CN114195872B - Application of FOT1 gene in rice flowering improvement breeding - Google Patents

Abstract

The invention discloses application of FOT1 gene in rice flowering improvement breeding, relates to a biological breeding technology, and is characterized in that target rice material is subjected to gene editing, so that base deletion, insertion or base substitution is carried out on CDS of FOT1 gene of 3365730-3373434bp region coding MYB transcription factors on a chromosome 8, and corresponding coding protein is mutated to obtain FOT1 mutant material; the FOT1 gene has a nucleotide sequence shown as Seq ID No.3, and the FOT1 gene CDS has a nucleotide sequence shown as Seq ID No.4, and the function of the FOT1 gene is verified by using CRISPR/Cas9 knockout and RNAi technologies, so that the FOT1 gene can be applied to selection and cultivation of early-flowering rice varieties.

Description

Application of FOT1 gene in rice flowering improvement breeding

Technical Field

The invention relates to the technical field of biology, in particular to application of FOT1 gene in rice flowering improvement breeding.

Background

Rice flowering Time (FOT) refers to the Time of glume Opening in the day after ear emergence of rice, and is usually expressed as the peak glume Opening Time (Hirabayashi et al, 2015). The key reproductive processes of rice anther cracking, pollen scattering, fertilization and the like are completed after glume flowers are opened. The flowering time is an important agronomic character and is closely related to the seed production yield of hybrid rice. The seed production yield of the hybrid rice is one of the key factors for large-area popularization. However, in the process of seed production, the asynchronous flowering caused by the difference of the flowering time habits of the sterile line and the restorer line seriously affects the outcrossing seed setting rate and the seed production yield of the sterile line. Research shows that the utilization and popularization of many excellent rice germplasm resources are limited due to the problem of no chance of flowering.

Although some manual regulation measures are already available to relieve the problem that the sterile line flowers later, such as spraying methyl jasmonate, dewing and the like (Zhouyu, 1995; great dawn spring and the like, 1999; zhangwang and the like, 2000; jianhai swallow and the like, 2008; zhouyou and the like, 2009; zhouyu and the like, 2016 Liu et al, 2017), all have certain limitations, require more financial and manpower consumption, and are far from meeting the requirements of hybrid rice seed production.

Previous studies have shown that rice flowers are a very complex quantitative trait and may be influenced by the control of different major genes and gene interactions in different genetic backgrounds. Researchers in our country have detected a number of related QTLs distributed on chromosomes 1, 5, 7, 8, 10 and 12 (went, 2013; bai dynasty, 2010; mazu et al, 2011). Researchers in japan have mapped multiple flowering-time-related QTLs from wild rice sources with early flowering characteristics (Sheehy et al, 2005. Thanh et al, using Oryza rufipogon, mapped to 3 QTLs, distributed on chromosomes 4, 5 and 10 (Thanh et al, 2010); hirabayashi et al mapped 3 QTLs using Oryza officinalis, distributed on chromosomes 3, 6 and 8, and further introduced qEMF3 from chromosome 3 into Nanjing 11, bringing the Nanjing 11 near isogenic line to bloom about 1.5 hours earlier (Hirabayashi et al, 2015). To date, no report has been made on the cloning of a regulatory gene in rice flowering, suggesting the difficulty in studying the molecular mechanism in rice flowering. For the identification and cloning of the complex quantitative trait genes, both the group construction and the phenotype identification are very difficult, and many years of backcrossing and group construction are often needed to achieve the purpose of purifying the genetic background, so that the time consumption is long and the efficiency is low.

The method is characterized by creating and exploring a rice material with early flowering characteristics, cloning related flowering genes, introducing early flowering genes into a sterile line widely applied in production through a molecular marker-assisted selection or CRISPR/Cas9 gene editing technology, and hopefully and rapidly solving the problem of non-meeting flowering time fundamentally.

Disclosure of Invention

Based on the needs in the field, the invention aims to explore the rice flowering regulating gene and the application of the gene in cultivating rice varieties changed in flowering, and particularly requests to protect the following technical scheme:

a method for improving the flowering time of rice materials is characterized in that target rice materials are subjected to gene editing, so that base deletion or insertion or base substitution is carried out on CDS of FOT1 genes which are positioned on a 8 th chromosome and encode MYB transcription factors in 3365730-3373434bp regions, and corresponding encoding proteins are mutated to obtain FOT1 mutant materials; the nucleotide sequence of the FOT1 gene is shown as Seq ID No.3, and the nucleotide sequence of the CDS of the FOT1 gene is shown as Seq ID No. 4.

The method is characterized in that the gene editing is to transfer a CRISPR/Cas9 gene editing vector capable of editing/knocking out the FOT1 gene into a target rice material.

The method is characterized in that the CRISPR/Cas9 gene editing vector is prepared into Oligo dimer by designing gRNA target sequences comprising PAM sequences as shown in Seq ID No.5 and Seq ID No. 6; the Oligo dimer is constructed into a CRISPR/Cas vector BGK 032.

Any one of the above methods, further comprising selfing, isolating and screening the improved early flowering homozygous mutant from the positive material successfully edited with the gene.

In another aspect of the invention, a CRISPR/Cas9 gene editing vector is provided, which is characterized in that Oligo dimer is prepared by designing gRNA target sequences including PAM sequence as shown in Seq ID No.5 and Seq ID No. 6; the Oligo dimer is constructed into a CRISPR/Cas vector BGK032, and the gene segments contained in the Oligo dimer are arranged from upstream to downstream in sequence as follows: U6-gRNA ^FOT1 -UBI-CAS9.

