CN114164282A - Primer for identifying genetic sex of double-wishbone and PCR (polymerase chain reaction) identification method - Google Patents
Primer for identifying genetic sex of double-wishbone and PCR (polymerase chain reaction) identification method Download PDFInfo
- Publication number
- CN114164282A CN114164282A CN202111431703.6A CN202111431703A CN114164282A CN 114164282 A CN114164282 A CN 114164282A CN 202111431703 A CN202111431703 A CN 202111431703A CN 114164282 A CN114164282 A CN 114164282A
- Authority
- CN
- China
- Prior art keywords
- pcr
- primer
- double
- sex
- genetic sex
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6879—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for sex determination
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/124—Animal traits, i.e. production traits, including athletic performance or the like
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to the technical field of biological detection, and discloses a primer for identifying the genetic sex of a double-wishbone and a PCR (polymerase chain reaction) identification method. The primer sequence is F: GATGATCACTGCAATGTTTC and R: GTGGCCAAACGCAGCATTGA are provided. The identification method comprises the steps of carrying out PCR amplification reaction and agarose gel electrophoresis detection by using the primers, wherein the result shows that the primer has 1187bp and 676bp bands which are female, and the primer only has 676bp bands which are male. The primers of the invention are used for PCR amplification reaction and agarose gel electrophoresis detection, and the sex of the double-wishbone is determined by using the difference of target bands of the electrophoresis detection result, so that the operation is simple and convenient, and the identification result is quick and accurate. Realizes the non-damage accurate identification of the sex of the double-beard bone-tongue fish.
Description
Technical Field
The invention belongs to the technical field of biological detection, and particularly relates to a primer for identifying the genetic sex of a double-wishbone and a PCR (polymerase chain reaction) identification method.
Background
The two-beard bone-tongue fish is commonly called silver dragon fish. The male and female bicolor cannot be distinguished in external morphology, and even in the reproductive season, it is difficult to accurately distinguish the sex. At present, an accurate sex identification method under the premise of not damaging fish still does not exist, so that the breeding efficiency is not high, and the industrial development is influenced.
Based on sex-specific molecular markers, genetic sex can be achieved simply and quickly. Patent CN105368948A discloses a primer for Nile tilapia sex PCR identification and a PCR identification method, wherein the primer can perform specific amplification on the AMH gene of Nile tilapia, and a male individual generates 2 specific amplification fragments with the lengths respectively: 179bp and 412bp, female individuals generate 1 specific amplified fragment with the length of 412 bp. Can be distinguished obviously, so that the sex of the nile tilapia can be identified simply and accurately. Patent CN 112029843A discloses a specific molecular marker for identifying the genetic sex of scatophagus argus, and primers and application thereof. The molecular marker is two DNA fragments which are partially homologous on the X chromosome and the Y chromosome of the scatophagus argus, the invention screens the two DNA fragments which are partially homologous on the X chromosome and the Y chromosome of the scatophagus argus from genome information of the scatophagus argus, and a specific primer is designed to identify the genetic sex of the scatophagus argus, so that the genetic sex of the scatophagus argus can be rapidly and accurately distinguished. The patent CN 112725427A discloses a primer, a fluorescent probe and a kit for identifying the sex of sturgeon based on a fluorescent PCR technology, wherein the primer and the fluorescent probe comprise a primer WF, a primer WR and a fluorescent probe W which are designed based on a specific DNA sequence of a chromosome W of the sturgeon, and a primer ZF, a primer ZR and a fluorescent probe Z which are designed based on a specific DNA sequence of a chromosome Z of the sturgeon, the kit comprises a fluorescent PCR reaction solution, TaqDNA polymerase, negative control and positive control, and the fluorescent PCR reaction solution comprises the primer and the fluorescent probe; carrying out fluorescence PCR amplification on the sturgeon genome sample, and then carrying out Ct value analysis; if the fluorescence PCR results of the two groups of primers are positive, the sample to be detected is female; and if the fluorescence PCR result of the W chromosome specific DNA sequence primer is negative and the fluorescence PCR result of the Z chromosome specific DNA sequence primer is positive, the sample to be detected is male.
