a prognosis marker and a treatment target.

Tools used in current studies to knock down the expression of long non-coding RNAs include: small interfering ribonucleic acid (siRNA) or short hairpin RNA (short hairpin RNA), among them, small interfering ribonucleic acid (siRNA) has a great potential for clinical application (short hairpin RNA requires vector overexpression into cells, and clinical transformation potential is low). At present, no research reports the effect of small interfering RNA aiming at LINC00624 in the field of breast cancer treatment.

Disclosure of Invention

Based on the defects of the prior art, the invention discovers a molecular marker of breast cancer drug resistance and a treatment target LINC00624, and obtains antisense oligonucleotide capable of efficiently targeting and degrading LINC00624 in cells, thereby realizing single-use or combined drug administration and enhancing the anti-cancer effect.

In a first aspect, the present invention provides an antisense oligonucleotide capable of specifically binding to LINC00624 to inhibit/degrade its expression.

In certain embodiments, the antisense oligonucleotide is selected from the group consisting of any one of (1) to (2) below:

(1) as shown in SEQ ID NO: 1-5 in sequence;

(2) as shown in SEQ ID NO: 1-5, at least 2 of the sequences shown;

(3) one or more nucleotides encoding a sequence complementary to a sequence capable of hybridizing to the sequence shown in (1) under high or very high stringency conditions.

In certain embodiments, the antisense oligonucleotide has at least one modification; the modification is selected from one or more of internucleoside linkage modification, methylation modification or cholesterol modification; preferably, the modification of the internucleoside linkage is a cholesterol modification, so as to enhance penetration of the membrane of the cancer cell and the membrane of the nucleus.

In a second aspect, the present invention provides a pharmaceutical composition capable of treating cancer, wherein the active ingredient of the pharmaceutical composition is the antisense oligonucleotide of the first aspect, and the cancer is selected from melanoma, sarcoma, lymphoma, brain cancer, breast cancer, liver cancer, stomach cancer, lung cancer, colon cancer; preferably, breast cancer.

In certain embodiments, the nucleotide is present in a liposome or linked to a pharmaceutically acceptable carrier.

In a third aspect, the present invention provides the use of an antisense oligonucleotide according to the first aspect above in the manufacture of a medicament having any one of the following functions, selected from:

(1) preventing and/or treating cancer;

(2) inhibiting the growth of cancer cells;

(3) slowly and continuously killing cancer cells;

(4) immunotherapy of cancer;

wherein the cancer is selected from melanoma, sarcoma, lymphoma, brain cancer, breast cancer, liver cancer, gastric cancer, lung cancer, and colon cancer; preferably breast cancer.

In certain embodiments, the cell is selected from a proliferative, neoplastic, pre-cancerous, or metastatic cell.

In certain embodiments, the metastatic cells are selected from metastatic tumor cells.

In a fourth aspect, the invention also provides a method of slow and sustained killing of cells for non-disease diagnostic and therapeutic purposes, the method comprising contacting the cells with an antisense oligonucleotide according to the first aspect or a pharmaceutical composition according to the second aspect.

In certain embodiments, the cell is selected from a proliferative, neoplastic, pre-cancerous, or metastatic cell; the metastatic cells are selected from metastatic tumor cells.

In certain embodiments, the pharmaceutical composition may be administered orally, intraperitoneally, intravenously, intraarterially, intramuscularly, intradermally, subcutaneously, transdermally, nasally, rectally, intratumorally, intralesionally, intrathecally, by subarachnoid injection, or systemically; optionally, the systemic administration comprises administration by intravascular administration; preferably, the intravascular administration is selected from injection, perfusion.

In certain embodiments, the method further comprises administering a second anti-cancer therapy that is a combination of one or more of chemotherapy, radiation therapy, immunotherapy, biological therapy, targeted therapy, and surgical therapy.

Compared with the prior art, the invention has the following technical effects:

1) the invention discovers that LINC00624 can be used as a molecular marker of breast cancer drug resistance for the first time, and provides a new target and a new idea for preventing or treating breast cancer.

2) Aiming at a target LINC00624, 5 antisense oligonucleotides (ASO1-5) capable of efficiently targeting and degrading LINC00624 in cells are prepared and subjected to cholesterol modification, and through intravenous injection verification of mice, the 5 antisense oligonucleotides (ASO1-5) can be used singly or in a mixed mode and can have an inhibitory effect on breast cancer transplantable tumors.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments will be briefly described below.