In another aspect of the present invention, an isolated FOT1 gene-specific fragment has a nucleotide sequence shown in Seq ID No. 9. Based on the above, an RNA interference vector is provided, which is characterized in that the vector is obtained by connecting a target fragment formed by connecting a FOT1 gene specific fragment shown by Seq ID No.9 as an interference fragment to an intermediate vector in a forward and reverse sequence by a double digestion method, and then connecting the target fragment to a backbone vector. The RNA interference vector, the intermediate vector is pUCCRNAi; the skeleton vector is pCAMBIA2300-actin1.

The invention further provides a method for inhibiting or down-regulating the FOT1 gene in target rice materials so as to change the rice flowering time, which is characterized by comprising the following steps:

(a) Transferring the CRISPR/Cas9 gene editing vector of claim 5 or the RNA interference vector of claim 8 or 9 into rice material to obtain a positive transformed cell;

(b) Culturing the positive transformed cell obtained in (a) and regenerating it into a rice plant.

The RNAi verifies the relationship between the FOT1 gene expression level and the rice flowering time, and most of materials with reduced FOT1 gene expression level caused by interference have early flowering phase strain, so that in the process of selecting breeding materials in early flowering phase, the candidate materials in early flowering phase can be selected by detecting and comparing the FOT1 gene expression level. Based on this, the present invention provides a method for screening early flowering rice material, comprising the steps of:

(1) Extracting RNA from the rice material to be detected, and performing reverse transcription to obtain cDNA;

(2) Detecting the expression level of FOT1 gene in the material to be detected; if the number of the candidate material is significantly lower than that of the control variety, the candidate material may be a candidate material earlier than that of the control variety; the nucleotide sequence of the FOT1 gene is shown as Seq ID No.3, and the nucleotide sequence of the CDS of the FOT1 gene is shown as Seq ID No. 4.

Preferably, the expression level of the FOT1 gene in the material to be detected is detected by adopting fluorescent quantitative PCR;

preferably, the nucleotide sequences of the upstream and downstream primers of the fluorescent quantitative PCR are shown as Seq ID No.10 and Seq ID No.11, respectively.

In previous studies, applicants obtained a pool of mutants by chemical mutagenesis treatment and screened for a rice early flowering mutant fot1. According to the invention, FOT1 is taken as a research material, a candidate gene FOT1 for coding MYB transcription factors is cloned by adopting a MutMap method, is positioned on chromosome 8 3365730-3373434bp, and the functions of the cloned gene are verified by using CRISPR/Cas9 knockout (japonica rice variety Nipponbare) and RNAi technology, so that the method can be applied to selection of candidate materials for breeding rice in early flowering and cultivation of rice varieties in early flowering.

Drawings

Figure 1. Comparison of flowering time of nipponica (WT) and fot1 mutants, wherein a. Fot1 is early flowering phenotype. B, counting fot1 blooming time;

FIG. 2.SNP index distribution on 12 chromosomes;

figure 3 fot1 gene structure, mutation site and CRISPR/Cas9 knock-out site, wherein a.crispr/Cas9 knockouts the target. The fot1 gene structure. A fot1 mutation site;

figure 4 flowering phenotype of fot1 knockout lines, where WT: wild type Nipponbare. MT: knocking out a strain by FOT 1;

FIG. 5 is a schematic diagram of a CRISPR/Cas9 gene editing vector structure;

FIG. 6 is a schematic diagram of an RNAi vector structure;

FIG. 7 shows the results of the gene expression level measurements of RNAi interference positive plants, WT shows Nipponbare, 1,2,3, three positive plants that appeared earlier when subjected to RNAi interference;

fig. 8. Floral time survey statistics for eagle 1B, knockout eagle 1B, and jakui 2115, where a.wt: wild type Yixiang 1B; MT: knocking out Yixiang 1B; B. a flowering survey statistical table;

Detailed Description

The present invention will be further described with reference to the following detailed description and the accompanying drawings, but the present invention is not limited to the following examples. In the following examples, unless otherwise specified, the experimental procedures used were those conventional in the art, using conventional commercially available reagents.

Example 1 discovery of FOT1 Gene

Sources of experimental materials:

in previous researches, the inventor obtains a mutant library through a Nipponbare treatment of a rice variety by Ethyl Methane Sulfonate (EMS) chemical mutagenesis, and selects a mutant named fot1 when the rice flowers early. The field survey results for many years show that the yield character of the FOT1 has no obvious change, and the application potential of the FOT1 in breeding improvement is suggested.

The mutant material "mutant fot1 at early flowering of rice" was kept in the applicant's laboratory, and the applicant agreed that experiments for validation could be provided to the public within twenty years from the application date.

fot1 flowering time survey statistics

The statistical results of the investigation in sichuan university in 8 months in 2017 show that the fot1 mutant starts to open from 10, while japan is just starting to open from 11.

Example 2 genetic analysis of fot1 mutant traits and MutMap cloning

2.1 Genetic analysis of fot1 mutation traits

F for (fot 1/NIP) hybridization ₁ 、F ₂ The statistical analysis of the flowering time of the generation plants shows that F ₁ The plants flower normally, corresponding to the wild type, F ₂ Late flowering plants in the generation group showed significant 3-1 segregation from early flowering plants, indicating that the early flowering mutant trait of FOT1 is controlled by 1 pair of recessive nuclear genes, which is designated as FOT1 (table 1).

TABLE 1.F ₂ (fot 1/NIP) population floral time segregation ratio statistics

Note that NIP is control Nipponbare; when df =1, χ ² _0.05(1) ＝3.84.