The prior art mentioned above is based on sex-specific molecular markers of different fish species to achieve sex identification. However, no methods for sex determination of specific markers for the Onchiostoma bicolor have been disclosed. The prior art can not obtain sex-specific DNA fragments of the double-wishbone and can not design corresponding primers according to the specific fragments.
Disclosure of Invention
Aiming at the difficulty of non-injury identification of the double-whisker bony-tongue fish, the invention mainly aims to provide a primer for identifying the genetic sex of the double-whisker bony-tongue fish.
The invention also aims to provide a PCR identification method for the genetic sex of the double-wishbone.
The primer is used for PCR amplification and agarose gel electrophoresis detection, and the sex of the double-wishbone (silver dragon fish) is determined by using the difference of target bands of the electrophoresis result, so that the method has the advantages of simple and convenient operation, quick and accurate identification result, convenience for popularization and use and wide application prospect.
The purpose of the invention is realized by the following technical scheme:
a primer for identifying the genetic sex of the double-wishbone is disclosed, and the sequence of the primer is as follows:
F：GATGATCACTGCAATGTTTC(SEQ ID NO：1)；
R：GTGGCCAAACGCAGCATTGA(SEQ ID NO：2)。
a PCR identification method for genetic sex of the double-wishbone comprises the following steps:
the primers are used for PCR amplification reaction and agarose gel electrophoresis detection, and the result shows that the female is the female with 1187bp and 676bp bands, and the male is the male with 676bp band only.
Further, the PCR amplification reaction conditions are as follows:
the total volume of the PCR reaction was 25. mu.L, including: 10 × Buffer 2.5 μ L, Mg2+1 uL of dNTPs, 1 uL of upstream and downstream primers, 1 uL of template DNA, 1U of TaqDNA polymerase, and ddH2And appropriate amount of O.
Further, said Mg2+The concentration is 25mmol/L, the concentration of dNTPs is 2mmol/L, the concentration of the upstream primer and the downstream primer is 10 mu mol/L, and the concentration of the template DNA is 50 ng/mu L.
Further, the PCR amplification reaction program is as follows: pre-denaturation at 94 ℃ for 3 min; denaturation at 94 ℃ for 30s, annealing at 50 ℃ for 30s, and extension at 72 ℃ for 30s for 30 cycles; finally, extension is carried out for 10min at 72 ℃.
Further, the nucleotide sequence of 1187bp band of the PCR amplification reaction is SEQ ID NO: 3.
further, the nucleotide sequence of the 676bp band of the PCR amplification reaction is SEQ ID NO: 4.
further, the agarose gel electrophoresis detection adopts 1.0% agarose gel for electrophoresis separation, the voltage is set to be 120V, the time is 20min, and then the gel imager is used for observation and photographing.
The principle of the invention is as follows: through the third-generation sequencing of female and male double-wishbone genomes, combined with the 5-female and 5-male genome re-sequencing fine alignment and the sequencing result of a 109-individual (51-female and 58-male) mixed sample, a sex-specific molecular marker is obtained through screening, the sex chromosome of the double-wishbone is determined, and a female specific genome DNA sequence is obtained on the sex chromosome. Primers are designed by crossing specific DNA sequences, a female fish sample has 1187bp and 676bp bands after PCR amplification, and a male fish has only 676bp bands.
Compared with the prior art, the invention has the beneficial effects that:
(1) the primers of the invention are used for PCR amplification reaction and agarose gel electrophoresis detection, and the sex of the double-wishbone is determined by using the difference of target bands of the electrophoresis detection result, so that the operation is simple and convenient, and the identification result is quick and accurate. The accurate identification of the sex of the double-beard bone-tongue fish is realized.
(2) Through genome high-throughput sequencing and comparing genome difference sequences between male and female silver dragon fish individuals, a female specific DNA fragment (the specific nucleotide sequence is SEQ ID NO: 5) with the size of 510bp is obtained. And amplifying primers designed according to the specific fragment column to obtain a product containing a difference sequence, so as to identify the sex of the sample to be detected according to the amplification difference of the specific fragments. The sex identification can be completed through PCR amplification, methods such as sequencing and the like are not needed, the operation is simple and convenient, and the time and the cost are saved. Compared with other molecular identification methods with tedious operation and long time consumption, the method is more suitable for quickly identifying mass samples. More importantly, the PCR primer can simply, accurately and quickly identify the sex of the double-wishbone, does not need to dissect the double-wishbone, basically does not influence the health condition of a detected sample, is convenient to realize the application in the breeding technology, realizes the sex pairing of the double-wishbone, greatly improves the breeding efficiency, the breeding success rate and the number of offspring, solves the major industrial problem of breeding of the double-wishbone, and has important economic value and social value.
