CN114149990A

CN114149990A - Method for editing BCL11A gene in hematopoietic stem/progenitor cells

Info

Publication number: CN114149990A
Application number: CN202010933224.3A
Authority: CN
Inventors: 焦娇; 崔正之; 栗飞红
Original assignee: Gan and Lee Pharmaceuticals Co Ltd
Current assignee: Gan and Lee Pharmaceuticals Co Ltd
Priority date: 2020-09-08
Filing date: 2020-09-08
Publication date: 2022-03-08
Also published as: WO2022052909A1

Abstract

The invention provides a method for editing BCL11A gene in hematopoietic stem/progenitor cells and a method for improving HbF expression of human hematopoietic stem/progenitor cells after erythroid differentiation, and also provides the hematopoietic stem/progenitor cells with the edited BCL11A gene, application of the cells in preparing medicines or medical products for preventing or treating anemia diseases, gRNA for editing BCL11A gene in the hematopoietic stem/progenitor cells and a kit containing the gRNA.

Description

Method for editing BCL11A gene in hematopoietic stem/progenitor cells

Technical Field

The invention belongs to the field of biological medicine. In particular to a method for editing genes in hematopoietic stem/progenitor cells by a gene editing system and a method for improving HbF expression of the human hematopoietic stem/progenitor cells after erythroid differentiation.

Background

Beta thalassemia (beta thalassemia for short) is a clinically common hereditary hemolytic anemia. Statistically, about 1.5% of the world population carries beta thalassemia genes (8000-9000 ten thousand people), and at least ten thousand of the heavy beta thalassemia patients are born each year, which has become a global public health problem.

Hemoglobin present in blood is mainly responsible for oxygen transport, and anemia is caused by a decrease in the amount or loss of function of hemoglobin. Normal hemoglobin consists of 4 subunits, most commonly adult hemoglobin HbA, consisting of 2 alpha and 2 beta subunits (α 2 β 2), the predominant form of adult hemoglobin, accounting for more than about 98%; the other is fetal hemoglobin HbF, which consists of 2 alpha subunits and 2 gamma subunits (α 2 γ 2), the major form of hemoglobin during fetal development and after birth. HbF can account for 70% of total hemoglobin at birth, but with age, the gamma subunit expression begins to decrease and the beta subunit begins to increase, with HbF levels generally not exceeding 1% of total hemoglobin after adulthood. Beta thalassemia patients have mutation of genes encoding beta subunits, so that the synthesis of the beta subunits in the patients is insufficient, HbA is reduced, and severe anemia is caused.

At present, most severe patients with beta-thalassemia are treated by long-term blood transfusion and iron discharging, but the long-term treatment can cause organ injury, hepatosplenomegaly and shortened life expectancy of the patients. The possible method for curing moderate and severe beta thalassemia is allogeneic hematopoietic stem cell transplantation, but the success rate of matching is low and the cost is very expensive, which brings great burden to families and society. The autologous hematopoietic stem cell gene therapy firstly collects the autologous hematopoietic stem cells carrying variant genes of a patient, temporarily cultures the hematopoietic stem cells in vitro, and transplants the cells into the body of the patient after introducing normal genes and corresponding expression regulatory elements, thereby bringing about long-term improvement on treatment.

Recent studies have found that the B-cell lymphoma 11A (BCL11A) gene is a key gene that regulates HbF expression. After birth of the fetus, BCL11A gene suppressed HbF expression. In contrast, researchers knock out the enhancer region of autologous hematopoietic stem cell BCLl1A gene of a patient through a CRISPR/Cas system, and inhibit the expression of BCL11A gene, so that HbF is re-expressed, and the mutant HbA is compensated, thereby achieving the purpose of treating beta thalassemia.

The CRISPR/Cas system is known as Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)/CRISPR-associated (Cas) system, which is a kind of acquired immune system currently found in most and all archaea to destroy foreign plastids or phages. Because of their properties of interfering with dna, they are currently actively used in genetic engineering as gene editing tools, and as well as zinc finger nucleases (zincfingenulease) and transcription activator-like nucleases (TALENs), they also use Non-homologous end joining (NHEJ) mechanism to generate double strand breaks of dna in the genome to facilitate editing. Three different types of CRISPR/Cas systems have been found to exist, of which the second type has a simpler composition, consisting of Cas9 and guide RNA (gRNA) as cores, and is applied to the genome editing of mammalian cells and zebrafish through genetic engineering. Cas9 is an RNA-mediated endonuclease that is directed by a gRNA complementary to a target sequence that must be adjacent to a pam (protospaceradjjacentmotif) sequence in the form of NGG or NAG to target sequences in the genome. Upon binding to the target sequence, a Single Strand Break (SSB) or Double Strand Break (DSB) is generated in a specific genomic region, thereby activating repair mechanisms such as non-homologous end joining (NHEJ) or homologous repair pathway (HDR) of the body. When under the NHEJ repair mechanism, without a template, DNA is only randomly repaired to restore its double-stranded structure, which causes the repair result to be different from the original genomic sequence, forming a mutation, resulting in the reduction or elimination of the gene of the target sequence in the cell. In recent years, the CRISPR/Cas9 system that has been engineered has been used for genome editing in eukaryotic cells.

Disclosure of Invention

The inventor unexpectedly finds that the BCL11A gene enhancer +62 has good effect on improving the HbF expression level, for example, the ratio of the hematopoietic stem/progenitor cells which are edited by the gene to differentiate into HbF positive erythrocytes is more than 65%. The method comprises the following steps: introducing one or more grnas targeting the BCL11A gene enhancer position +62 and one or more endonucleases into the cell, resulting in a Single Strand Break (SSB) or Double Strand Break (DSB) within or near the BCL11A gene enhancer, e.g., resulting in deletion or inactivation of 45% -80% of the BCL11A gene enhancer in the cell, correspondingly resulting in a differentiation of the hematopoietic stem/progenitor cell to HbF-positive erythrocytes of greater than 65%; wherein the gRNA comprises crRNA and tracrRNA, and the BCL11A enhancer +62 bit sequence is shown in SEQ ID NO: 14. The BCL11A gene is deleted efficiently in hematopoietic stem/progenitor cells, the inhibition effect of the BCL11A gene on HbF is relieved, high-level expression HbF is obtained, and the mutant HbA is compensated, so that the aim of treating anemia diseases is fulfilled.

Further, the guide sequence of the crRNA is selected from

a.SEQ ID NO:1，

b.SEQ ID NO:2，

c.SEQ ID NO:3，

d.SEQ ID NO:4，

e.SEQ ID NO:5，

f.SEQ ID NO:6，

g.a-f, wherein 1-4 bases are optionally added or deleted from the 5 'or 3' end, preferably the added or deleted bases are complementary to the bases at the corresponding positions of the target DNA.

Preferably, the guide sequence of the crRNA is selected from SEQ ID NO 1 or SEQ ID NO 2,

or SEQ ID NO 1 or SEQ ID NO 2 wherein 1 to 4 bases are optionally added or deleted at the 5 'or 3' end of SEQ ID NO 1 or SEQ ID NO 2, preferably, the added or deleted bases are complementary to the bases at the corresponding positions of the target DNA,

wherein the proportion of said hematopoietic stem/progenitor cells that are correspondingly caused to differentiate into HbF-positive erythrocytes is more than 70%.

Further, the endonuclease is selected from the group consisting of Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5 (also referred to as Csn 5 and Csx 5), Cas5, Csy 5, Cse 5, Csc 5, Csa5, Csn 5, Csm5, Cmr5, Csb 5, Csx 5, CsaX 5, csaf 5, csxf 5, csxf, Csf, a5, a5, a mutant forms thereof, a5, a5, a mutant forms thereof, a mutant forms thereof, or a mutant forms thereof, a mutant forms thereof, a mutant forms thereof, or a forms thereof, and forms thereof; preferably, the endonuclease is Cas 9.

Further, the sequence of the tracrRNA is shown as SEQ ID NO. 7, or a nucleotide sequence which is formed by replacing, deleting and/or optionally adding 1-4 bases from the 5 'end to the 3' end and has the same function with the SEQ ID NO. 7.

Further, the gRNA is not modified with 2 '-O-methylation and/or internucleotide 3' phosphorothioate. However, most of the prior art uses 2' -O-methyl analogs and/or internucleotide 3 ' -thio modifications of gRNAs, such as chemical modifications of the gRNAs that involve 2' -O-methylation of the first, second and/or third base at the 5 ' end and/or the last base at the 3 ' end of the gRNA. The present inventors have surprisingly found that without such chemical modification of grnas, the editing efficiency is higher.

Further, the method includes premixing the endonuclease with a gRNA to form one or more RNP complexes.

Further, the one or more RNP complexes are delivered to the hematopoietic stem/progenitor cells by electroporation transfection, and the method can ensure high gRNA editing efficiency, reduce cost and meet the quality of drug declaration. Most of the prior art use the introduction of endonucleases and grnas by means of lentiviruses, which lead to clinically predisposing leukemias.

Preferably, the molar ratio of endonuclease to gRNA in the RNP complex is 1 (0.4-5.5), e.g., 1: 0.5; 1: 1; 1: 1.5; 1: 2; 1: 2.5; 1: 3; 1: 3.5; 1: 4; 1; 4.5; 1:5, and further preferably, the molar ratio of endonuclease to gRNA in the RNP complex is 1 (1-2.5).

Further, the hematopoietic stem/progenitor cells are mammalian cells, primate cells, preferably primate cells, and more preferably human cells.

In a second aspect of the present invention, there is provided a method for increasing HbF expression of hematopoietic stem/progenitor cells after erythroid differentiation, comprising the steps of:

1) editing the BCL11A gene of a hematopoietic stem/progenitor cell using the method of any one of the first aspect;

2) differentiating the hematopoietic stem/progenitor cells described in step 1).

In a third aspect, the present invention provides a hematopoietic stem/progenitor cell obtained by the method of any one of the first aspect, wherein the hematopoietic stem/progenitor cell is differentiated into erythrocytes exhibiting a HbF/(HbF + HbA) ratio of 15% or more and, preferably, 15% to 45%.

In a fourth aspect, the invention provides the use of the hematopoietic stem/progenitor cells of the third aspect in the preparation of a medicament or medical article for increasing HbF expression in a mammal (preferably a human).

Further, the present invention provides the use of the hematopoietic stem/progenitor cells of the third aspect in the preparation of a medicament or medical product for the prevention or treatment of anemic disorders, hemorrhagic disorders, tumors, or other disorders requiring massive blood transfusions for prevention or treatment, preferably, the anemic disorder is beta thalassemia or sickle cell anemia.

In a fifth aspect, the present invention provides one or more guide ribonucleic acids (grnas) for editing BCL11A gene of a hematopoietic stem/progenitor cell, the grnas comprising a crRNA and a tracrRNA, the grnas being in the form of a dimer consisting of the crRNA and the tracrRNA or an artificially engineered sgRNA fused from the crRNA and the tracrRNA; the guide sequence of the crRNA is selected from

a.SEQ ID NO:1，

b.SEQ ID NO:2，

c.SEQ ID NO:3，

d.SEQ ID NO:4，

e.SEQ ID NO:5，

f.SEQ ID NO:6，

g.a-f, wherein 1-4 bases are optionally added or deleted at the 5 'or 3' end, preferably the added or deleted bases are complementary to the bases at the corresponding position of BCL11A gene;

the sequence of the tracrRNA is shown as SEQ ID NO. 7, or a nucleotide sequence which is formed by replacing, deleting and/or optionally adding 1-4 bases at the 5 'end to the 3' end and has the same function with the SEQ ID NO. 7.

Further, the gRNA is not modified with 2 '-O-methylation and/or 3' phosphorothioate between nucleotides.

The invention also provides a kit comprising a gRNA according to any one of the fifth aspects and one or more endonucleases selected from the group consisting of Cas1, Cas1B, Cas2, Cas3 (also referred to as Csn 3 and Csx 3), Cas3, Csy3, Cse 3, Csc 3, Csa 3, Csn 3, Csm3, Cmr3, Csb3, Csx3, CsaX 3, csaf 3, Csx3, csaf, cs3672, csaf, cs3672, a 3, a mutant forms of a, a mutant forms of a nucleic acid, or a, a nucleic acid, or a recombinant forms thereof, wherein the nucleic acid molecule is present in a form, or a form thereof, and a form thereof.

Further, the kit is used for treating or preventing the poor blood disease, the blood loss disease, the tumor or other diseases needing massive blood transfusion for prevention or treatment of the subjects.

The invention also provides the use of a BCL11A gene fragment as a target for the design of a medicament for increasing the in vivo hemoglobin evaluation in a subject, the BCL11A gene fragment being selected from the group consisting of sequences that are fully complementary to:

a.SEQ ID NO:1，

b.SEQ ID NO:2，

c.SEQ ID NO:3，

d.SEQ ID NO:4，

e.SEQ ID NO:5，

f.SEQ ID NO:6，

g.a-f, wherein 1-4 bases are optionally added or deleted from the 5 'or 3' end, and the added or deleted bases are bases at the corresponding position of BCL11A gene.

Defining:

CD34+ cells: the CD34 molecule is a highly glycosylated transmembrane glycoprotein, selectively expressed on the surface of hematopoietic stem/progenitor cells of human and other mammals. The CD34 positive cells described herein therefore represent hematopoietic stem/progenitor cells.

B cell lymphoma 11A (BCL11A) gene: is a protooncogene, which is abundantly expressed in human lymph node, thymus and bone marrow tissues, and has low-level expression in most other tissues. An enhancer of the BCL11A gene can negatively regulate the expression of fetal hemoglobin (HbF), wherein positions +55 (a region +55kb from the transcription start site, kb represents 1000 bases), position +58 (a region +58kb from the transcription start site, kb represents 1000 bases), position +62 (a region +62kb from the transcription start site, kb represents 1000 bases) are defined according to the distance (in kilobases) of the BCL11A enhancer from the transcription start site, and the positions are key regulation regions for negatively regulating the expression of fetal hemoglobin (HbF). The base sequence at position 11A +62 of BCL (see sequence SEQ ID NO:14) is located in the region 60,717,492 to 60,718,860 of human chromosome II (relative to the human hg19 genome) (see Erythroid Enhancer of BCL11A Subject to Genetic Variation providers Feal Hemoglobin Level, Daniel E.Bauer et al, Science vol, 342, complementary Material). These regions are destroyed by editing to affect expression of BCL11A protein and are ultimately used for HbF enrichment.

The CRISPR/Cas9(Clustered partitioned short palindromic repeats/CRISPR-associated end complex 9) gene editing system is an artificial endonuclease gene editing system and is a gene knockout means commonly used in the prior art. CRISPR/Cas9 is composed of two parts: 1) a guide RNA, hereinafter also referred to as gRNA, and 2) endonuclease Cas 9; the grnas described herein include crRNA (CRISPR-derived RNA) and tracrRNA (trans-activating RNA). The crRNA and tracrRNA function in one of the following ways: 1) a tracrRNA/crRNA dimer, a part of the sequence of the crRNA is complementary to a part of the sequence of the tracrRNA and forms a dimer, and it is understood by those skilled in the art that a part of the base sequence of the crRNA is a guide sequence complementary to the target DNA sequence, and another part of the base sequence and a part of the sequence of the tracrRNA are combined together through base pairing to form a chimeric RNA (i.e., a tracrRNA/crRNA dimer); 2) the crRNA is fused with the tracrRNA into a chimeric single-stranded guide RNA (sgRNA) at the 5' end of the tracrRNA, wherein the crRNA includes a guide sequence. The tracrRNA sequence of the gRNA may be a conventional tracrRNA sequence known to the person skilled in the art, i.e. as the person skilled in the art knows which tracrRNA sequence can be used to implement the present invention, as the person skilled in the art knows that SEQ ID No. 7 may be used as a tracrRNA; further, the skilled person knows that mutants having 50% to 99%, preferably 60% to 99%, more preferably 70% to 99%, still more preferably 80% to 99%, even more preferably 90% to 99% identity to conventionally used tracrRNA sequences, such as SEQ ID No. 7, can also be used to carry out the present invention. It will be understood by those skilled in the art that the gRNA includes a guide sequence and a framework sequence, and the gRNA may be in the form of a dimer consisting of crRNA and tracrRNA or an artificially engineered chimeric single-stranded sgRNA formed by fusion of crRNA and tracrRNA, so that the framework sequence may be a dimer consisting of crRNA and tracrRNA or an artificially engineered chimeric single-stranded sgRNA formed by fusion of crRNA and tracrRNA, and the framework sequence is known to those skilled in the art; cas9 endonuclease is used to cleave the active domain of DNA, breaking the DNA.

As used herein, the term "ribonucleic acid protein (RNP complex) refers to a protein complex comprising RNA, i.e., a form in which a nucleic acid and a protein are bound together. In the CRISPR/Cas9 system, the gRNA binds to Cas9 to form a Cas9-gRNA complex, and upon binding of the complex to matching target DNA adjacent to the PAM, the Cas9 undergoes a conformational change, which triggers endonuclease activity, resulting in a Single Strand Break (SSB) or Double Strand Break (DSB) of DNA that the cell will repair by non-homologous end joining (NHEJ) or Homologous Directed Repair (HDR).

Ratio of hematopoietic stem/progenitor cells to differentiate into HbF-positive erythrocytes: the ratio is measured using flow cytometry to characterize the ratio of HbF-expressing red blood cells to total red blood cells (wherein the red blood cells are obtained by differentiation of hematopoietic stem/progenitor cells), which directly reflects the ratio of HbF-expressing red blood cells to total red blood cells.

HbF/(HbF + HbA): the ratio is obtained by High Performance Liquid Chromatography (HPLC) detection, and specifically is a ratio of a normalized ratio of HbF peak areas to a sum of normalized ratios of HbF peak areas and HbA peak areas in an HPLC spectrum; the amount of HbF used to characterize HbF is the ratio of the sum of HbF and HbA.

Drawings

FIG. 1: experimental group a FACS scattergram expressing the percentage of HbF cells among erythrocytes differentiated from CD34+ cells edited with BCL11A gene using gRNA-1, the horizontal axis represents the fluorescence intensity of HbF, and the FSC channel represents forward scattered light.

FIG. 2: experimental group b FACS scattergrams of percentage of HbF-expressing cells in erythrocytes differentiated from CD34+ cells edited with BCL11A gene using gRNA-2, fluorescence intensity of HbF was plotted on the horizontal axis, and FSC channel represents forward scattered light.

FIG. 3: experimental group c FACS scattergrams of percentage of HbF-expressing cells in erythrocytes differentiated from CD34+ cells edited with BCL11A gene using gRNA-3, fluorescence intensity of HbF was plotted on the horizontal axis, and FSC channel represents forward scattered light.

FIG. 4: experimental group d FACS scattergrams of percentage of HbF-expressing cells in erythrocytes differentiated from CD34+ cells edited with BCL11A gene using gRNA-4, fluorescence intensity of HbF was plotted on the horizontal axis, and FSC channel represents forward scattered light.

FIG. 5: experimental group e FACS scattergrams of percentage of HbF-expressing cells in erythrocytes differentiated from CD34+ cells edited with BCL11A gene using gRNA-5, fluorescence intensity of HbF was plotted on the horizontal axis, and FSC channel represents forward scattered light.

FIG. 6: experimental group f FACS scattergrams of percentage of HbF-expressing cells in erythrocytes differentiated from CD34+ cells edited with BCL11A gene using gRNA-6, fluorescence intensity of HbF was plotted on the horizontal axis, and FSC channel represents forward scattered light.

FIG. 7: FACS scattergrams of percentage of HbF-expressing cells in erythrocytes differentiated from unedited CD34+ cells of the control gBCL11A gene, with HbF fluorescence intensity on the horizontal axis and FSC channel representing forward scattered light.

FIG. 8: in experimental group a, the results of HPLC measurement of HbF expression levels of erythrocytes differentiated from CD34+ cells edited by the gRNA-1 gene were used, and the X-axis represents time (unit: min) and the Y-axis represents peak height.

FIG. 9: in experimental group b, the HPLC measurement of HbF expression level of erythrocytes differentiated from CD34+ cells edited by the gRNA-2 gene was performed, and the X-axis represents time (unit: min) and the Y-axis represents peak height.

Detailed Description

Embodiments of the present invention will be described in detail below with reference to examples, but it will be understood by those skilled in the art that the following examples are only illustrative of the present invention and should not be construed as limiting the scope of the present invention. The examples, in which specific conditions are not specified, were conducted under conventional conditions or conditions recommended by the manufacturer. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products available commercially.

The abbreviations used in the embodiments are explained in detail in table 1:

TABLE 1 abbreviation names interpretation

Example 1: CD34+ cell culture

SFEM II medium (Stemcell) was prepared to culture CD34+ cells by adding 100ng/mL SCF (purchased from near-shore protein technology, Inc.), 100ng/mL Flt3-L (purchased from near-shore protein technology, Inc.), 100ng/mL TPO (purchased from near-shore protein technology, Inc.), 100ng/mL IL-6 (purchased from near-shore protein technology, Inc.) and 1% penicillin-streptomycin diabody (Gibco).

After the CD34+ cells are recovered, the cells are placed in a prepared SFEM II medium (Stemcell) for pre-stimulation, the concentration is 0.25 multiplied by 106 cells/mL, and the cells are placed in a CO2 incubator at 37 ℃ for pre-stimulation for 48 hours.

Example 2: electroporation transfection of peripheral blood-derived CD34+ cells

(1) Taking the CD34+ cells with good state obtained in the example 1, sucking, blowing, uniformly mixing, and then counting the cells;

(2) pipette 5X 104 cells into 7 15mL centrifuge tubes, numbered a-g. Subsequently, the centrifuge tubes with the numbers a-g are subjected to electroporation transfection by adopting the following conditions respectively:

grouping experiments: a.gRNA-1

b.gRNA-2

c.gRNA-3

d.gRNA-4

e.gRNA-5

f.gRNA-6

g. Control (without electroporation transfection)

The gRNA used in the examples of the present invention is a tracrRNA/crRNA dimer formed by annealing a crRNA and a tracrRNA, the tracrRNA of each gRNA used in the experimental group is represented by SEQ ID NO:7, and the guide sequence of the crRNA backbone sequence paired with the tracrRNA is GUUUUAGAGCUAUGCU, crRNA is shown in Table 2:

TABLE 2 guide sequences of crRNA of gRNA in experimental groups

(3) Respectively centrifuging the cells in the step (2) for 10min under the centrifugal force of 100g, and sucking the supernatant;

(4) 1mL of PBS is taken respectively for resuspending cell precipitation, centrifuging for 10min, and sucking supernatant;

(5) preparation of RNP complexes: gently mixing 2.1. mu.L PBS, 1.2. mu.L gRNA (120pmol) and 1.7. mu.L Cas9(IDT,105pmol) uniformly according to the electroporation transfection conditions designed in the step 2), placing for 15min at room temperature, and placing the prepared RNP compound in a 4-degree refrigerator for later use;

(6) preparing 20 mu L of electroporation transfection liquid, wherein the electroporation transfection liquid is prepared by mixing 16.4 mu L of Nucleofector Solution in a P3 Primary Cell4D-Nucleofector X Kit S Kit (Lonza) and 3.6 mu L of Supplement1, and the electroporation transfection liquid is placed at normal temperature for use; resuspend each set of cells using 20 μ Ι _ of electroporation transfection fluid;

(7) electroporation transfection

Adding 20 μ L of each Cell suspension into 5 μ L of corresponding RNP complex and 3.85 μ M electroporation enhancer (IDT), mixing, adding 25 μ L of Cell suspension into a special cuvette provided in P3 Primary Cell4D-nucleofector X Kit S Kit (Lonza);

placing the electric shocking cup into an electroporation transfection instrument (Lonza) and executing an electroporation transfection program;

(8) after electroporation transfection, 75 μ L of fresh SFEM II medium (Stemcell) was added to each group immediately, mixed well, the cell suspension in the cuvette was aspirated, and after the culture was resumed in the incubator for 30min, the mixture was added to a 96-well plate for further culture.

Example 3: extraction of CD34+ cell genome after electroporation transfection

(1) After electroporation transfection of CD34+ cells of each experimental group, cells are recovered after continuous culture for 72 h;

(2) the genomes of each experimental group were extracted manually:

centrifuging at 500g for 5min, and resuspending the cell pellet in 500. mu.L of Tris-HCl (pH 8.0),100mM/L of EDTA (pH 8.0),100mM/L of NaCl, 1% SDS; adding 200 mu L of saturated NaCl solution into the mixture, and violently shaking and uniformly mixing the mixture; centrifuging for 10min at 4 ℃ and 13000 rpm; the resulting supernatant was transferred to an EP tube containing 700. mu.L of isopropanol and mixed by inversion to give rise to feathery material (DNA); centrifuging at 4 deg.C and 13000rpm for 5min, and removing supernatant; adding 600 μ L of 75% ethanol, turning upside down, centrifuging at 13000rpm for 5min, and discarding the supernatant; opening the cover for 3-5min to volatilize ethanol; finally, 20. mu.L of sterile double distilled water was added to dissolve the DNA.

Example 4: shear efficiency validation

(1) According to different sequences of gRNAs of each experimental group, a fragment containing gRNA editing sites is selected for amplification, the amplified fragment is about 500-600 bp, and the edited sites are not required to be positioned in the middle of the amplified fragment, so that two bands with different sizes can be cut out, and a person skilled in the art knows that a primer sequence for amplification is designed and synthesized according to the fragment to be amplified.

(2) PCR amplification (primer sequences are shown as SEQ ID NO:8-13) with designed primers

HSDNAPolymease (Takara) performs PCR amplification, and recovers PCR products, wherein the PCR system is shown in Table 3:

T7E1-F1TGTCACATGCTGTGCTGGTA(SEQ ID NO:8)

T7E1-R1AGAACTCGGCATGAAGGGTA(SEQ ID NO:9)

T7E1-F2CCAAAAGTGTCCATGTTTGCT(SEQ ID NO:10)

T7E1-R2CCTAAAAGGGAAGTTATTTTTCCA(SEQ ID NO:11)

T7E1-F3CCCTCTGGCATCAAAATGAG(SEQ ID NO:12)

T7E1-R3TTTGAAAGTACCAGCACAGCA(SEQ ID NO:13)

wherein SEQ ID NO 8 and 9 are used for amplifying DNA fragments of about 565bp near the editing sites of gRNA-1, gRNA-2 or gRNA-4;

wherein SEQ ID NO 10 and 11 are used to amplify a DNA fragment of about 501bp near the editing site of gRNA-3 or gRNA-6;

wherein SEQ ID NO 12 and 13 are used to amplify a DNA fragment of about 564bp near the editing site of gRNA-5.

TABLE 3 PCR System

5 Xbuffer solution	10μL
		dNTP	4μL
Forward primer	1μL
		Reverse primer	1μL
Form panel	1μL
		Polymerase enzyme	0.5μL
Double distilled water	32.5μL

(3) The cleavage of T7E1 is characterized by the shearing efficiency: the T7 endonuclease I kit (Kinsry) was used, wherein the cleavage system is shown in Table 4:

TABLE 4 enzyme digestion System

PCR product	200ng
		10x reaction buffer	2μl
Nuclease-free water	17μl
		T7 Endonuclease I	1μL

A gradient annealing procedure was used: a, pre-denaturation: 5min at 95 ℃; b. gradient annealing: 95-85 ℃ and-2 ℃/s; 85-25 ℃ and-0.1 ℃/s; the temperature is kept at 4 ℃ until the annealing is completed. Adding 1 mu L T7E1 enzyme into the annealed PCR product, incubating at 37 ℃ for 15min, detecting the enzyme digestion result by 1.5% agarose gel electrophoresis, and determining the gene editing efficiency of each experimental group (taking the amplification result of the fragment of the gRNA-1 editing site as an example, the electrophoresis result shows 3 bands, the sizes of the bands are about 565bp, 360bp and 200 bp. respectively, and the grey level of the bands is analyzed by ImageJ software, and the cutting efficiency is calculated, wherein the editing efficiency is (the grey level of the 360bp bands + the grey level of the 200bp bands)/the sum of the grey levels of the 3 bands multiplied by 100%) and is shown in Table 5:

TABLE 5 BCL11A Gene editing efficiency of experimental groups a-f

Example 5: hematopoietic stem/progenitor erythroid differentiation

Cells 3 days after electroporation transfection were transferred sequentially to erythroid differentiation medium at different stages, the method consisting of 3 stages: differentiation (DIF) I (days 0-4), Differentiation (DIF) II (days 5-8) and Differentiation (DIF) III (days 9-16). Wherein the erythroid differentiation basal medium (EDM) comprises IMDM (Gibco), 15% FBS, 1% L-glutamine (Gibco), 1% BSA (Sigma), 1% ITS (Gibco), 1% penicillin-streptomycin double antibody (Gibco).

Differentiation (DIF) I (days 0-4), cells were cultured in DIF I medium, which included erythrocyte differentiation basal medium (EDM), 1. mu.M DEX (Sigma), 5ng/mL IL-3 (from nearshore protein technology, Inc.), 100ng/mL SCF (from nearshore protein technology, Inc.), 6U/mL EPO (from nearshore protein technology, Inc.), 100nM gw7647 (Sigma); differentiation (DIF) II (days 5-8), cells were cultured in DIF II medium, which included erythroid differentiation basal medium (EDM), 50ng/mLSCF (from near-shore protein technology, Inc.), 6U/mL EPO (from near-shore protein technology, Inc.), 10nM gw7647 (Sigma); differentiation (DIF) III (days 9-16), cells were cultured in DIF III medium, which included erythroid differentiation basal medium (EDM) and 2U/mL EPO (available from nearshore protein technologies, Inc.).

Example 6: measurement of HbF expression level

6.1 flow cytometry detection of the proportion of HbF-Positive erythrocytes

(1) The method comprises the steps of adopting differentiated erythrocytes as experimental materials, marking erythrocyte groups with PE-CD71 antibody (Invitrogen) and PB-CD235a antibody (Invitrogen) after the differentiated erythrocytes are stained and fixed, performing cell membrane rupture, adding APC-HbF monoclonal antibody (Invitrogen), and performing flow analysis on a computer to detect the expression condition of HbF.

The results of the grnas of the respective experimental groups editing BCL11A gene and the unedited CD34+ cells differentiating into HbF-positive erythrocytes by performing flow assay on the differentiated erythrocytes are shown in fig. 1 to 7, and specifically, the ratios of HbF-positive erythrocytes of the experimental groups a to g are shown in table 6.

TABLE 6 proportion of HbF-positive erythrocytes in experimental groups a-g

The above results indicate that the ratio of differentiation of CD34+ cells into HbF-positive erythrocytes was greater than 65% after BCL11A gene edited by gRNA according to the present invention.

6.2 HPLC detection of HbF expression level

(1) Sample treatment:

collecting 1 × 107 cells by using erythroid differentiated cells as experimental materials, washing with PBS, and lysing for 10min on 100 μ L of 0.01% SDS ice; 12000rpm, centrifuging for 5min, taking 20 μ L of supernatant, adding into 80 μ L of mobile phase A, and incubating on ice for 30 min;

(2) HPLC detection conditions of HbF:

a chromatographic column: PolyLC Inc. item #3.54CT0315

Sample loading amount: 20 μ L

Flow rate: 1.2mL/min

Mobile phase A: 20mM bis-tris +2mM KCN, pH 6.9

Mobile phase B: 20mM bis-tris +2mM KCN +200mM NaCl, pH 6.57

Ultraviolet detection wavelength: 415nm

Direct quantification of hemoglobin was performed by integrating the area under the HbF peak. The ratio of the peak area of HbF expressed in erythrocytes differentiated from CD34+ cells with or without the edited BCL11A gene in experimental groups a-g to the total peak area is shown in Table 7, and the HPLC detection results of HbF expressed in erythrocytes differentiated from CD34+ cells with or without the edited gRNA-1 and gRNA-2 are shown in FIGS. 8 and 9.

TABLE 7 ratio of peak area of HbF expressed in erythrocytes after differentiation of CD34+ cells to total peak area in experimental groups a-g

The erythrocytes differentiated from CD34+ cells in experimental groups a-g exhibited HbF/(HbF + HbA) ratios as shown in Table 8.

TABLE 8 HbF/(HbF + HbA) ratios of red blood cells after differentiation of CD34+ cells in experimental groups a-g

Numbering	HbF/(HbF+HbA)
		a	21.9％
b	23.2％
		c	20.8％
d	20.9％
		e	18.9％
f	18.1％
		g	17.4％

The above results show that the erythrocytes differentiated from the CD34+ cells after editing the BCL11A gene by the gRNA of the present invention exhibit HbF/(HbF + HbA) ratios of 15% or more, specifically, in the range of 15% to 45%.

Example 7: effect of unmodified gRNA and modified gRNA on efficiency of BCL11A Gene editing

In contrast to the experimental group, in which grnas were used to edit BCL11A gene, the grnas used in the control group were custom-made modified grnas, and the methods for modifying grnas were as follows: the 3 nucleotides at the 5 ' end of the grnas used in the experimental groups were modified by 2' -O-methylation and internucleotide 3 ' -phosphorothioate. As shown by the following chemical modifications, the left side is the chemically modified gRNA and the right side is the unmodified gRNA. After RNP complexes were prepared in vitro with modified grnas and Cas9, hematopoietic stem/progenitor cells were transfected by electroporation and editing efficiency was tested. Experiments demonstrated that unmodified grnas had higher editing efficiency, detailed in table 9:

TABLE 9 Effect of unmodified gRNAs and modified gRNAs on BCL11A Gene editing efficiency

Numbering	gRNA forms	Efficiency of editing
			Experimental group a	Unmodified gRNA-1	60.5％
Experimental group b	Unmodified gRNA-2	62.2％
			Control group 1	Modified gRNA-1	53.4％
Control group 2	Modified gRNA-2	56.0％

Example 8: effect of gRNA introduction into hematopoietic Stem/progenitor cells by electroporation of RNP Complex and packaging of lentiviruses on Gene editing efficiency

In contrast to experimental groups a and b (in which grnas of experimental groups a and b were used to introduce grnas into hematopoietic stem cells by electroporation transfection), control groups 3 and 4 (corresponding to grnas of experimental groups a and b) introduced grnas (gRNA-1 and gRNA-2) into hematopoietic stem/progenitor cells in a lentivirus-packaged manner were used to edit the BCL11A gene. Specifically, a packaging plasmid and a lentiviral vector carrying a CRSPR/Cas9 gene and a gRNA sequence are co-transfected into 293T cells by a liposome method, the lentiviral vector is obtained from supernatant, and the lentiviral vector and the hematopoietic stem/progenitor cells are co-cultured to obtain the infected hematopoietic stem/progenitor cells. The method comprises the following specific steps:

(1) digestion and dephosphorylation of 5ug lentiviral CRISPR plasmid (e.g., LentiCRISPRV2, Addgene) with BsmBI (NEB) for 30min at 37 ℃;

(2) gel-purifying the digested plasmid using a gel extraction kit (Thermo) and eluting in water;

(3) phosphorylate and anneal each pair of oligonucleotides:

the phosphorylation/annealing reaction was placed in the PCR instrument using the following parameters:

30 minutes at 37 ℃;

95 ℃ for 5 minutes, and then reducing the temperature to 25 ℃ at the speed of 5 ℃/min;

(4) annealing the oligonucleotide of step (3) in a 1: diluting with 200% of dilution ratio to sterile water or EB;

(5) ligation was set up and incubated overnight at 16 ℃:

(6) transformation clone competent DH5 α (all gold);

(7) sending the grown clones to sequencing, and selecting correct clones to perform subsequent experiments;

(8) carrying out large-scale plasmid extraction on the correct clone for slow virus packaging;

(9) to produce lentiviruses, HEK293T cells were cultured with dmem (Gibco) supplemented with 10% fbs (Gibco) and 1% penicillin-streptomycin (Gibco) and passaged in 15 cm tissue culture dishes;

(10) lentivirus was packaged by lipofection (Lipofectamine3000(Thermo)), inoculated to 70-90% confluence, and transfected using Opti-MEM^TM(Gibco) medium dilution plasmid containing 13.3mg of psPAX2 (addge), 6.7mg of VSV-G (addge) and 20mg of the lentivirus-constructed plasmid of interest, lentiviral supernatants collected at 48 and 72 hours after transfection, and concentrated by ultracentrifugation at 4 ℃ and 24,000rpm for 2 hours;

(11) after lentiviral titer detection by qPCR, erythroid differentiation was performed after infection of CD34+ cells, and the editing efficiency and HbF expression were determined.

The editing efficiency was checked as described in example 3. Experiments show that the efficiency of gene editing for introducing gRNA into hematopoietic stem/progenitor cells by adopting RNP complex is higher than that by packaging lentivirus, and the details are shown in Table 10:

TABLE 10 influence of introduction of gRNA into hematopoietic stem/progenitor cells by electroporation of RNP complexes and packaging of lentiviruses on Gene editing efficiency

Numbering	Means for introducing gRNA	Efficiency of editing
			Experimental group a	RNP	60.5％
Experimental group b	RNP	62.2％
			Control group
3	Lentivirus (lentivirus)	49.3％
			Control group
4	Lentivirus (lentivirus)	51.8％

Example 9: influence of different molar ratios of endonuclease Cas9 and gRNA on gene editing efficiency of CD34+ cells and positive rate of HbF in differentiated erythrocytes

By repeating the steps of examples 1-6, using gRNA-1 to edit BCL11A gene, unlike experimental group a, example groups 5-10 (using gRNA of experimental group a) varying the endonuclease Cas9 to gRNA-1 molar ratio, demonstrated by experiments that gene editing efficiency was high at the ratios described in the present invention, and that HbF positivity of erythrocytes into which the edited hematopoietic stem/progenitor cells were finally differentiated was high, as detailed in table 11:

TABLE 11 influence of different molar ratios of Cas9 and gRNA-1 on the editing efficiency of BCL11A gene and positive rate of HbF in red blood cells differentiated therefrom

The present invention has been illustrated by the above embodiments, but it should be understood that the above embodiments are for illustrative and descriptive purposes only and are not intended to limit the invention to the scope of the described embodiments. Furthermore, it will be understood by those skilled in the art that the present invention is not limited to the embodiments described above, and that many more modifications and variations are possible in light of the teaching of the present invention and are within the scope of the invention as claimed. The scope of the invention is defined by the appended claims and equivalents thereof.

Sequence listing

<110> Ganli pharmaceutical industry Co., Ltd

<120> method for editing BCL11A gene in hematopoietic stem/progenitor cells

<160> 14

<170> SIPOSequenceListing 1.0

<210> 1

<211> 20

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

uuaguucccc guacccauca 20

<210> 2

<211> 20

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

gacuagguag accuucauug 20

<210> 3

<211> 20

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

aguugcacaa ccacguaguu 20

<210> 4

<211> 20

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

uauuuuccuu gauggguacg 20

<210> 5

<211> 20

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

ucugucagac uuuaccaacc 20

<210> 6

<211> 20

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

auaugugaag cccaacuacg 20

<210> 7

<211> 67

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

agcauagcaa guuaaaauaa ggcuaguccg uuaucaacuu gaaaaagugg caccgagucg 60

gugcuuu 67

<210> 8

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

tgtcacatgc tgtgctggta 20

<210> 9

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

agaactcggc atgaagggta 20

<210> 10

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

ccaaaagtgt ccatgtttgc t 21

<210> 11

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

cctaaaaggg aagttatttt tcca 24

<210> 12

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

ccctctggca tcaaaatgag 20

<210> 13

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

tttgaaagta ccagcacagc a 21

<210> 14

<211> 1369

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

actccttaag ccatcattcc agagctccac aatccaactc caattttcta ttccagtctt 60

agttccccgt acccatcaag gaaaatattc tgcccaagta aaaatccctt ccgttctcat 120

ttccttcctg gcttttcttc ttcttctctt acctcctgga atcctgctca tacttcaagg 180

cctcaatgaa ggtctaccta gtcaccttag caagaagaat caatctcatc cttctccaac 240

ctcatagaac actcatccca tgcaccactc cctgactcat atctaggcct tacattgctg 300

gttaaccctc tatgcctcta attaatttca tgtgttccca atgagtttct tcaatacagg 360

gactctttct cctacttgct tctattatat ttgaaagtac cagcacagca tgtgacatga 420

tattcatata ttctaggaat tcaacaaata gcatataaat gactgattta ccttcctaaa 480

agggaagtta tttttccaaa tatcatttct gttcaaaatg gtaattttaa ccttcttagc 540

acccacaaac atttcccttc tgatatctac ttgaactttc agataaaaaa aaaaaagcaa 600

gttgcagtaa catgttatgc tacacaaaga ttagcatgaa tatccaccct ctttaaacag 660

ccaccccaca ccctggagaa gagcaaatgt gaagtttatg tgccaaccag actgtgcgcc 720

aggttggtaa agtctgacag agttaccaaa aaatgacaac atcttctata tgtgaagccc 780

aactacgtgg ttgtgcaact ctatagctga ctttcaacca tggtcatctg caaagaagtt 840

agtctcagcc acctgcgcat cctcaatgca aaaagctaag ttctaaaaac gtattcttaa 900

tgctgtttta aatgcagcac tactaaaaag gacctcattt tgatgccaga gggcagcaaa 960

catggacact tttggccccc ttcagctatt aagtacagta aaaggaagtc ctaactatca 1020

tttgaaatgc tcccggccag gcgctgtggc tcacacctgt aatcccagca ctttgggagg 1080

ccggggcagg aggatcacct gaggtcagga gttcaagatc agtttggaca acacagtgaa 1140

accccgtctc tactaaaaat acaaaattag ccgggcatgg taatacatgc ctgtaatctc 1200

agctactcgg gaggctgagg caggagatcg cttgaacctg ggaggcagaa gatgcagtga 1260

gccgagatcg cgccattgca ttccagcccg ggcaacaaga gtaaatctcc gtctcaccaa 1320

aaaaagaaaa aagaaaaaaa aaaaaaagaa agaaatgctc ccctcagtt 1369

Claims

1. A method of editing BCL11A gene in a hematopoietic stem/progenitor cell, comprising:

introducing one or more grnas targeting the BCL11A gene enhancer +62 position and one or more endonucleases into the cell;

wherein the BCL11A enhancer +62 bit sequence is set forth in SEQ ID NO 14, and the gRNA comprises crRNA and tracrRNA.

2. The method of claim 1, wherein the crRNA comprises a leader sequence that pairs with the target DNA, the leader sequence selected from the group consisting of

a.SEQ ID NO:1，

b.SEQ ID NO:2，

c.SEQ ID NO:3，

d.SEQ ID NO:4，

e.SEQ ID NO:5，

f.SEQ ID NO:6，

3. The method of claim 1 or 2, wherein the guide sequence of the crRNA is selected from the group consisting of

1 or 2 of SEQ ID NO,

or SEQ ID NO 1 or SEQ ID NO 2, wherein 1 to 4 bases are optionally added or deleted at the 5 'or 3' end of SEQ ID NO 1 or SEQ ID NO 2, preferably, the added or deleted bases are complementary to the bases at the corresponding positions of the target DNA.

4. The method of any one of claims 1-3, wherein the endonuclease is selected from the group consisting of Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Csy 7, Cse 7, Csc 7, Csa 7, Csn 7, Csm 7, Cmr 7, Csm 7, Csb 7, Csx 7, Csf, Csx 7, Csx 7, Csx, a mutant forms, or a mutant forms thereof, or a mutant forms thereof, and a recombinant form of a mutant form of the nucleic acid, or a recombinant form thereof, or a mutant form thereof, and a mutant form thereof, or a recombinant nucleic acid thereof, and a mutant form thereof, wherein said nucleic acid thereof, preferably a mutant form thereof.

5. The method of any one of claims 1 to 4, wherein the tracrRNA has the sequence shown in SEQ ID NO. 7, or a nucleotide sequence which has the same function as SEQ ID NO. 7 and is formed by replacing, deleting and/or optionally adding 1-4 bases from the 5 'end to the 3' end of the tracrRNA.

6. The method of any one of claims 1-5, the gRNA is not 2 '-O-methylated and/or internucleotide 3' phosphorothioate modified.

7. The method of any one of claims 1-6, comprising pre-mixing the endonuclease with the gRNA to form one or more RNP complexes.

8. The method of any one of claims 1-7, wherein the one or more RNP complexes are delivered into the hematopoietic stem/progenitor cells by electroporation transfection.

9. The method of claim 7, wherein the molar ratio of endonuclease to gRNA in the RNP complex is 1 (04-5.5), preferably the molar ratio of endonuclease to gRNA in the RNP is 1 (1-2.5).

10. The method according to any one of claims 1 to 9, wherein the hematopoietic stem/progenitor cells are mammalian cells, primate cells, preferably primate cells, and further preferably human cells.

11. A method of increasing HbF expression of hematopoietic stem/progenitor cells following erythroid differentiation, comprising the steps of:

1) editing the BCL11A gene of a hematopoietic stem/progenitor cell using the method of any one of claims 1-10;

2) differentiating the hematopoietic stem/progenitor cells of step 1).

12. A hematopoietic stem/progenitor cell obtained by the method of any one of claims 1-10 and which differentiates into erythrocytes exhibiting a HbF/(HbF + HbA) ratio of 15% or more, preferably between 15% and 45%.

13. Use of the cell of claim 12 for the manufacture of a medicament or medical article for increasing HbF expression in a mammal (preferably a human).

14. Use of the cell of claim 12 for the preparation of a medicament or medical product for the prevention or treatment of anemic disorders, blood loss disorders, tumors or other disorders requiring massive blood transfusions for prevention or treatment, preferably the anemia disorder is beta thalassemia or sickle cell anemia.

15. One or more guide ribonucleic acids (gRNAs) for editing BCL11A gene of hematopoietic stem/progenitor cells, the gRNAs comprising a crRNA and a tracrRNA, the guide sequence of the crRNA being selected from the group consisting of

a.SEQ ID NO:1，

b.SEQ ID NO:2，

c.SEQ ID NO:3，

d.SEQ ID NO:4，

e.SEQ ID NO:5，

f.SEQ ID NO:6，

a-f, wherein 1-4 bases are optionally added or deleted at the 5 'end or the 3' end of the DNA, and preferably, the added or deleted bases are complementary with the bases at the corresponding positions of the target DNA;

the sequence of the tracrRNA is shown as SEQ ID NO. 7, or a nucleotide sequence which is formed by replacing, deleting and/or optionally adding 1-4 bases at the 5 'end or the 3' end and has the same function with the SEQ ID NO. 7.

16. The gRNA of claim 15, which is not 2 '-O-methylated and/or internucleotide 3' phosphorothioate modified.

17. A kit comprising the gRNA of any one of claims 15 and one or more endonucleases selected from the group consisting of Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5 (also referred to as Csn 5 and Csx 5), Cas5, Csy 5, Cse 5, Csc 5, Csa5, Csn 5, Csm5, Cmr5, Csb 5, Csx 5, a5, Csx 363672, Csx 5, a 363636363672, a mutant forms, a mutant forms, or a mutant forms thereof, or a recombinant forms thereof, or a forms thereof, and a forms thereof, or a version thereof, and a version thereof, or a version thereof, wherein said nucleic acid, or a mutant forms thereof, or a version thereof, or a mutant or a version thereof, wherein said nucleic acid, or a version thereof, or a5, wherein said nucleic acid, or a version thereof, wherein said nucleic acid, or a version thereof, and a5, or a mutant, or a version thereof; more preferably, the endonuclease is Cas 9.

18. The kit of claim 17, wherein the kit is used for treating or preventing a anemia disorder, a blood loss disorder, a tumor or other disorder requiring bulk transfusion for prevention or treatment in a subject.

Use of a BCL11A gene fragment as a target for designing a medicament for increasing hemoglobin levels in a subject, the BCL11A gene fragment selected from the group consisting of sequences fully complementary to:

a.SEQ ID NO:1，

b.SEQ ID NO:2，

c.SEQ ID NO:3，

d.SEQ ID NO:4，

e.SEQ ID NO:5，

f.SEQ ID NO:6，