With F ₂ (fot 1/NIP) large population is used as MutMap cloning population, 20 typical early flowering mutant individuals are randomly selected from the MutMap cloning population, and equal amount of genomic DNA is mixed to form a mutant mixed pool and used for high-throughput sequencing, and the sequencing depth is more than 30 x. A SNP index scattergram on 12 chromosomes is constructed by utilizing a MutMap method.

According to the genetic linkage relationship, the SNP index in the vicinity of the mutant gene should be equal to or close to 1, and exhibit linkage distribution, i.e., the farther away from the mutant gene, the smaller the SNP index, and the closer to the mutant gene, the larger the SNP index.

According to the SNP index scattergram on the 12 chromosomes, only the SNP sites at the telomere end of the 8 th chromosome are continuously distributed and present obvious unimodal distribution, as shown in the figure 2. Therefore, it was preliminarily presumed that the mutant gene is located in the region of the chromosome 8 proximal to the short arm. And finally locking the target gene in the 2 th-4M interval of the rice chromosome 8 by referring to the high-throughput sequencing result.

According to the sequencing and analysis results, only one gene FOT1 encoding MYB transcription factors is mutated in the region.

2.2 verification of the correctness of the mutation site

Design and synthesis of a pair of primers spanning the mutation site:

seq ID No.1 upstream primer: CTAACTGACAAAGCGACCAA

Seq ID No.2 upstream primer: AATAAATCAGACGGCAAACA

By taking mutant FOT1 genome DNA as a template, a FOT1 gene fragment (Seq ID No. 3) is amplified by PCR and is compared and analyzed with a Nipponbare genome, and the result shows that as shown in figure 4, the 44 th base of CDS (Seq ID No. 4) of the gene is mutated from G to A, and the corresponding codon encoding amino acid is changed from arginine to lysine, namely, the code shift mutation occurs, so that the gene function is damaged, and the gene is possibly a mutant gene which leads to early flower change of FOT1.

Example 3 CRISPR/Cas9 knockout validation

CRISPR/Cas9 gene editing vector for constructing two different target sites of FOT1 gene

The vector construction method comprises the following steps:

1. designing gRNA target sequences GCATTGATTCATAGTTCCGCTGG (Seq ID No. 5) and TTCACCTTCTTATGCTGCCAGG (Seq ID No. 6) including PAM sequences, and preparing Oligo dimer:

the synthesized Oligo was dissolved in water to 10. Mu.M, mixed according to the following reaction system, heated at 95 ℃ for 3 minutes, and then slowly decreased to 20 ℃ at about 0.2 ℃/sec (preferably using a PCR apparatus).

2. Construction of Oligo dimers into CRISPR/Cas vectors

The components were mixed on ice according to the following reaction system, and reacted at room temperature (20 ℃ C.) for 1 hour after mixing.

3. The obtained CRISPR/Cas9 gene editing vector is shown in FIG. 5, and the expression cassette comprises U6-gRNA-UBI-CAS9 which are arranged in sequence.

4. The CRISPR/Cas9 gene editing vector is used for transforming a wild rice variety Nipponbare through agrobacterium:

coli with reference to standard procedures: adding 5 μ l of the reaction solution into at least 50 μ l of competent cells, mixing, and standing in ice bath for 30min (without shaking, keeping standing strictly); gently taken out, thermally shocked at 37 ℃ for 60 seconds, and immediately placed on ice for 2 minutes; adding 500. Mu.l of SOB/LB, and culturing at 37 ℃ and 200rpm for 1 hour; an appropriate amount of the bacterial solution was spread on LB plate containing kanamycin and inverted overnight culture was carried out at 37 ℃.

About 20 positive plants are successfully obtained from each vector.

These plants were further selfed, isolated and grown at T ₁ 9 homozygous mutant lines (Table 2) were obtained from the generations, and all flowering times were consistent with fot1, about 1 hour earlier than Nipponbare (FIG. 4).

TABLE 2 CRISPR/Cas9 knockout homozygous strain mutation sites

Example 4 RNAi validation

Constructing an RNAi vector of the FOT1 gene and transferring the RNAi vector into wild Nipponbare to obtain 24 positive plants, and detecting the expression quantity of the FOT1 gene, wherein the specific steps are as follows:

step 1.RNAi vector construction

Primers (Seq ID No.7 and Seq ID No. 8) were designed to amplify the 169bp fragment of FOT1 gene cDNA with strong specificity as the interference fragment (Seq ID No. 9).

Seq ID No.7 upstream primer:

XbaI cleavage site underlined

Seq ID No.8 downstream primer:

underlined is the SalI cleavage site

Seq ID No.9 interference segment

ATGGAGATTAATTCCTCTGGTGAGGAAGCGGTGGTAAAGGTGAGGAAGCCATACACAATCACAAAGCAGAGGGAGCGTTGGACTGAGGCAGAGCACAACAGGTTCCTTGAAGCCTTGAAACTGTATGGGAGAGCCTGGCAGCGCATAGAAGAGCATGTTGGGACAAAGA。

Connecting the interference fragment to an intermediate vector (pUCCRNAi) by a forward and reverse sequence through an XbaI/SalI double enzyme digestion method so as to form a hairpin structure, and finally connecting the target fragment (forward sequence + intermediate vector sequence + reverse sequence) to a vector pCAMBIA2300-actin1 to obtain an RNAi vector, wherein the structure of the RNAi vector is shown in figure 6; and carrying out double enzyme digestion detection and sequencing verification.

And 2, transforming the constructed RNAi interference vector into a wild rice variety Nipponbare through agrobacterium to obtain 24 positive plants.