Drawings
FIG. 1 is a diagram showing the result of agarose gel electrophoresis detection for sex determination of Onchiostoma bicolor in the embodiment of the present invention.
Detailed Description
The present invention will be described in further detail with reference to examples, but the embodiments of the present invention are not limited thereto.
Example 1
(1) Screening sex-specific molecular markers of the double-wishbone:
and (3) selecting 5 female dragon fish samples and 5 male fish samples to extract DNA by adopting a high-throughput sequencing strategy, and constructing a double-end genome DNA library with an insert fragment of 500bp according to the requirements of an Illumina library construction process. And then carrying out high-throughput sequencing on the genome by adopting an Illumina NovaSeq sequencing platform, wherein the sequencing quantity of each sample is 30Gb, and the sequencing strategy is Pair-End 150 bp. And (3) detecting the sequence difference of the sequenced female sample and male sample by adopting a high-throughput sequencing sequence alignment strategy. 109-tailed double-wishbone individuals (51 female and 58 male) were taken and subjected to whole genome association analysis using SNPs developed by whole genome sequencing. Screening to obtain sex specific molecular markers, determining sex chromosomes of the double-wishbone, and obtaining female specific genome DNA sequences on the sex chromosomes through fine alignment. On the basis, amplification is carried out according to high-throughput sequencing data and a primer so as to obtain a sequence which contains a sex-specific DNA fragment and can be used for identifying the sex of the salangid male and female by a PCR method. PCR primers (F: GATGATCACTGCAATGTTTC; R: GTGGCCAAACGCAGCATTGA) are designed, and the electrophoresis result of the female fish sample has 1187bp and 676bp bands, and the electrophoresis result of the male fish sample has only 676bp bands. Wherein, the PCR product of the female genome has two bands with the size of 1187bp and 676bp, and the 1187bp sequence is unique to female and comprises a female specific DNA sequence; the 676bp sequence and a male genome amplification product are homologous sequence amplification products in a homologous double-tassel Onchiostomus genome.
(2) Designing a PCR primer:
designing primers according to the female specific DNA sequence obtained in the step (1), wherein the determined primer sequences are as follows:
F：GATGATCACTGCAATGTTTC(SEQ ID NO：1)；
R：GTGGCCAAACGCAGCATTGA(SEQ ID NO：2)。
(3) PCR amplification reaction and agarose gel electrophoresis detection:
the total of 122 fish of the double-beard Onchiostomus was collected from the research institute of Zhujiang aquatic products, Chinese institute of aquatic science. Gonadal tissue was dissected and gender identified by histological methods (64 female and 58 male). Collecting the gluteal fin tissue of each fish, extracting genome DNA by using an Omega genome DNA extraction kit, and carrying out PCR amplification by using primers F and R by using the obtained genome DNA as a template. The total volume of the PCR amplification reaction was 25. mu.L, including: 10 × Buffer 2.5 μ L, Mg2+(25mmol/L) 1. mu. L, dNTPs (2 mmol/L each) 1. mu.L, upstream and downstream primers (10. mu. mol/L) 1. mu.L, template DNA 1. mu.L (50 ng/. mu.L), Taq DNA polymerase 1U, and an appropriate amount of ddH2And O. The PCR reaction program is: pre-denaturation at 94 ℃ for 3min, 30 cycles (denaturation at 94 ℃ for 30s, annealing at 50 ℃ for 30s, extension at 72 ℃ for 30s), and final extension at 72 ℃ for 10 min. 1.0% agarose was used for PCR productsAnd carrying out electrophoretic separation on the gel, setting the voltage to be 120V and the time to be 20min, and observing by using a gel imager. The result shows that the electrophoresis result of the female fish sample of the PCR amplification product of the female fish DNA has 1187bp and 676bp bands, the male fish only has the 676bp band, and the detection accuracy rate is 100%.