FIG. 1 shows the LINC00624 expression amount of pre-operation hollow needle puncture of 63 patients receiving new adjuvant chemotherapy HER2 positive breast cancer; FPKM, fragments per kilobase per million.

FIG. 2 is a Kapan-Meier survival analysis of the central 319 cohorts of breast cancer specimens for relapse free survival (A) RFS Kaplan-Meier survival curves in all patients typed; (B) RFS Kaplan-Meier curve in ER/PR positive patients; (C) RFS Kaplan-Meier curve in HER2 positive patients; (D) RFS Kaplan-Meier curves in TNBC patients. HR: hazard ratio, risk ratio; 95% CI: confidence interval, 95% confidence interval.

Fig. 3 is a knock-down effect identification of 5 ASOs in breast cancer cells.

FIG. 4 is an animal experiment with cholesterol-modified ASO1-5 used alone or in combination, wherein the left panel: BT474 breast cancer cell nude mouse tumorigenic growth curve, right panel: the picture was taken after the tumor was stripped.

Detailed Description

The invention will be better understood from the following examples. However, it is easily understood by those skilled in the art that the description of the embodiment is only for illustrating and explaining the present invention and is not for limiting the present invention described in detail in the claims. Unless otherwise specified, reagents, methods and equipment used in the present invention are conventional methods, and test materials used therein are available from commercial companies, unless otherwise specified.

Definition of

In the claims and/or the description of the present disclosure, the words "a" or "an" or "the" may mean "one", but may also mean "one or more", "at least one", and "one or more than one".

As used in the claims and specification, the terms "comprising," "having," "including," or "containing" are intended to be inclusive or open-ended and do not exclude additional, unrecited elements or method steps. Also, the terms "comprising," "having," "including," or "containing" are intended to be inclusive and mean that there may be additional, unrecited elements or method steps.

In the present disclosure, the term "about" means: a value includes the standard deviation of error for the device or method used to determine the value.

Although the disclosure supports the definition of the term "or" as merely an alternative as well as "and/or," the term "or" in the claims means "and/or" unless expressly indicated to be merely an alternative or a mutual exclusion between alternatives.

In the present disclosure, the term "antisense oligonucleotide (ASO)" means a nucleic acid fragment expressed in vivo or artificially synthesized, which is complementary to a certain segment of a target gene or mRNA, and can bind to the target gene/mRNA by the base complementary principle, thereby blocking the expression of the gene.

The term "cancer" as used in this disclosure includes any cancer, including, but not limited to, melanoma, sarcoma, lymphoma, cancer (e.g., brain, breast, liver, stomach, lung, and colon), and leukemia.

The terms "prevent," "treat," or any variation of these terms, as used in this disclosure, include any measurable reduction or complete inhibition to achieve a desired result (e.g., cancer treatment). Desirable results include, but are not limited to, alleviation, reduction, slowing, or eradication of cancer or a proliferative disorder or cancer-related symptoms, as well as improved quality of life or prolongation of life.

In some embodiments, the disclosure relates to stringency of hybridization conditions for defining the degree of complementarity of two polynucleotides. Alternatively, the aforementioned polynucleotide may be selected from DNA. "stringency" as used in this disclosure refers to the conditions of temperature and ionic strength during hybridization and the presence or absence of certain organic solvents. The higher the stringency, the higher the degree of complementarity between the target nucleotide sequence and the labeled polynucleotide sequence. "stringent conditions" refer to temperature and ionic conditions under which only nucleotide sequences having a high frequency of complementary bases will hybridize. The term "hybridizes under high or very high stringency conditions" as used herein describes the conditions used for hybridization and washing. Guidance for performing hybridization reactions can be found in Current Protocols in molecular biology, John Wiley and Sons, N.Y. (1989), 6.3.1-6.3.6. Specific hybridization conditions mentioned in this disclosure are as follows: 1) high stringency hybridization conditions: washing one or more times in 6X sodium chloride/sodium citrate (SSC) at about 45 ℃ and then with 0.2XSSC, 0.1% SDS at 65 ℃; 2) very high stringency hybridization conditions: 0.5M sodium phosphate, 7% SDS at 65 ℃ and then washed one or more times with 0.2XSSC, 1% SDS at 65 ℃.