Step 3. Detection of expression level

mRNA of wild plants and leaves of RNAi interference positive plants is extracted, and LHY expression quantity is detected by a fluorescent quantitative PCR method after reverse transcription, and the specific method is as follows:

3.1 extracting RNA by using Trizol reagent method:

(1) Preparation: placing the gun head and a 1.5mL EP tube into an autoclave for sterilization for 2h; storing trichloromethane, isopropanol, and 75% alcohol prepared with DEPC water at-20 deg.C; precooling at 4 ℃ by using a high-speed centrifuge; sterilizing the clean bench with ultraviolet for 30min, and wiping with 75% alcohol; the EP tubes were marked in advance.

(2) Sequentially grinding and crushing the rice sample which is well preserved in liquid nitrogen and well marked in a mortar by using liquid nitrogen, pouring the liquid nitrogen from time to time during the grinding to ensure that the mortar is low in temperature, scooping the ground rice sample into an EP (EP) tube by using a spoon, adding 1mL of Trizol reagent, and putting the mixture on ice;

(3) Adding 350mL of precooled trichloromethane into each EP tube, placing the tubes into a box, shaking the tubes for 3min by hand violently, and then placing the tubes on ice or a centrifuge for 5min; standing, and centrifuging in a 4 ℃ centrifuge at 12000r/min for 15min; carefully sucking out 500mL of supernatant in a new marked EP tube, adding precooled 500mL of isopropanol into each tube, turning over and uniformly mixing, and standing on ice or in a centrifuge for 10min; standing, centrifuging at 12000r/min in a 4 ℃ centrifuge for 10min, adding 1mL of 75% alcohol prepared by DEPC water into the supernatant after pouring the supernatant in a clean bench, suspending the precipitate with a liquid transfer gun, centrifuging for 1min in the centrifuge, taking out the supernatant, placing in an idle EP (ethylene propylene) tube of the centrifuge for 1mL, carefully sucking off excessive water, and standing on ice for 2min; adding 30mL DEPC water to dissolve RNA, and if the RNA is not used urgently, storing in a refrigerator at-80 ℃.

3.2 reverse transcription: reverse transcription of RNA was performed according to the protocol indicated in the kit (Vazyme):

(1) Removal of genomic DNA:

(2) Sucking and uniformly mixing the part 1 reaction solution by using a pipette gun, and putting the mixture into a PCR instrument for 2min at 42 ℃;

(3) Taking out the reaction solution, standing for 30sec, adding 2 mu l of 5 xselect qRT Super Mix II, and mixing uniformly again;

(4) Reverse transcription program at 50 deg.C for 15min;85 ℃ for 5sec;

(5) Finally, the cDNA is separated instantly by a high-speed centrifuge, and the total cDNA is stored in a refrigerator at the temperature of 20 ℃ below zero for later use.

3.3 real-time fluorescence quantification

qRT-PCR System

qRT-PCR procedure

Pre-denaturation:

95℃ 5min

and (3) cyclic reaction:

95℃ 10sec

60℃ 30sec

melting curve:

95℃ 15sec

60℃ 1min

95℃ 15sec

the fluorescent quantitative PCR result shows that the FOT1 gene expression of 12 of 24 positive plants is obviously reduced, the flowering time of the 12 positive plants is consistent with that of the material FOT1, namely, about 1 hour earlier than Nipponbare, and the FOT1 gene expression difference of 3 positive plants with flowering time earlier and a wild type Nipponbare is shown in figure 7.

Example 5 knockout of FOT1 on indica variety to obtain early flowering variety

Adopting the same CRISPR/Cas9 gene editing vector obtained in real-time example 3, knocking out FOT1 gene from Yixiang 1B of late indica rice maintainer line material during flowering to obtain a transgenic positive plant;

these plants were further selfed, isolated and grown at T ₁ The generation successfully obtains a homozygous knockout strain of the Yixiang 1B (knockout of the Yixiang 1B), and the strain can stably advance 1 hour or so compared with wild type Yixiang 1B under different temperature conditions (except rainy days) when flowers bloom.

The main cultivated variety of the rice is fragrant 2115, the area of the continuous planting in the upper reaches of the Yangtze river is ranked first for many years, and the first prize of scientific and technical progress of 2019 Sichuan province is honored. However, years of follow-up investigation shows that the combination has slow flowering time due to the fact that the maintainer line prefers fragrant 1B and the sterile line prefers fragrant 1A, the seed production yield is low, and the seed cost is high.

The invention investigates the flowering time of Yixiang 1B, knockout Yixiang 1B and the variety Yahui 2115 of the main cultivation recovery line.

Statistical results show that the flower time of the wild type Yixiang 1B is later than that of Yahui 2115, the flower time of knocking out the Yixiang 1B is earlier than that of the restorer Yahui 2115, and the flower time is about 1 hour earlier than that of the wild type Yixiang 1B (figure 8), and further prove the application potential of FOT1 in the improvement of rice flower time.

In conclusion, the invention fully proves the influence of the FOT1 gene on early flowering phenotype through CRISPR/Cas9 knockout, RNAi and other experiments, and proves that the early flowering phenotype of the FOT1 is caused by the frame shift mutation of the coding protein caused by the mutation of the FOT1. Therefore, the FOT1 gene of the target material is edited, so that the CDS region of the target material is subjected to base deletion, insertion or substitution to cause coding mutation, and the rice breeding material with changed flowering time can be obtained and applied to rice breeding.