The result of agarose gel electrophoresis for sex determination of Onchiostoma bicolor in this example is shown in FIG. 1. (wherein YLS1, YLS2, YLS6 and YLS7 are male double-wished hyoglossus and have no specific bands, and YLS4, YLS5, YLS9 and YLS10 are female double-wished hyoglossus and have specific amplification bands).
The above embodiments are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principle of the present invention should be construed as equivalents thereof, and all such changes, modifications, substitutions, combinations, and simplifications are intended to be included in the scope of the present invention.
Sequence listing
<110> Zhujiang aquatic research institute of Chinese aquatic science research institute
<120> primer for identifying genetic sex of Onchiostoma bicolor and PCR identification method
<130> 2021-11-26
<160> 5
<170> SIPOSequenceListing 1.0
<210> 1
<211> 20
<212> DNA
<213> Artificial Synthesis ()
<400> 1
gatgatcact gcaatgtttc 20
<210> 2
<211> 20
<212> DNA
<213> Artificial Synthesis ()
<400> 2
gtggccaaac gcagcattga 20
<210> 3
<211> 1187
<212> DNA
<213> Artificial Synthesis ()
<400> 3
gatgatcact gcaatgtttc ccgaaacaaa agaacaagga acccttcact cgagcaagtt 60
agcccggtca atgcctcccc ttgtgcgtga gacccacagg tatccccccc tcctcgtcat 120
ctccgcctgg cagcacacgc agcgggctgg gcagctgctg atggacattt cccgctctcg 180
ctgtttattg aggccaaccc tccagcttct gacagattcc ttttatcttt ccagggagtc 240
gacgcagcac ctcttccggc ggcgatctgc tttcgagccc gtccgggcgt ggttcgacgg 300
ttgcggtcct gttccggcgg accccggtgg cagaccccag cggcgggggt tgctccactt 360
gcgcaacggc ccaccaacgg cgcatgcgat gaatcgttgg gagtcccgag cggctggccg 420
ctttcagcag aaggactcat ttggtgcggt aggggaggcg tcgggcggtc gaacggcagt 480
cgtgccggac tgcgaggact cgttctccag aattgtctgg aaggacatcg ccctgattta 540
cagctgggga ggctgttaat acaaaaacgg gatttcacta tcgatatggg tgtaatgaaa 600
agagcctgag aaatattaac ctttgcctcg agttttcagc ctcaaaaatt ccctcgtaaa 660
acccatctct ccaaggctcc gcacagtaaa tctgtcttag agagcatgaa aaataaaagt 720
ctgctgtctt ttgctggcta cgctggtttt tggggtctcg gggcagagct ttggagaggc 780
ggggctgggg ggggtggggt cgacctcggt cggactgggg tcctagggga ccgctctcca 840
ccgctcggct cgcagcggcc cctcgggggt gcgggacgct ccgcagagaa cgtgctccgc 900
tctccaggga gaaaaagaag ggtggctcgg gggcgggggg gggggatgag acaaagcgag 960
accggcggga ccacagtgct caagcctaat gatagatgtc cttcagatgt cctcgaatgc 1020
gcgccaccgg tcccagccac acagaggcct actatgagct aatggtgtcc actccaaatg 1080
gcccgcttta aattagagac tccggcgatg cccactcaag caccgacaca atgaaaaatg 1140
tgctgcattg tacgtgcctc tatttagtca atgctgcgtt tggccac 1187
<210> 4
<211> 676
<212> DNA
<213> Artificial Synthesis ()
<400> 4
gatgatcact gcaatgtttc acactattat ttttaatgag tgacttgcac aagaggaaaa 60
gctggcgtag gcgcattgac acgaatgcac aaaaaagaaa aggcctcgcg acaaacttaa 120
aacgcgcggc tttttcgtct gaggtatcga gtgccgccgg tcgttccgca ttttggatct 180
ctttgaagca tcaactttgc gagcgggttt ttagtgtaaa tgttgacaac agcgctctct 240
agaagccgtg catcaaaaaa tggggggggg gggaacgcgg ctctgacgcg cggactccga 300
cgccgattac gtttctgccc acacgtgttg cacgcgacag cttgtcttta ttttcgaacc 360