In certain aspects of the disclosure, a cell is contained within a patient, and the cell can be a proliferative, neoplastic, precancerous, metastatic cell. Illustratively, the cells are selected from cancer cells.

In a particular embodiment, the cancer cell is selected from the group consisting of melanoma cells, sarcoma cells, lymphoma cells, cancer (e.g., brain, breast, liver, stomach, lung, and colon cancer) cells.

In certain aspects of the present disclosure, administration may be oral, intraperitoneal, intravenous, intraarterial, intramuscular, intradermal, subcutaneous, transdermal, nasal, or rectal administration. In certain aspects, the compositions are administered systemically, particularly by intravascular administration, including injection, infusion, and the like.

The term "radiotherapeutic agent" in the present disclosure includes the use of drugs that cause DNA damage. Radiotherapy has been widely used in cancer and disease treatment and includes those commonly referred to as gamma rays, X-rays and/or the targeted delivery of radioisotopes to tumor cells.

The term "chemotherapeutic agent" in the present disclosure is a chemical compound useful for the treatment of cancer. Classes of chemotherapeutic agents include, but are not limited to: alkylating agents, antimetabolites, kinase inhibitors, spindle poison plant alkaloids, cytotoxic/antitumor antibiotics, topoisomerase inhibitors, photosensitizers, anti-estrogen and selective estrogen receptor modulators, anti-progestins, estrogen receptor downregulators, estrogen receptor antagonists, luteinizing hormone-releasing hormone agonists, anti-androgens, aromatase inhibitors, EGFR inhibitors, VEGF inhibitors, antisense oligonucleotides that inhibit the expression of genes involved in abnormal cell proliferation or tumor growth. Chemotherapeutic agents useful in the treatment methods of the present disclosure include cytostatic and/or cytotoxic agents.

The term "immunotherapeutic agent" in the present disclosure includes "immunomodulators" and agents that promote or mediate antigen presentation that promotes a cell-mediated immune response. Among these, "immune modulators" include immune checkpoint modulators, such as immune checkpoint protein receptors and their ligands that mediate the inhibition of T cell-mediated cytotoxicity and are typically expressed by tumors or on anergic T cells in the tumor microenvironment and allow the tumor to evade immune attack. Inhibitors of the activity of immunosuppressive checkpoint protein receptors and their ligands can overcome the immunosuppressive tumor environment to allow cytotoxic T cell attack of the tumor. Examples of immune checkpoint proteins include, but are not limited to, PD-1, PD-L1, PDL2, CTLA4, LAG3, TIM3, TIGIT, and CD 103. Modulation (including inhibition) of the activity of such proteins may be accomplished by immune checkpoint modulators, which may include, for example, antibodies, aptamers, small molecules that target checkpoint proteins, and soluble forms of checkpoint receptor proteins, among others. PD-1 targeted inhibitors include the approved pharmaceutical agents pembrolizumab and nivolumab, while plepima (ipilimumab) is an approved CTLA-4 inhibitor. Antibodies specific for PD-L1, PD-L2, LAG3, TIM3, TIGIT, and CD103 are known and/or commercially available and can also be produced by those skilled in the art.

The Molecular biological methods used in the present disclosure can be referred to the corresponding methods described in publications such as "Current Protocols in Molecular Biology, Wiley publication", "Molecular Cloning, Manual, Cold spring harbor laboratory publication", and the like.

The method for synthesizing the antisense oligonucleotide in the present disclosure is not particularly limited, and can be synthesized by a known oligonucleotide synthesizer, for example, a phosphoamidite method, a phosphorothioate method, a phosphotriester method, or the like.

In one embodiment of the disclosure, antisense oligonucleotides include oligonucleotides containing modified backbones or non-natural internucleoside linkages. As determined herein, oligonucleotides having modified backbones include those oligonucleotides that retain a phosphorus atom in the backbone and those oligonucleotides that do not contain a phosphorus atom in the backbone. For the purposes of this specification, and as sometimes referred to in the art, modified oligonucleotides that do not contain a phosphorus atom in the internucleoside backbone can also be considered oligonucleosides.

In one embodiment of the disclosure, modified oligonucleotide backbones include, for example, phosphorothioate (phosphorothioate), chiral phosphorothioate, phosphorodithioate, phosphotriester, aminoalkyl phosphotriester, methyl and other alkyl phosphate esters, including 3 '-alkylene phosphate esters and chiral phosphate esters, phosphines, phosphoramidates, including 3' -phosphoramidate and aminoalkyl phosphoramidate, thionophosphate triester, and borylphosphate having a normal 3 '-5' linkage, a 2 '-5' linked analog thereof, and having inverted polarity, wherein adjacent paired nucleoside units are 3 '-5' to 5 '-3' or 2 '-5' to 5 '-2' linked. Also included are various salts, mixed salts and free acid forms.

In one embodiment of the present disclosure, the preferred modified oligonucleotide backbone excluding the phosphorus atom is a backbone formed from short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkynyl internucleoside linkages, or one or more short chain heteroatom or heterocyclic internucleoside linkages. They include those containing morpholino linkages (formed by the sugar moiety of a nucleoside); a siloxane backbone; sulfide, sulfoxide and sulfone backbones; a formylacetyl and thiocarbonylacetyl backbone; methylene formyl acetyl and thio formyl acetyl skeletons; a backbone comprising an alkene; a sulfamate backbone; methylene imino and methylene hydrazino skeletons; sulfonate and sulfonamide backbones; an amide skeleton; and those containing mixed N, O, S and CH2 building part of the backbone.

In other preferred oligonucleotide mimetics, the sugar and internucleoside linkages, i.e., the backbone of the nucleotidic unit, are replaced by new groups. The base units are retained for hybridization with a suitable nucleic acid target compound. One such oligomeric compound, an oligonucleotide mimetic that has been shown to have excellent hybridization properties, is known as a nucleic acid Peptide (PNA). In PNA compounds, the sugar backbone of an oligonucleotide is replaced by an amine amide-containing backbone, in particular an aminoethylglycine backbone. The nucleobases are retained and bound directly or indirectly to the aza nitrogen atoms of the amide portion of the backbone.

Preferred embodiments of the present disclosure are oligonucleotides having phosphorothioate backbones. The modified oligonucleotide may also comprise one or more substituted sugar moieties.

Other preferred modifications in the present disclosure include 2 '-methoxy (2' O-CH 3), 2 '-aminopropoxy (2' -OCH 2 CH2 NH 2) and 2 '-fluoro (2' -F). Similar modifications may also be made at other positions on the oligonucleotide, particularly the 3 'position of the sugar on the 3' terminal nucleotide or the 5 'position of the nucleotide at the 5' end in 2 '-5' linked oligonucleotides. The oligonucleotide may also have a glycomimetic form, such as with a cyclobutyl moiety in place of pentofuranose. Oligonucleotides may also include nucleobase (often referred to in the art simply as "base") modifications or substitutions. As used herein, "unmodified" or "natural" nucleobases include the purine bases adenine (A) and uracil (G), as well as the pyrimidine bases thymine (T), cytosine (C) and uracil (U). Modified nucleobases include other synthetic and natural nucleobases such as 5-methylcytosine (5-Me-C), 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyluracil and cytosine, 6-azouracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxy and other 8-substituted adenines and guanines, 5-halogen is in particular 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine and 7-deazaguanine and 3-deazaadenine.

Other modifications of the oligonucleotides of the disclosure include chemically linking to the oligonucleotide one or more moieties or conjugates that enhance the activity, cellular distribution, or cellular uptake of the oligonucleotide. The moieties include, but are not limited to, lipid moieties such as cholesterol moieties, cholic acids, thioethers, e.g., hexyl-S-tritylthiol, thiocholesterol, aliphatic chains, e.g., sebacic acid or undecyl residues, phospholipids, e.g., dihexadecyl-rac-glycerol or triethylammonium 1, 2-di-o-hexadecyl-rac-glycerol-3-H-phosphate, polyamine or polyethylene glycol chains, or adamantane acetic acid, palmityl moieties, or octadecylamine or hexylamino-carbonyl-oxocholesterol moieties.