SEQUENCE LISTING

<110> Sichuan university of agriculture

Application of <120> FOT1 gene in improvement of rice flowering

<130> P210111-SAU

<160> 9

<170> PatentIn version 3.5

<210> 1

<211> 20

<212> DNA

<213> FOT1 Gene fragment upstream primer

<400> 1

ctaactgaca aagcgaccaa 20

<210> 2

<211> 20

<212> DNA

<213> FOT1 Gene fragment downstream primer

<400> 2

aataaatcag acggcaaaca 20

<210> 3

<211> 7705

<212> DNA

<213> FOT1 Gene

<400> 3

ttgtgtattt tgttgttctg gcaggatcaa ggaagtgttt ggccttcgta ggtgagcctg 60

attactgttt gcattgctgc ttcatatatt tttcatactt ctaattggtt ttatgtttct 120

aattaattct tcttttttta atggttgcat aatttgagaa ctgcgagttt taatctgatt 180

ctagagttga agataacgaa aggagcaagg gtgaactctg ctgacttggt ttttgtgtgc 240

acagaccaac tgcagctgag gatttagtag gtgagtggag tggtgctgta ctgcgctgtc 300

cctggatttt tgtctcgagt aattgttgta gttgtggaac cctttagttt tatcaaatta 360

agtgatgcct tcttttgggg aaataaatgt ttttttcttg gtggagttca gtttgaccat 420

ttggagatgc ttatgaattt aaaatgatgt ggccccttat tgcatttttt ttttcagatt 480

gactgcaatt ggatcaattc aagtaggtga gtggaattga tcctcttgaa gattttgacc 540

caagtccaat tcacaagtag aattgtgaat tctttaggtt ctaccttggg tttgtaacac 600

taatttggct gctcttttgt ggttggccgc acaaatttga aatactggga gtgttggcgt 660

gatatagagg tctaggagga ggtatgaggt actacttgcg tcaggtccag cgtttggttg 720

gagatatgga aggaggagtg cttttgtttg tggaagacct caactctaac tgacaaagcg 780

accaattgcc aacacttctg ttatatttct tctttttctt gaattgggaa tggagattaa 840

ttcctctggt gaggaagcgg tggtaaaggt gagttgttct ttgatgtgca tgttgattcg 900

tgttaaaagg gagcagcatt ttattagggg ttatttgtag gtgaggaagc catacacaat 960

cacaaagcag agggagcgtt ggactgaggc agagcacaac aggttccttg aagccttgaa 1020

actgtatggg agagcctggc agcgcataga aggtgaattc tccacatata tatgtcatat 1080

cacaaatagt tctatgctat tactttctga atttactttt tgtactcact gtgattatta 1140

gctggttaat aaatacggct ttaattgagt tattgatatg gatcttgcat cttttttttt 1200

tcgttttctt gtttgccgtc tgatttattc tatagagcat gttgggacaa agacagctgt 1260

gcagatcaga agtcatgctc aaaagttctt caccaaggtt cttcctctat cttattggcc 1320

agtgctcctt tttttggttt agcgctatct ccttagcttt ctggtttcct tgtctttacc 1380

tttgggataa aaacggctgg cttttgtgct tactttctta ttattttttc ttactttctg 1440

cagtattatt tctttctttc cttcttttat tttacatatg agtacagcaa ttatgtacat 1500

agagtctgaa ctgtgtgtga tcagttcctt tcgattatta tgagaaatac acttatggct 1560

tttgtgctct gttagttgga tgaaacgtta actaaacagt gctgagatgg aaaagaagca 1620

ctaggaagtg tttgtctcgt agtaaaaaaa aaataatgtt gcaaaattga tgctattaaa 1680

cattctgttt gcatgttcct ttatttacat atccatccta tcactgagat tttgagcatg 1740

cacagatgca cttatgacaa aaaaaaaagc attttggtac tgttatattt acatactaag 1800

tcaagtcaaa ttgtatatct ggactatcat caagattagt aataaagatt tagttaaaca 1860

tgttccagtg cctacgtggt gttcataact aataaggatt cttaaaaaaa aaaagaacta 1920

gggcagccat ttgagacaat ttattaaaat aagaaaaatg taaaatgatt tgcaagttga 1980

ccaaggtatc accttccatt agaaatagcc actcaatcgc gcatttgcgc gactttgact 2040

gacagcatat aatatgtagg agtagttata acagtcacga gtggattaag tttcttttat 2100

ttatacatta ggcttatttt ttaatgaaat tctaatttac gcggtagaat tgtatcttta 2160

tttttgaaaa gggttgtcta ttattaatga tttttttaat caaggtgtaa tattggaatt 2220

cacagttatt tgttcggcaa acattgtaat aattgtctgt agattcacta aagtaaaggt 2280

cggaataatt tttgccatgc tggctttttc tttagaaaaa aaaagaagaa aactgttgtc 2340

cggtttcctc caattttttt tctacgtggg ctgcctgcag gttctggagg tttctctttg 2400

gaactctcct tgtttgatta gggctaatcc aacggttgtt gttgcttatt tctttgcatt 2460

ggacggtcct acatttcttt cttatgtggc tcaaccagat tgtgtgaaag tagttctttc 2520

actactttat attgtgtgaa aggtcggaaa acatcaaaaa taatactgta cacctattgt 2580

ttatcagtca aaacagaagg acctagtcca ttcccttctt ttaaaaaatt tactcccaat 2640

ctaagtcttg ttttttttcc tgttgcgcaa tctacccaaa ctgtgccttt taggggcttt 2700

acactgccac ctgatggagg tcacgttgcc atcactgtgc aacagccact ggactgttgc 2760

attgttgatt gcatcatcat cctctcaaag gtctcattgc aagatctatg aatggggagg 2820

aacacaaggt tagtaattta agaaacatga tggctttctg gtttctcaac tctatatcca 2880

gccaacatcc atgagcatct gaccgtccat tgttgtggtg ggttggattt ttggttgttg 2940

attaaagagg tgaataggtc tgccctaatc tccataaaat atgtaataca gctaataggt 3000

tttcgtcgct gcaagtactt gccagtaact gttctccatg tctaggctca taaaaaatat 3060

agagtgacaa gtaacaacgt ttaacctgac caatacttat actgcttaaa caccttctgt 3120

tttctaacaa gtatgcagta aatgtaatca gtgctacaat aacttcttga acattaacca 3180

tgcctagaac ttgggaccat acgctcataa cattggtttg agaagggtag tggactggga 3240

ggatatactc tagtcacgta tttcctagta atcccttggt tttgccaaaa aaaaggcaac 3300

caaggcaaat taccactgtt cattgaaccc tgatagtcaa tagttcgaaa agtggtaact 3360

aataactgtg aaatgtccat tgtggttgat gtcaattaaa ttagtcttta ctttgataag 3420

atgtccaaga gctttttgga gccccgaagg gttatgagtg atggccattc caggcttcag 3480

atgcacagtc gcttttcttt tgcaaagaca tgcaacaatg tttggttcta catcagcact 3540

ataccagtaa ttgcagtagt atagttttgg cttgtcgtta ctggtttctg ggctgaagtc 3600

caacatgact aggctccatt tgtggtctta tctagtgact aggctccatt tggttcttgt 3660

cataattatc cacagagatc tggttcattg atcacttttt ctactgtatc agcgaaaagt 3720

ttgatgatat taccgcctat acaaatgtta tagcatgctg ctaatcatac ccaccaatgc 3780

atactctccc ctgtttggtc aatgatgatt gatgccatgg ttgatgttca aactaaacct 3840

cggcaggtca ttctgagatc agaaggataa tataggcata aaactaaatc tatgacaacc 3900

tgtaatgtgg aaatggcctt tttcttttat gcaggtgaaa aaaaataaat gcgtactaaa 3960

ttaataataa cccaagggga gagacatccc aaaggcattg catataaggt tgagcaaagg 4020

ccccaaagcc agctcataac cgtatgggta ctttagggga acatatagcg aggggtcttt 4080

ttttttgtga gaactaggaa gcctcatgac tggaggactt accagttacc accgtgctac 4140

aagcacgttc tctctactaa atttataata gcaaagtact tggcttcaat gtgacttttt 4200

aggtccagga aaaatgcttt caaatttctt atcaacttat catcacaata gctagacgat 4260

gattttgatc aataaaagag caggggaatg tctagttgac tgaaagtaga agaggaacaa 4320

ttttctttct gcaaatttgg cttcaaaata atctgttgaa atattcatca ttacatgttt 4380

tcttttggac aaaggaagtg taacttccag cctctgcacc aactaaggat gcaaacaacc 4440

atatttgtgg ataccaggat ttgaaccctg gtggctggag tcattacatg ttttctatat 4500

tccaacttcc atgtcaaacc atgttcctga agtataatgc tcattaatta tctaatatgg 4560

cagcaaggca gacataatcc ggtaagtaaa gggtagggct gaccgccctc tggtcaagca 4620

ggctctccct gcatagcagg aggctctgct cggtgaaata caaaatcctt ctctgatatt 4680

attgcttatt tttccttaat acacatacta gtccaccttt atagcacaag tgctgagata 4740

tgtacttgga agtactaaat aaactaggaa gctctagcta gaaagtaccg gttcccgaac 4800

cgatggcttc atgaaacttt ttgccaaagg tttttagtaa ccttctacat gacactccct 4860

ctactccaca atatttgtcc aagactacca tctgcataga ccaaggaggt gcaagatata 4920

agaaatagtt aatgataatg gactatatat accatctgca taacttttat acctctttta 4980

agcattatat aaagtttagt agagagttgg gacatcgcaa taagtccaaa ctcctaattt 5040

tctcgacaaa cagacattgt caaaggggac agccccgaga aaatgaacaa atcttgtgga 5100

gcagacggag tagcattatg taaaatatca atatcatgta gtatggcact ttcatatatg 5160

tcaaaattac tgttagatat gcctgatttg ttttctgttt ctttatgtaa tttaactgta 5220

tctaactaat tgaaatatta cagttggaaa aggaagctat caacaatggc acttctccag 5280

gacaagctca tgacatcgac atacctccac cacgaccaaa aagaaaacct aacagtccat 5340

atcctcgaaa aagttgtctc agctctgaga catccaccag ggaagttcaa aatgataagg 5400

caacaatatc aaatatgacg aacaatagca ctgcacaaat ggcaggtgat gcagctcttg 5460

aggtacatac ctttgtagta tttcgtttta gttaggtttc tatttttgat ttatcctttt 5520

ctttaatgtg ctatcctgtt tctttaacaa gaaactcact tacattcaga aacttcaaag 5580

aaaggagata tctgaaaaag gaagttgctc cgaagttctt aatctctttc gagaagtccc 5640

atcggcatca ttttcttcag ttaacaaaag ctcttcaaat catggtgcat ccagggggct 5700

ggaaccgact aaaacagaag tcaaagatgt ggtcatcttg gaaagggatt ctatttccaa 5760

tggtgcaggg aaggatgcaa aagatatcaa tgatcaagaa atggaaaggc tcaatgggat 5820

acacatcagc tcgaagcctg atcattctca tgaaaactgt ttggatacct caagccaaca 5880

atttaagcca aaatcaaact ctgtggagac aacatatgtg gattggtctg ctgcaaaagc 5940

ttcacactac caaatggaca gaaatggggt tactggcttt caagccactg gaactgaagg 6000

aagccatcct gatcaaacaa gtgatcaaat gggaggagcc agcggaacta tgaatcaatg 6060

catccatcca acacttcctg tggatccaaa attcgacggc aatgccgcag cacagccctt 6120

tcctcacaac tatgcagcct ttgcaccaat gatgcaatgc cactgcaacc aagatgccta 6180

cagatctttt gccaatatgt catccacctt ctccagcatg cttgtctcca cattgttgtc 6240

aaaccctgca atccatgcag ctgccaggct tgcagcatcg tactggccta cagtagacgg 6300

caatactcct gatccaaatc aagaaaatct ttctgagagt gctcaaggaa gccacgctgg 6360

ctctcctccc aacatggcat ctattgtcac agctacagtt gctgcagcat cagcatggtg 6420

ggcaacacaa ggtcttctcc ctctttttcc tccacctata gcttttccat ttgttccagc 6480

tcctagtgct cccttttcca cagcagatgt tcagcgagct caagagaaag atatagactg 6540

cccaatggat aatgcacaga aggaattgca agaaactcgg aaacaagata attttgaagc 6600

tatgaaggtc atagtgtctt cagagactga tgagagtgga aaaggagaag tgtcgctcca 6660

cactgagtta aagatatctc cagcagataa ggccgacacc aaacctgccg caggagctga 6720

aacaagtgac gtttttggaa ataagaaaaa gcaggatcgc tcttcatgtg gttccaacac 6780

accgtcaagt agtgatatag aagcagataa tgctcctgag aatcaagaaa aggctaacga 6840

caaggcaaag caagcatctt gcagtaactc ttcagccggt gacaataacc accgtagatt 6900

taggagcagt gcaagcacaa gtgattcatg gaaggaagtt tctgaagagg tggtcgtcta 6960

ccagcattcc gcatattcac atttatctta ctcgctgaac atccatcact gcttttctaa 7020

ttcacatttc tgctgtcagg gtcgtctggc ttttgatgca ctgttcagta gagaaaggct 7080

tccccaaagc ttttctcctc cgcaagtaga aggatcaaag gagattagca aggaggaaga 7140

agatgaagta accacggtga cggttgacct caacaagaat gccgctatta ttgatcaaga 7200

actcgacaca gcggatgagc caagagcttc ctttcctaat gaattgtcaa acctgaagct 7260

gaaatctcgc aggaccggtt tcaaaccata caagaggtgc tcagtggaag cgaaggagaa 7320

cagggtaccg gctagcgatg aggttggtac caagaggatt cgtcttgaga gcgaagcatc 7380

gacatgattt gctttccacc tggttgctgg cctctaccaa gtcagaagtt aaatttacat 7440

ccgagctacc ataggacttc agaccttcca atgcattacc tcacaaactc aatttattgt 7500

gtgttgtatc ttaatgcttg ccaagcagct cctatagact gcttttaaac cgtatctcat 7560

agacttttga ttagcattta agcgactgct aaactttctt cataaaaggg tattatcctt 7620

attatgcatt atagtctggg gaaggtaata agtggaattt tggttcattt ttctgggtca 7680

tattttacca actgcatttt tatcc 7705

<210> 4

<211> 2160

<212> DNA

<213> CDS of FOT1 Gene

<400> 4

atggagatta attcctctgg tgaggaagcg gtggtaaagg tgaggaagcc atacacaatc 60

acaaagcaga gggagcgttg gactgaggca gagcacaaca ggttccttga agccttgaaa 120

ctgtatggga gagcctggca gcgcatagaa gagcatgttg ggacaaagac agctgtgcag 180

atcagaagtc atgctcaaaa gttcttcacc aagttggaaa aggaagctat caacaatggc 240

acttctccag gacaagctca tgacatcgac atacctccac cacgaccaaa aagaaaacct 300

aacagtccat atcctcgaaa aagttgtctc agctctgaga catccaccag ggaagttcaa 360

aatgataagg caacaatatc aaatatgacg aacaatagca ctgcacaaat ggcaggtgat 420

gcagctcttg agaaacttca aagaaaggag atatctgaaa aaggaagttg ctccgaagtt 480

cttaatctct ttcgagaagt cccatcggca tcattttctt cagttaacaa aagctcttca 540

aatcatggtg catccagggg gctggaaccg actaaaacag aagtcaaaga tgtggtcatc 600

ttggaaaggg attctatttc caatggtgca gggaaggatg caaaagatat caatgatcaa 660

gaaatggaaa ggctcaatgg gatacacatc agctcgaagc ctgatcattc tcatgaaaac 720

tgtttggata cctcaagcca acaatttaag ccaaaatcaa actctgtgga gacaacatat 780

gtggattggt ctgctgcaaa agcttcacac taccaaatgg acagaaatgg ggttactggc 840

tttcaagcca ctggaactga aggaagccat cctgatcaaa caagtgatca aatgggagga 900

gccagcggaa ctatgaatca atgcatccat ccaacacttc ctgtggatcc aaaattcgac 960

ggcaatgccg cagcacagcc ctttcctcac aactatgcag cctttgcacc aatgatgcaa 1020

tgccactgca accaagatgc ctacagatct tttgccaata tgtcatccac cttctccagc 1080

atgcttgtct ccacattgtt gtcaaaccct gcaatccatg cagctgccag gcttgcagca 1140

tcgtactggc ctacagtaga cggcaatact cctgatccaa atcaagaaaa tctttctgag 1200

agtgctcaag gaagccacgc tggctctcct cccaacatgg catctattgt cacagctaca 1260

gttgctgcag catcagcatg gtgggcaaca caaggtcttc tccctctttt tcctccacct 1320

atagcttttc catttgttcc agctcctagt gctccctttt ccacagcaga tgttcagcga 1380

gctcaagaga aagatataga ctgcccaatg gataatgcac agaaggaatt gcaagaaact 1440

cggaaacaag ataattttga agctatgaag gtcatagtgt cttcagagac tgatgagagt 1500

ggaaaaggag aagtgtcgct ccacactgag ttaaagatat ctccagcaga taaggccgac 1560

accaaacctg ccgcaggagc tgaaacaagt gacgtttttg gaaataagaa aaagcaggat 1620

cgctcttcat gtggttccaa cacaccgtca agtagtgata tagaagcaga taatgctcct 1680

gagaatcaag aaaaggctaa cgacaaggca aagcaagcat cttgcagtaa ctcttcagcc 1740

ggtgacaata accaccgtag atttaggagc agtgcaagca caagtgattc atggaaggaa 1800

gtttctgaag agggtcgtct ggcttttgat gcactgttca gtagagaaag gcttccccaa 1860

agcttttctc ctccgcaagt agaaggatca aaggagatta gcaaggagga agaagatgaa 1920

gtaaccacgg tgacggttga cctcaacaag aatgccgcta ttattgatca agaactcgac 1980

acagcggatg agccaagagc ttcctttcct aatgaattgt caaacctgaa gctgaaatct 2040

cgcaggaccg gtttcaaacc atacaagagg tgctcagtgg aagcgaagga gaacagggta 2100

ccggctagcg atgaggttgg taccaagagg attcgtcttg agagcgaagc atcgacatga 2160

<210> 5

<211> 23

<212> DNA

<213> gRNA target sequence 1

<400> 5

gcattgattc atagttccgc tgg 23

<210> 6

<211> 23

<212> DNA

<213> gRNA target sequence 2

<400> 6

ttcaccttct atgcgctgcc agg 23

<210> 7

<211> 31

<212> DNA

<213> RNAi interference fragment upstream primer

<400> 7

cgttctagaa tggagattaa ttcctctggt g 31

<210> 8

<211> 27

<212> DNA

<213> RNAi interference fragment downstream primer

<400> 8

cgtgtcgact ctttgtccca acatgct 27

<210> 9

<211> 169

<212> DNA

<213> RNAi interference fragment

<400> 9

atggagatta attcctctgg tgaggaagcg gtggtaaagg tgaggaagcc atacacaatc 60

acaaagcaga gggagcgttg gactgaggca gagcacaaca ggttccttga agccttgaaa 120

ctgtatggga gagcctggca gcgcatagaa gagcatgttg ggacaaaga 169

<210> 10

<211> 21

<212> DNA

<213> real-time fluorescent quantitative upstream primer

<400> 10

cagataaggc cgacaccaaa c 21

<210> 11

<211> 21

<212> DNA

<213> real-time fluorescence quantitative downstream primer

<400> 11

ggtgtgttgg aaccacatg 19

Claims (7)

1.FOT1The application of the gene in the improvement of rice flowering is characterized in that the gene editing is carried out on target rice materials, so that a region of 3365730-3373434bp positioned on the 8 th chromosome encodes MYB transcription factorsFOT1Base deletion, insertion or base substitution occurs in CDS of the gene, so that mutation occurs in corresponding encoded protein, and FOT1 mutant material is obtained;

the describedFOT1The nucleotide sequence of the gene is shown as Seq ID No.3FOT1The nucleotide sequence of CDS of the gene is shown in Seq ID No. 4;

the rice flowering time refers to the time of a peak of glume opening in one day after the rice heading.

2. The use according to claim 1, wherein said gene editing is targeted to the transformation of target rice material into an editable/knock-out of said target rice materialFOT1CRISPR/Cas9 gene editing vector of gene.

3. The use of claim 2, wherein the CRISPR/Cas9 gene editingThe vector is obtained by preparing designed gRNA target sequences comprising PAM sequences as shown in Seq ID No.5 and Seq ID No.6 into Oligo dimer, and constructing the Oligo dimer into a CRISPR/Cas vector BGK032, wherein the Oligo dimer comprises gene segments which are arranged from upstream to downstream in sequence: U6-gRNA ^FOT1 -UBI-CAS9。

4. The use of any one of claims 1-3, further comprising selfing the positive material successfully edited for gene, and isolating to screen for improved homozygous mutants at early flowering.

5. A method for screening early flowering rice material, comprising the steps of:

(1) Extracting RNA from the rice material to be detected, and performing reverse transcription to obtain cDNA;

(2) Detecting in materials to be testedFOT1The level of expression of the gene; if significantly lower than the control variety, the material to be tested may be a candidate material that blooms earlier than the control variety; the above-mentionedFOT1The nucleotide sequence of the gene is shown as Seq ID No.3FOT1The nucleotide sequence of CDS of the gene is shown in Seq ID No. 4.

6. The method of claim 5, wherein the expression level of FOT1 gene in the material to be tested is detected by fluorescence quantitative PCR.

7. The method of claim 6, wherein the nucleotide sequences of the upstream and downstream primers of the fluorescent quantitative PCR are shown as Seq ID No.10 and Seq ID No.11, respectively.

Images