cgtcgacgca atccgaatgc ctcttcgcat ccgagcgcct ttgcaagaat tcggttcgga 420
tcgcttcgtt tttatgacgt tcgcctctca ccggagcgag gccgaatgag gttggagcgc 480
aaaacaattt tatttatgta tttatattaa tttatttcgc tttttacata tttttcggtt 540
tcgtcgtttc ctgttctctg tgcttaggtg acgttgtaaa tttccctgct gtgggattaa 600
tgaagtctca tcttatctta acgatttctc aaaataatcc aaaattacat cgtcgttcaa 660
tgctgcgttt ggccac 676
<210> 5
<211> 510
<212> DNA
<213> Artificial Synthesis ()
<400> 5
gacgctccgc agagaacgtg ctccgctctc cagggagaaa aagaagggtg gctcgggggc 60
gggggggggg gatgagacaa agcgagaccg gcgggaccac agtgctcaag cctaatgata 120
gatgtccttc agatgtcctc gaatgcgcgc caccggtccc agccacacag aggcctacta 180
tgagctaatg gtgtccactc caaatggccc gctttaaatt agagactccg gcgatgccca 240
ctcaagcacc gacacaatga aaaatgtgct gcattgtacg tgcctctatt tagtcaatgc 300
tgcgtttggc cacttaactc attttagttg ctttgtgcac gtttgcaacg attttttttt 360
tgttggacgc tcttgtgctg ggcgggtggg tagttaaggt ggtcaaaaca atttttcacc 420
gtgtctccat ccatcactac gacaaccatt taatgtcgtc atcatcgtcg tcatcatcat 480
ggtctctgga accgcttaat ccaatgcagg 510
Claims (8)
1. The primer for identifying the genetic sex of the anchovy with double-wishbone is characterized by comprising the following sequences:
F：GATGATCACTGCAATGTTTC；
R：GTGGCCAAACGCAGCATTGA。
2. a PCR identification method for genetic sex of the double-wishbone is characterized by comprising the following steps:
the primer of claim 1 is used for PCR amplification reaction and agarose gel electrophoresis detection, and the result shows that the female is the double band of 1187bp and 676bp, and the male is the double band of 676 bp.
3. The method for identifying the genetic sex of the anchovy as claimed in claim 2, wherein the PCR amplification reaction conditions are as follows:
the total volume of the PCR reaction was 25. mu.L, including: 10 × Buffer 2.5 μ L, Mg2+1 uL of dNTPs, 1 uL of upstream and downstream primers, 1 uL of template DNA, 1U of TaqDNA polymerase, and ddH2And appropriate amount of O.
4. The method for PCR identification of the genetic sex of Onchiostoma bicolor as claimed in claim 3, wherein Mg is added2+The concentration is 25mmol/L, the concentration of dNTPs is 2mmol/L, the concentration of the upstream primer and the downstream primer is 10 mu mol/L, and the concentration of the template DNA is 50 ng/mu L.
5. The method for PCR identification of the genetic sex of the Amyda bicolor according to claim 3 or 4, wherein the PCR amplification reaction program comprises: pre-denaturation at 94 ℃ for 3 min; denaturation at 94 ℃ for 30s, annealing at 50 ℃ for 30s, and extension at 72 ℃ for 30s for 30 cycles; finally, extension is carried out for 10min at 72 ℃.
6. The PCR identification method of the genetic sex of the Osmanthus aphyllus hybridus of claim 2, wherein the nucleotide sequence of 1187bp band of the PCR amplification reaction is SEQ ID NO: 3.
7. the PCR identification method of the genetic sex of the Onchiostomus bicolor as claimed in claim 2, wherein the nucleotide sequence of the 676bp band of the PCR amplification reaction is SEQ ID NO: 4.