In the present disclosure, all positions of an antisense oligonucleotide need not be uniformly modified throughout, and in fact more than one of the above-described modifications may be incorporated in a single compound or even on a single nucleoside within the oligonucleotide. The disclosure also includes antisense oligonucleotides that are chimeric compounds. In the present disclosure, a "chimeric" antisense oligonucleotide or "chimera" is an antisense oligonucleotide, particularly an oligonucleotide, comprising two or more chemically distinguishable regions, each consisting of at least one monomeric unit, such as a nucleotide in an oligonucleotide compound. These oligonucleotides typically include at least one region in which the oligonucleotide is modified so as to confer to the oligonucleotide an increase in resistance to nuclease degradation, an increase in cellular uptake, and/or an increase in binding affinity for the target nucleic acid. Additional regions of the oligonucleotide may serve as primers capable of cleaving RNA: DNA or RNA: substrates for enzymes of RNA hybrids. For example, RNaseH is a splicing RNA: cellular endonucleases of the RNA strand of the DNA duplex. Thus, activation of RNaseH results in cleavage of the RNA target, thereby greatly enhancing the efficacy of the oligonucleotide in inhibiting gene expression. Thus, when chimeric oligonucleotides are used, comparable results are generally obtained with shorter oligonucleotides compared to phosphorothioate deoxyoligonucleotides that hybridize to the same target region. Cleavage of the RNA target can be routinely detected by gel electrophoresis, and, if desired, related nucleic acid hybridization techniques known in the art.

The chimeric antisense oligonucleotides of the present disclosure can be constructed as a composite structure of two or more oligonucleotides, modified oligonucleotides, oligonucleosides, and/or oligonucleotide mimetics as described above. The antisense oligonucleotides are also referred to in the art as hybrids.

In a specific embodiment, to increase the stability of the antisense oligonucleotides of the present disclosure and their affinity for cells, derivatives obtained by replacing the hydroxyl group in the phosphate or ribose moiety with another, more stable group can be used without significantly reducing their activity. Specific examples of such antisense oligonucleotide derivatives include derivatives in which a phosphorothioate group, a methylphosphonate group or the like is substituted for the phosphate group, or in which the hydroxyl group of the ribose moiety is substituted for an alkoxy group such as a methoxy group, an allyloxy group or the like or an amino group, a fluorine atom or the like.

In the molecular design of the antisense oligonucleotides of the present disclosure, the nucleotide sequence constituting the antisense oligonucleotides is important. Oligonucleotides are modified compounds that include modifications of peptide nucleic acids in addition to naturally occurring nucleotide molecules and non-naturally occurring modified oligonucleotides described above. The translating functional nucleotide in the present disclosure preferably has a sugar (preferably a pentose sugar) in its structure to facilitate penetration of cell membranes, nuclear membranes, and the like.

In a specific embodiment, the antisense oligonucleotides of the present disclosure preferably carry cholesterol modifications to enhance penetration of cancer cell and nuclear membranes.

The antisense oligonucleotides of the present disclosure may also be used alone. Accordingly, the present disclosure provides a cancer cell growth inhibitor and a therapeutic or prophylactic agent for cancer (hereinafter sometimes referred to as all pharmaceutical preparations) which may be composed of the antisense oligonucleotide, but is preferably a pharmaceutical preparation obtained by mixing the antisense oligonucleotide with a pharmaceutically acceptable substance by a known method to form a mixture. Here, although the cancer cell growth inhibitor and the cancer treating or preventing agent are not particularly distinguished in terms of composition, production process, etc., they are different in that the cancer cell growth inhibitor is used for inhibiting cancer cell growth in addition to alleviating or ameliorating symptoms of cancer or treating or preventing cancer, for example, as a general agent in a usual experimental procedure. The pharmaceutical preparation can be prepared in the following manner.

For example, an injection can be prepared by dissolving the antisense oligonucleotide of the present disclosure in a solvent such as water, physiological saline, glucose solution, etc., and if necessary, can contain a buffer, a preservative, a stabilizer, etc.

The ointment can be prepared by dissolving or dispersing the antisense oligonucleotide in the present disclosure in a lipid-based, emulsion-based or water-soluble substance, and if necessary, can contain a stabilizer, a pH adjuster, a plasticizer, an emulsifier, a surfactant, a solubilizer, a humectant, a preservative, a bactericide, a solvent, an absorption accelerator, and the like.

Emulsions, lotions and the like can be prepared by dissolving or dispersing the antisense oligonucleotide in the present disclosure in an aqueous phase and then emulsifying with an oil phase component such as a hydrocarbon or higher alcohol, and if necessary, can contain substances such as stabilizers, pH adjusters, plasticizers, emulsifiers, surfactants, solubilizers, humectants, preservatives, bactericides, solvents, absorption accelerators and the like.

The cytostatic agent of the present disclosure may be prepared as a dry type product, and may be easily formed into a solution when a solvent, for example, water, which is a general solvent, is added.

When it is desired to integrate the antisense oligonucleotides of the present disclosure more efficiently into living bodies or to have sustained action, the antisense oligonucleotides are preferably formed into pharmaceutical formulations together with pharmaceutically acceptable known carriers. Carriers include, for example, lipid-based carriers such as liposomes, fatty emulsifiers, and microcapsules, peptide carriers such as polylysine, and polyornithine synthetic polymeric carriers such as polyethyleneimine and polylactic acid/ethylene glycol copolymers. In particular, pharmaceutical formulations in combination with liposomes are preferred. In pharmaceutical formulations, the antisense oligonucleotides of the present disclosure are preferably present in a form embedded in liposomes. These carriers can be formulated by known methods.

For example, methods of formulation with liposomes are described in Gregory, g. (ed), Liposome Technology: liposomepreparation and Related Techniques, 2nd Ed., CRC Pr., 1992, etc. The pharmaceutical preparation associated with the liposome may include not only lipids such as phospholipids, glycolipids and neutral lipids, which are generally used to form liposomes, but also substances that provide cationic charges to form liposomes, such as dicetyl phosphate, stearamide, etc., and substances that prevent oxidation of liposomes, such as alpha-tocopherol, etc. For the purpose of enhancing integration into cells and enhancing targeting of targeted cells, modified vectors as described above may be used.

Here, these pharmaceutical preparations may include other components known to have anticancer effects.

In the above pharmaceutical preparations, the antisense oligonucleotide in the present disclosure can be used after being linked to a vector, for example, being incorporated into any vector. In this case, the antisense oligonucleotide is preferably operably linked to a suitable promoter. The term "operable" means that an antisense oligonucleotide (RNA) can be expressed in a living cell under the action of the promoter. Vectors include, but are not limited to, for example, adenoviral vectors, poxviral vectors, retroviral vectors, and the like. These vectors are useful as vectors for gene therapy. For methods of constructing these vectors, specific uses thereof, and the like, reference may be made to, for example, Sambrook, j., et al, Molecular Cloning: a Laboratory Manual; 2nd Ed., Cold Spring Harbor laboratory, Cold Spring Harbor, NY, 1989, etc.

The content of the antisense oligonucleotide in the pharmaceutical preparation of the present disclosure is not particularly limited, and can be appropriately adjusted to achieve the desired effect of each pharmaceutical preparation. Generally, a content of about 1 to 10% by mass is suitable.

The cancer cell growth inhibitor and the cancer therapeutic or prophylactic agent in the present disclosure can be obtained by the above-described method. Accordingly, a method for producing the cancer cell growth inhibitor and the cancer therapeutic or prophylactic agent of the present disclosure using the antisense oligonucleotide of the present disclosure is provided as another embodiment of the present disclosure.

The method of administering the cancer therapeutic or prophylactic preparation in the present disclosure to a living body may include, but is not particularly limited to, for example, oral administration, intravenous administration, transdermal administration, topical administration, intraperitoneal administration, and the like, depending on the form of the therapeutic or prophylactic preparation. As a method of administering the cancer therapeutic or prophylactic preparation of the present disclosure, a more effective method can be selected depending on the individual and the condition of the disease, and intravenous administration is generally preferable. The dose of the cancer therapeutic or prophylactic agent to be administered is determined depending on the symptoms and the like, and is not particularly limited. In the case of intravenous administration, the dose of the cancer therapeutic or prophylactic agent is preferably 0.1 to 1 mg/(body weight) kg, more preferably 0.1 to 0.5 mg/(body weight) kg per day per person in terms of the amount of the antisense oligonucleotide in the present disclosure. The administration may be once daily or in divided portions. The administration period is also not particularly limited.

Here, the living body to which the cancer therapeutic or prophylactic agent of the present disclosure is administered is not limited to the above-mentioned human, but includes other animals such as mammals. The cancer cell growth inhibitor in the present disclosure is also used in the same manner as the cancer therapeutic or prophylactic agent in the present disclosure.

The site of the cancer cell that is a target of the cancer cell growth inhibitor and the cancer therapeutic or prophylactic agent of the present disclosure is not particularly limited, and it is particularly preferable that the cancer cell is derived from a body surface such as skin; the digestive tract such as the esophagus, stomach, and large intestine; the inhibitor or formulation may be administered intra-arterially to the liver or the like.

Example 1

63 cases of pre-operation hollow needle puncture tissue samples for receiving a patient with neoadjuvant chemotherapy HER2 positive breast cancer are utilized, tissue RNA is extracted, qPCR is carried out for reverse transcription to detect the expression level of LINC00624, and the samples are grouped according to the curative effect of neoadjuvant therapy: pathological complete remission pCR and pathological incomplete remission non-pCR, and drawing a scatter diagram, as shown in figure 1, finding that the expression of LINC00624 is high in a non-PCR group, and p is 0.011, so that the statistical significance is achieved, and the high expression of LINC00624 indicates poor treatment effect.

Example 2

319 breast cancer specimen cohorts are used for extracting tissue RNA, qPCR is carried out for reverse transcription to detect the expression level of LINC00624, the cohorts are followed up for survival analysis, and the result is shown in figure 2, and the result shows that the LINC00624 high expression is found in total typing, and the luminal and HER2 typing, which indicates poor prognosis.

Example 3

SK-BR-3(ATCC No. HTB-30), BT-474(ATCC No. HTB-20), and B16(ATCC No. CRL-6322), NF639(ATCC No. CRL-3090) cell lines were purchased from ATCC. Of these, BT-474, B16, and NF639 cell lines were cultured in RPMI 1640(Gibco, Grand Island, New York, USA) containing 10% fetal bovine serum (FBS, Gibco, South America). SK-BR-3 was cultured in McCOY's 5A (Dulbecco's Modified Eagle Medium) (Gibco, Grand Island, NY, USA) containing 10% FBS. All cells were treated with mycoplasma inhibitory reagent (Normicin) (Invivogen, USA) to avoid mycoplasma infection and verified by STR sequencing.

Total RNA was extracted from tissues or cells according to the protocol of TRIzol (Invitrogen, CA, USA) reagent. RNA concentration was measured using a Nanodrop (Thermofoisher, Rockford, USA). RNA was Reverse transcribed by using HiScript Reverse Transcriptase (HiScript Reverse Transcriptase Transcriptase) (Vazyme, Nanjing, China). Real-time qPCR assays were performed in Applied Biosystems7500 by using AceQ qPCR SYBR Green Master Mix (Vazyme, Nanjing, China). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as an internal control.

Transfection of ASO

Based on the suggested concentrations and indicated doses, RNAiMAX (Invitrogen, CA, USA) was diluted in Opti-MEM (Gibco, Grand Island, NY, USA), while cholesterol modified LINC00624 ASO (HippoBio, Huzhou, China), or corresponding controls, were diluted in Opti-MEM, after which incubation with diluted RNAiMAX was performed for 5 min at room temperature. Finally, the ASO-lipid complex was dropped uniformly into the cells previously prepared according to the experimental requirements.

Results as shown in fig. 3, we performed LINC00624 knockdown using ASO, designing a total of 5 ASOs to detect knockdown effects in breast cancer cell lines, the sequences of 5 ASOs 1-5 are as follows:

LINC00624 ASO1：GCCTATTTATTCACACCAAG(SEQ ID NO.1)；

LINC00624 ASO2：TGTTTCCTGCAGTATGCACC(SEQ ID NO.2)；

LINC00624 ASO3：GCAGAAGTAGGCCACATCTT(SEQ ID NO.3)；

LINC00624 ASO4：GAATACCTACCTTGGGCACA(SEQ ID NO.4)；

LINC00624 ASO 5: CAACTTGCCTGGTACGGAGG (SEQ ID NO. 5); as can be seen in the figure, the total LINC00624 is eliminated by more than 50%.

Example 4

For the mouse breast cancer model ASO treatment trial, 17BESTRADIO (0.72mg particles, SE-121, IRA) was subcutaneously implanted into 6-week-old nude mice one week prior to mouse inoculation. Take 2.5X 10⁶pCDH or LINC00624 overexpressing BT-474 cells, resuspended in D-PBS solution (Gibco), mixed with BME (Cultrex,3632-010-02) at a volume ratio of 1:1, and injected subcutaneously into the fourth mammary fat pad. After palpable neoplasia 10 days, 6 ASO injections were performed: each mouse was injected intravenously with 10nmol ASO2 and 3 mixtures (5 nmol each, ASO2 and ASO3 mix ratio 1:1) or ASO controls. And measuring the tumor body once every 2 to 3 days, and drawing a tumor body curve according to the volume. After 35 days, the nude mice were sacrificed and the tumor was dissected off for photographing.

The results are shown in FIG. 4, and the diameter of the tumor is obviously reduced after the treatment by using 10nmol of the mixture of ASO2 and 3, which shows that the antisense oligonucleotide of the invention is used together to produce obvious inhibition effect on breast cancer transplantable tumor.

The foregoing shows and describes the general principles, essential features, and advantages of the invention. It will be understood by those skilled in the art that the present invention is not limited to the embodiments described above, which are given by way of illustration of the principles of the present invention, and that various changes and modifications may be made without departing from the spirit and scope of the invention as defined by the appended claims.

Claims

1. An antisense oligonucleotide, characterized in that it is capable of specifically binding to LINC00624 to inhibit/degrade its expression.

2. An antisense oligonucleotide according to claim 1, wherein the antisense oligonucleotide is selected from the group consisting of any one of the following (1) to (3):

(1) as shown in SEQ ID NO: 1-5 in sequence;

(2) as shown in SEQ ID NO: 1-5, at least 2 of the sequences shown;

3. An antisense oligonucleotide according to claim 2, characterized in that it has at least one modification; the modification is selected from one or more of internucleoside linkage modification, methylation modification or cholesterol modification; preferably, the modification of the internucleoside linkage is a cholesterol modification.

4. A pharmaceutical composition for treating cancer, wherein the active ingredient of the pharmaceutical composition is the antisense oligonucleotide of any one of claims 1 to 3, and the cancer is selected from melanoma, sarcoma, lymphoma, brain cancer, breast cancer, liver cancer, stomach cancer, lung cancer, colon cancer; preferably breast cancer.

5. The pharmaceutical composition of claim 4, wherein the nucleotide is present in a liposome or linked to a pharmaceutically acceptable carrier.

6. Use of an antisense oligonucleotide according to any of claims 1 to 3 for the manufacture of a medicament having any of the following functions, wherein said use is selected from:

(a) preventing and/or treating cancer;

(b) inhibiting the growth of cancer cells;

(c) slowly and continuously killing cancer cells;

(d) immunotherapy of cancer;

7. Use according to claim 6, wherein the cells are selected from proliferative, neoplastic, pre-cancerous or metastatic cells.

8. Use according to claim 7, wherein the metastatic cells are selected from metastatic tumor cells.

9. A method of slow sustained killing of cells for non-disease diagnostic and therapeutic purposes, comprising contacting the cells with the antisense oligonucleotide of claims 1-3 or the pharmaceutical composition of claims 4-5.

10. The method of claim 9, wherein the cell is selected from the group consisting of a proliferative, neoplastic, pre-cancerous, or metastatic cell; the metastatic cells are selected from metastatic tumor cells.

11. The method of claim 9, wherein the pharmaceutical composition can be administered orally, intraperitoneally, intravenously, intraarterially, intramuscularly, intradermally, subcutaneously, transdermally, nasally, rectally, intratumorally, intralesionally, intrathecally, subarachnoidally, or systemically; optionally, the systemic administration comprises administration by intravascular administration; preferably, the intravascular administration is selected from injection, perfusion.

12. The method of claim 9, further comprising administering a second anti-cancer therapy that is a combination of one or more of chemotherapy, radiation therapy, immunotherapy, biologic therapy, targeted therapy, and surgical therapy.