8. the PCR method for genetic sex determination of Amyda bicolor as claimed in claim 2, wherein the agarose gel electrophoresis detection is performed by 1.0% agarose gel electrophoresis separation, setting voltage at 120V for 20min, and then observing and taking pictures by a gel imager.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111431703.6A CN114164282B (en) | 2021-11-29 | 2021-11-29 | Primer for identifying genetic sex of hynchus bifidus and PCR identification method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111431703.6A CN114164282B (en) | 2021-11-29 | 2021-11-29 | Primer for identifying genetic sex of hynchus bifidus and PCR identification method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114164282A true CN114164282A (en) | 2022-03-11 |
| CN114164282B CN114164282B (en) | 2023-05-09 |
Family
ID=80481402
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111431703.6A Active CN114164282B (en) | 2021-11-29 | 2021-11-29 | Primer for identifying genetic sex of hynchus bifidus and PCR identification method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114164282B (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106636364A (en) * | 2016-11-11 | 2017-05-10 | 厦门出入境检验检疫局检验检疫技术中心 | Multi-PCR kit for rapidly identifying Dragonfish type and identifying method thereof |
| CN113005203A (en) * | 2021-03-27 | 2021-06-22 | 中国水产科学研究院珠江水产研究所 | Microsatellite marking method for identifying paternity of scleropages formosus |
-
2021
- 2021-11-29 CN CN202111431703.6A patent/CN114164282B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106636364A (en) * | 2016-11-11 | 2017-05-10 | 厦门出入境检验检疫局检验检疫技术中心 | Multi-PCR kit for rapidly identifying Dragonfish type and identifying method thereof |
| CN113005203A (en) * | 2021-03-27 | 2021-06-22 | 中国水产科学研究院珠江水产研究所 | Microsatellite marking method for identifying paternity of scleropages formosus |
Non-Patent Citations (2)
| Title |
|---|
| 王且鲁;刘奕;宋红梅;汪学杰;刘超;牟希东;胡隐昌;罗建仁;: "双须骨舌鱼转录组EST-SSR标记开发与引物筛选" * |
| 田媛: "双须骨舌鱼雌雄鉴别与性腺发育研究" * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN114164282B (en) | 2023-05-09 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111154754B (en) | Probe set for analyzing DNA sample and method for using the same | |
| CN114686597B (en) | SNP molecular marker for sex identification of silver dragon fish and application thereof | |
| CN110607359B (en) | Patinopecten yessoensis female specific marker combination and application | |
| KR20130045636A (en) | Ssr primer derived from paeonia lactiflora and use thereof | |
| CN115198023B (en) | Hainan cattle liquid-phase breeding chip and application thereof | |
| TW201936921A (en) | A primer for next generation sequencer and a method for producing the same, a DNA library obtained through the use of a primer for next generation sequencer and a method for producing the same, and a DNA analyzing method using a DNA library | |
| Thies | Molecular approaches to studying the soil biota | |
| KR20130142523A (en) | Method for designing fusion primer used in next generation sequencing, and method for analyzing genotype of target gene using next generation sequencing and fusion primer | |
| CN111549146A (en) | Universal macro-barcode amplification primer for mitochondria of amphibian and application method thereof | |
| CN108823327B (en) | Camphor tree whole genome SSR molecular marker and preparation method and application thereof | |
| CN114164283B (en) | PCR primer for sex identification of double-wishbone and identification method | |
| CN114164282B (en) | Primer for identifying genetic sex of hynchus bifidus and PCR identification method | |
| CN114875157B (en) | SNP (Single nucleotide polymorphism) marker related to individual growth traits of pelteobagrus fulvidraco and application | |
| CN113801945B (en) | Molecular marker C768 for identifying ammonia nitrogen tolerance character of portunus trituberculatus and application thereof | |
| CN112725427B (en) | Primer, fluorescent probe and kit for identifying gender of sturgeon based on fluorescent PCR | |
| CN112522422A (en) | Molecular identification method of pelagic fish and little-scale pelagic fish based on COI gene fragment | |
| CN109280697B (en) | Method for identifying fetal genotype by using plasma free DNA of pregnant woman | |
| CN110643713A (en) | STR locus set for pandas and application thereof | |
| CN113981112B (en) | InDel marker C3082 for identifying ammonia nitrogen tolerance character of portunus trituberculatus, primers and application thereof | |
| CN110846419B (en) | SSR primer pair group, kit, identification method and application for identifying huso and flash sturgeon species | |
| CN114686594B (en) | SNP molecular marker suitable for sex identification of silver dragon fish and application thereof | |
| CN114686595B (en) | SNP molecular marker for sex identification of silver dragon fish and application thereof | |
| CN114686596B (en) | SNP molecular marker for sex identification of silver dragon fish and application thereof | |
| KR101414827B1 (en) | The Specific Primer-Set and Usage for DNA Profiling or Human Y STR Test | |
| CN113403406B (en) | Multiplex amplification system and kit for X chromosome STR locus |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |