CN114149976A

CN114149976A - Eukaryotic cell S-adenosylmethionine concentration perception fluorescence reporting system

Info

Publication number: CN114149976A
Application number: CN202111427318.4A
Authority: CN
Inventors: 高倩倩; 张婷婷; 艾宜岑; 杨博; 徐策; 房璐; 徐君琴; 曾家鑫; 吴谦
Original assignee: Tongji University
Current assignee: Tongji University
Priority date: 2021-11-26
Filing date: 2021-11-26
Publication date: 2022-03-08
Anticipated expiration: 2041-11-26
Also published as: CN114149976B

Abstract

The invention belongs to the field of biochemical detection, and relates to a eukaryotic cell S-adenosylmethionine concentration perception fluorescence report system, which fills the technical blank of SAM concentration sensitive detection in living cells, and simultaneously realizes the screening of functional genes for regulating SAM metabolism. Firstly, a SAM perception system of eukaryotic cells constructed by utilizing AAVS1 fixed-point insertion based on the binding preference of MetJ repressor protein and met-box sequence in the methionine metabolic pathway of Escherichia coli is disclosed. The method mainly comprises the following steps: s1: determining a met-box sequence which can reflect SAM concentration in real time from the candidate sequences bound by the MetJ protein, and screening a preferred sequence; s2: inserting a fluorescence report sequence at a fixed point by using AAVS1 to obtain an allele dual-fluorescence report system; s3: and (3) composing the MetJ protein and the Cas9 protein into a report system to obtain a double-fluorescence report system with a sensible SAM concentration. The invention provides a real-time sensing fluorescence reporting system for the SAM concentration of eukaryotic cells, which can be used for detecting the SAM concentration in living cells and screening related genes for regulating SAM metabolism.

Description

Eukaryotic cell S-adenosylmethionine concentration perception fluorescence reporting system

Technical Field

The invention belongs to the field of biochemical detection, and particularly relates to a real-time sensing fluorescence reporting system for the concentration of S-adenosylmethionine of eukaryotic cells.

Background

In the methionine cycle, SAM has an important role. Methionine Adenosyltransferase (MAT) catalyzes the formation of SAM from methionine and ATP, and during the transmethylation reaction, the methyl group of SAM is transferred to different biological receptors and converted into S-adenosylhomocysteine (SAH). SAH is further converted to homocysteine (Hcy) and adenosine by the action of hydrolases. Homocysteine has two fates: is either re-methylated to regenerate methionine or enters the transsulfuration pathway to be converted into cysteine and alpha-ketobutyrate. From a physiological perspective, SAMs act as methyl donors and are involved in DNA, RNA, and protein methylation. The methyl group can be transferred into C, S, N and O atoms and participate in the synthesis and metabolism process. In addition, the synthesis of various sulfur-containing substances can not be assisted by SAM, under the influence of sulfur transfer, SAM can generate a large amount of cysteine, and the cysteine is converted into glutathione through metabolism, and the glutathione is a sulfur storage bank of a human body. After the SAM is subjected to decarboxylation reaction, polyamine such as putrescine, spermidine, spermine and the like is formed after decarboxylation treatment in production, and tissue growth is promoted. Under the influence of transmethylation, SAM can promote the methylation of phospholipid and regulate the flow of cell membrane, and in the transmethylation pathway, the generated GSH is the main antioxidant of cells. Polyamine formed by decarboxylation of SAM can promote cell regeneration, and the absence of polyamine can affect normal cell division and DNA synthesis.

SAM is an important intermediate metabolite in all cells, and plays a central role in methyl and propylamine biotransformation. In E.coli, MetJ acts as an inhibitor, which controls the expression of genes involved in methionine biosynthesis and transport. Binding of SAM to MetJ modulates MetJ function in cells. When methionine is abundant, SAM accumulation promotes the formation of SAM-MetJ-protein complexes, two MetJ dimers bind to the DNA duplex, inhibiting expression of genes for Met biosynthesis and transport. Researchers have demonstrated different binding capacity of MetJ to different met-boxes at different concentrations of SAM in vitro E.coli experiments, which showed that the methionine metabolism mechanism in E.coli is equally reliable in vitro (Augusts AM, Sage H, spacer LD. binding of MetJ repressor to specific and specific DNA and effect of S-adenosylmethionine on the interaction. biochemistry.2010; 49(15): 3289; 3295.). Although many advances have been made in the study of methylation modification, the overall understanding of the gene network cluster involved in methylation modification is not complete, and there is a gap to be studied in the formation of related diseases and the selection of therapeutic targets.

The development and treatment of many diseases are associated with SAM dysregulation, such as Alzheimer's disease, depression, HIV-related neurological dysfunction/dementia, multiple sclerosis, Parkinson's disease, chronic liver dysfunction, arteriosclerosis, and cancer. Research shows that; the disbalance of SAM supply can cause the gene expression of liver cells to change, and liver cancer is caused. SAM is a methyl donor for a variety of methylation reactions in the brain, including methyl reactions involved in neurotransmitter metabolism, and is associated with a deficiency in neurotransmitters and depression, and elevated levels of homocysteine can cause Alzheimer's disease. In addition, SAM and tumor is closely related. The tumor is marked by hypomethylation, the SAM concentration is reduced, and the occurrence of tumors can be inhibited to a certain extent by increasing the SAM concentration.

Disclosure of Invention

The balance of SAM supply in the body is very important, but SAM concentration measurement in living cells is still blank. The technical scheme of the invention provides a system for sensing the concentration of the SAM of the eukaryotic cell in real time by combining an escherichia coli methionine metabolism regulation mechanism, AAVS1 allele site-specific insertion, transcriptomics analysis and the like, and simultaneously obtains a system for screening related genes for regulating the SAM metabolism by a whole genome, thereby providing a basis for exploring potential genes related to SAM circulation and disease formation.

The inventor finds a safe and sensitive method suitable for detecting SAM concentration in a body, and the finding provides a research basis for further exploring SAM metabolic disorder related disease treatment gene targets.

The nucleotide sequence of the candidate sequence is shown as SEQ ID NO 1-10, namely shown in Table 1; the nucleotide sequences of the preferred sequences are shown in SEQ ID NO. 4 and SEQ ID NO. 9, i.e., the 3nat and NS44 sequences in Table 1.

Specifically, the technical scheme of the invention is as follows:

the invention discloses a system for sensing the concentration of SAM (SAM) of eukaryotic cells in real time, which is characterized in that the construction method comprises the following steps:

(1) respectively constructing AAVS1_ Hygro _ CMV _3nat _ EGFP and AAVS1_ Hygro _ CMV _ NS44_ RFP vectors, specifically shearing the AAVS1 site on the human chromosome 19 by using a CRISPR-Cas9 system, and integrating two donor fragments into the safety site on the genome; the 3nat sequence is SEQ ID NO. 4, and the NS44 sequence is SEQ ID NO. 9.

Realizing allele fixed-point insertion by screening hygromycin B drugs, and obtaining a cell line with fixed-point insertion by RCR identification and DNA sequencing;

(2) in the cell line, through the virus packaging system, over-expression KRAB MetJ expression vector, so as to construct SAM concentration perception double fluorescence report system.

Further, the cell line is HEK 293T.

Further, the method for constructing the virus packaging system in the step (2) is as follows: the cell line was infected with lentivirus generated after culturing by three plasmid transacclimatization of KRAB MetJ-PCW57.1 plasmid with P/G plasmid, VSVG plasmid.

The second aspect of the invention discloses a SAM concentration detection kit, which is characterized by comprising the system for sensing the SAM concentration of the eukaryotic cell in real time.

The third aspect of the invention discloses a method for screening genes for regulating SAM metabolism, which is characterized by comprising the following steps:

constructing a cell line for stably expressing the Cas9 protein according to the system for sensing the concentration of the SAM of the eukaryotic cells in real time, and screening in a whole genome range by using a GeCKO lentivirus library;

knocking out genes after infecting a sgRNA plasmid library by viruses, obtaining different clusters by flow cell sorting, specifically amplifying gene sequence information of the different clusters by PCR, obtaining the enriched sgRNA sequence information and the corresponding genes thereof by deep sequencing analysis and comparison of PCR amplification sequences of cells obtained by functional screening and enrichment and untreated stock library cells, and sequentially obtaining potential genes for regulating and controlling SAM metabolism.

The fourth aspect of the invention discloses a KRAB MetJ expression vector.

In a fifth aspect of the invention, the 3nat and NS44 sequences are used for constructing a system for sensing the SAM concentration of the eukaryotic cell in real time.

Compared with the prior art, the invention has the innovation points that:

1) the mechanism of methionine metabolism in escherichia coli and the characteristic of metJ repressor protein specific binding to met-box sequence preference are initially focused, and a safe and reliable eukaryotic cell SAM concentration perception fluorescence reporting system is established by combining AAVS1 fixed-point insertion and can be used as a monitor for SAM concentration in living cells.

2) At present, large-scale gene screening provides an important tool for analyzing potential gene functions and pathways in biological processes and human diseases, can screen drug targets, sensitivity-enhancing genes, drug-resistant genes and the like, and can also perform multi-target synergistic action research. The invention starts from MetJ repression regulation, combines deep sequencing and bioinformatics analysis means, establishes a system for screening SAM metabolism regulation genes at high flux, and provides targets for exploring potential genes related to SAM circulation and treating diseases.

Drawings

FIG. 1 shows that KRAB MetJ's inhibition of the transcriptional capacity of 3nat and NS44 was methionine concentration dependent as probed by dual luciferase reporter genes, where A shows KRAB MetJ's inhibition of 3nat-met box binding and B shows KRAB MetJ's inhibition of NS44-met box binding. In the figure, "Promoter activity" means "relative luciferase activity" and "Met" means "methionine".

FIG. 2 shows the change in the fluorescence expression intensity of EGFP or RFP from cells overexpressing KRAB MetJ at different SAM concentrations. Wherein EGFP fluorescence represents the change in fluorescence upon binding of KRAB MetJ to the 3nat-met box and RFP fluorescence represents the change in fluorescence upon binding of KRAB MetJ to the NS44-met box, the change in fluorescence being detected by flow cytometry analysis.

FIG. 3 shows the change in the fluorescence expression intensity of EGFP or RFP from cells overexpressing KRAB MetJ at different methionine concentrations. Wherein EGFP fluorescence represents the change in fluorescence upon binding of KRAB MetJ to the 3nat-met box and RFP fluorescence represents the change in fluorescence upon binding of KRAB MetJ to the NS44-met box, as detected by flow cytometry analysis.

FIG. 4 shows the change in fluorescence following SAM concentration-sensing cellular knock-out of MAT2A (SAM synthetase), where MAT2A-sg control is the control group and MAT2A-sg2 is the MAT2A targeted knock-out.

FIG. 5 shows the results of whole genome library screening enrichment.

Fig. 6 shows the whole construction process of the SAM concentration sensing system.

FIG. 7 shows the authentication strategy in example 2;

FIGS. 8 and 9 are AAVS1 vectors constructed in example 2;

FIG. 10 is the KRAB MetJ-PCW57.1 inducible plasmid constructed in example 2;

FIG. 11 is a diagram of: PGl3 SV 403 nat plasmid constructed in the luciferase reporter system of example 1;

FIG. 12 is a diagram: PGl3 SV40 NS44 plasmid constructed in the luciferase reporter system of example 1;

FIG. 13 is a graph of: pcdna3.1 KRAB MetJ expression plasmid constructed in the luciferase reporter system of example 1.

Detailed Description

The invention is further illustrated by the following examples, which are not intended to limit the scope of the invention. The experimental methods without specifying specific conditions in the following examples were selected according to the conventional methods and conditions, or according to the commercial instructions.

The instruments, equipment, reagents used in the examples are available from various sources, for example, purchased, or may be prepared.

The candidate sequences, 3nat and NS44 sequences described herein are from Augustus AM, Sage H, spacer LD.binding of MetJ pressure to specific and generic DNA and effect of S-adenosylmethyl on the same interactions.2010 Apr; 49(15), 3289 and 3295. the candidate sequence is shown in SEQ ID NO 1-10.

The primer sequence of step 1 in embodiment 1 of the invention:

SEQ ID NO:11:Ecoli-MetJ-F：ATGGCTGAATGGAGCGGCGAATA

SEQ ID NO:12:Ecoli-MetJ-R：TTAGTATTCCCACGTCTCCG

primers designed in step 2 of example 1:

SEQ ID NO:13：

809F1:GTACCGAGCTCGGATCCGCCACCATGGACTATAAGGACGACGACGACAAGgggttggtgtcctttgagga

SEQ ID NO:14：

809R1:TGATATATTCGCCGCTCCATTCAGCacctgggaggctcctgcttgaagcttctgctaggctccatggcccaaatccac

homologous recombination primers of step 2 in example 1:

SEQ ID NO:15：

KRAB-metJ-F1:cttcaagcaggagcctcccaggtGCTGAATGGAGCGGCGAATATATCAGC

SEQ ID NO:16：

KRAB-metJ-R1:GGCCCTCTAGACTCGAGCGGCCGCtTTAGTATTCCCACGTCTCCGGG

primer sequence for step (1) in example 2:

17- -primer CMV-F1: ttgcggattaatggtAATTCGTGATGCGGTTTTGGCAGTA

18- -primer CMV-3 nat-R1: gGAtGTtaAGgCaTCcAGACGTCTAGCTCTGCTTATATAG

19- -primer CMV-3 nat-R2: GCTTTACCAACAGTACCGGAATGCCAAGCTTgGAtGTtaA

20-primer 3nat-EGFP-F1: TCCGGTACTGTTGGTAAAGCCACCGCCACCATGGTGAGCAAGGG SEQ ID NO

SEQ ID NO:21- -primer 3nat-EGFP-R1: GAAGCGGCCGGCCGCCCCGACTCTAGAATTACTTGTACAGCT

SEQ ID NO:22—

Primer CMV-NS 44-R1: cagCGTaTgGgCtgaTAtAttcgccGctccaTtcAgccaTAGCTCTGCTTAT

SEQ ID NO:23—

Primer CMV-NS 44-R2: GCGGTGGCTTTACCAACAGTACCGGAATGCCAAGCTTAcagCGTaTgG

SEQ ID NO:24—

Primer NS44-RFP-F1: TGTTGGTAAAGCCACCGCCACCatggtgagcaagggcgagga

SEQ ID NO:25—

Primer NS44-RFP-R1: AGCGGCCGGCCGCCCCGACTCTAGAATtacttgtacagctcg

The primer sequence required by the KRAB MetJ-PCW57.1 plasmid constructed in example 2 is as follows;

PCW_Blast_F1：GAATTGGCTAGCGAATTCATGGAGCAGAAGCTGATCTCAGAGG(SEQ ID NO:26)

PCW_Blast_R1：acacaacatatccagtcactatggtcgacTTAGTATTCCCACGTCTCCGG(SEQ ID NO:27)

PCW_Blast_F2：CCCGGAGACGTGGGAATACTAAgtcgaccatagtgactggatatgttgtgt(SEQ ID NO:28)

PCW_Blast_R2：CTCCGTCGTGGTCCTTATAGTCCATAGATCTggtgaattgctggg(SEQ ID NO:29)

PCW_Blast_F3：cccagcaattcaccAGATCTATGGACTATAAGGACCACGACGGA(SEQ ID NO:30)

PCW_Blast_R3:ttgagacaaaggcttggccatagggccgggattctcctccacg(SEQ ID NO:31)

PCW_Blast_F4：cgtggaggagaatcccggccctatggccaagcctttgtctcaa(SEQ ID NO:32)

PCW_Blast_R4:ctttgctcttgtccagtctagacattggaccagggttttcttcaacatcaccacaagtgaggagaga(SEQ ID NO:33)

MAT2A sgRNA sequence in step (3) of example 2: TGAACACCTTGAGCAATATC (SEQ ID NO:34)

Example 1: based on the met-box sequence that MetJ protein can bind in E.coli, the sequence that both bind with SAM concentration dependence was identified in eukaryotic cells.

Firstly, the purpose is as follows: method for identifying preferred met-box

Second, method

1. Coli genome DNA was extracted, primers (SEQ ID NO: 11-12) were designed to amplify the complete sequence region of metJ, and constructed on PCdna3.1 plasmid to enable normal expression. Then inserting candidate Metbox in front of a firefly luciferase reporter gene vector promoter to construct a Metbox luciferase reporter plasmid. The MetJ expression plasmid, Metbox luciferase reporter plasmid and renal luciferase expression plasmid were co-expressed in 293T cells using a vigofect high efficiency transfection reagent. After 6h of transient transformation, the cells were treated with the solution change, and after culturing the cells for 36h with different concentrations of methionine (0mM, 0.02mM, 0.2mM, 2mM), the binding ability of MetJ to Metbox was investigated by the detected enzyme activity of luciferase by treating the cells with a dual-luciferase reporter assay kit (promega11402ES 80).

2. Designing a primer (the sequence is shown as SEQ ID NO: 13-14) to amplify to obtain the KRAB structural domain sequence of ZFP809, and then designing a homologous recombination primer (the sequence is shown as SEQ ID NO: 15-16) by using an In-Fusion seamless cloning method to obtain the KRAB-MetJ-PCdna3.1 Fusion expression plasmid. The KRAB-MetJ expression plasmid, the Metbox luciferase reporter plasmid and the renal luciferase expression plasmid were co-expressed in 293T cells using a vigofect high efficiency transfection reagent. After a transient period of 6h, the cells were subjected to a fluid change treatment and cultured using different concentrations of methionine (0mM, 0.02mM, 0.2mM, 2 mM). After the cells are cultured for 36h, the cells are treated by a dual-luciferase reporter gene detection kit (promega11402ES80), and whether the inhibition effect of the KRAB MetJ protein combined with Metbox has methionine concentration dependence is researched according to the detected enzyme activity of luciferase.

Third, result and discussion

Through literature discovery, we obtain Met-box sequences capable of binding to MetJ and perform reporter gene detection on the MetJ-box sequences in HEK293T cells, and we observe that the binding of MetJ protein and Metbox cannot produce obvious inhibition effect. Furthermore, in zinc finger proteins comprising a zinc finger domain and a KRAB domain, the zinc finger domain is responsible for recognition and binding to the DNA binding region, and the KRAB domain can amplify the inhibitory effect of binding. The results of the reporter genes showed that KRABMetJ had significant binding capacity to 3na-Met box and NS44-Met box after introduction of KRAB protein, which inhibits the signal amplifier, and that KRAB MetJ had significant methionine concentration dependence on the binding capacity of 3na-Met box and NS44-Met box (FIGS. 1A and 1B), whereas the control group of ZNF809 containing KRAB protein did not show this, which indicates feasibility of achieving the E.coli methionine repression mechanism in eukaryotic cells.

The candidate sequences are shown in Table 1.

TABLE 1 candidate met-box sequences binding to MetJ protein (SEQ ID NOS: 1 to 10)

Example 2: SAM (SAM) perception system for constructing eukaryotic cells by utilizing AAVS1 fixed-point insertion

Firstly, the purpose is as follows: SAM concentration dependency of KRAB MetJ binding ability to 3na-Met box and NS44-Met box in eukaryotic cells

Secondly, the method comprises the following steps:

(1) providing preferred Met-box sequences (3na and NS44) obtained according to the method, designing primers (the sequences are shown as SEQ ID NO: 17-25) to respectively construct AAVS1_ Hygro _ CMV _3na _ EGFP and AAVS1_ Hygro _ CMV _ NS44_ RFP vectors, specifically targeting AAVS1 site by using CRISPR-Cas9 technology, integrating two donor fragments into AAVS1 site on a genome, wherein the site is an open chromosome structure, ensuring that transferred RFP and EGFP genes can be normally transcribed under the drive of a promoter, realizing allele fixed-point insertion by hygromycin B (Hygromycin B) drug screening, and obtaining a cell line with fixed-point insertion by RCR identification and DNA sequencing, wherein the specific identification strategy is shown as figure 7.

(2) In the cell, a constructed KRAB MetJ-PCW57.1 induction plasmid is overexpressed through a virus packaging system, so that an SAM concentration sensing system is constructed, the KRAB MetJ protein can be transiently expressed after DOX induction is added, and a cell line stably expressing the KRAB MetJ is verified through a western experiment method. And (3) changing SAM concentration or methionine concentration in an organism in the over-expressed cells, and analyzing the relation between the change of RFP and EGFP fluorescence and the SAM concentration by flow analysis to investigate whether the cells can be used as a SAM concentration sensing system.

The virus packaging system construction method in the step (2) comprises the following steps: KRAB MetJ-PCW57.1 plasmid vs. P/G plasmid, VSVG plasmid 5: 3: 2, plasmid transient transformation was performed. After 48h, lentivirus is generated, the cell line is infected by the lentivirus, a cell line over expressing KRAB MetJ can be constructed, and a SAM concentration perception dual-fluorescence report system is constructed

The sequence of a primer required by the constructed KRAB MetJ-PCW57.1 plasmid is as follows;

PCW_Blast_F1：GAATTGGCTAGCGAATTCATGGAGCAGAAGCTGATCTCAGAGG

PCW_Blast_R1：acacaacatatccagtcactatggtcgacTTAGTATTCCCACGTCTCCGG

PCW_Blast_F2：CCCGGAGACGTGGGAATACTAAgtcgaccatagtgactggatatgttgtgt

PCW_Blast_R2：CTCCGTCGTGGTCCTTATAGTCCATAGATCTggtgaattgctggg

PCW_Blast_F3：cccagcaattcaccAGATCTATGGACTATAAGGACCACGACGGA

PCW_Blast_R3:ttgagacaaaggcttggccatagggccgggattctcctccacg

PCW_Blast_F4：cgtggaggagaatcccggccctatggccaagcctttgtctcaa

PCW_Blast_R4:ctttgctcttgtccagtctagacattggaccagggttttcttcaacatcaccacaagtgaggagaga

the method comprises the following specific steps: using Nhe1 and xba1 endonuclease to cut the PCW57.1 empty vector; the template is amplified using the corresponding primers. And recovering the required fragment and the enzyme digestion vector by using glue, connecting the vector with a plurality of fragments by using a seamless connection kit, and detecting after conversion to obtain the correct KRAB MetJ-PCW57.1 induced plasmid.

(3) MAT2A sgRNA plasmid is designed, a virus packaging system is used for infecting the cell, SAM synthetase MAT2A gene is knocked out in a targeted mode through drug screening, the fluorescence change condition is explored through flow analysis, and the sensitivity of the system is verified.

The steps of designing plasmids and packaging include: designing sgRNA by using a UCSC website CRISPR tool, inserting the constructed sgRNA fragment into the downstream of a corresponding plasmid U6 promoter, and carrying out MAT2A sgRNA sequence: TGAACACCTTGAGCAATATC, respectively;

sgRNA plasmid and P/G plasmid, VSVG plasmid at 5: 3: 2, plasmid transient transformation was performed. After 48h lentivirus was produced and used to infect the cell line.

Third, result and discussion

Through AAVS1 site-specific insertion, an AAVS1_ Hygro _ CMV _3na _ EGFP and AAVS1_ Hygro _ CMV _ NS44_ RFP double-fluorescence report system is constructed, and a cell line with EGFP and RFP fluorescence simultaneously expressed is obtained. By treating cells overexpressing the KRAB MetJ protein with different concentrations of SAM and methionine, we found that EGFP and RFP fluorescence show different trends, and that increased levels of SAM in vivo lead to different degrees of attenuation of EGFP fluorescence, while RFP fluorescence does not change (fig. 2 and 3). This indicates that binding of KRAB MetJ protein to 3na-Met box in eukaryotic cells is clearly SAM concentration dependent and may indicate intracellular SAM changes. And SAM was not synthesized in the MAT2A knockout cell line, and EGFP fluorescence of this system showed a significant change (fig. 4).

Example 3: method for realizing whole genome sgRNA library screening by using SAM concentration perception system

Firstly, the purpose is as follows: screening of genes associated with SAM metabolism in eukaryotic cells

Second, method

(1) Constructing a cell line stably expressing Cas9 protein, adding a cell population with flow sorting EGFP fluorescent-darkened after DOX induction for whole genome screening of cells. And (3) carrying out lentivirus packaging and infection by using a human GeCKO sgRNA plasmid library to realize whole genome-wide screening. Knocking out genes after the virus infects the sgRNA plasmid library, obtaining a cell cluster with EGFP fluorescence change through flow cell sorting, specifically amplifying gene sequence information of different clusters through PCR, obtaining enriched sgRNA sequence information and corresponding genes thereof through deep sequencing analysis and comparison, and obtaining potential genes for regulating SAM metabolism.

Third, result and discussion

Through whole genome screening, an EGFP fluorescence brightened cell cluster and an EGFP fluorescence unchanged cell cluster are obtained, sgRNA sequence information and gene number enriched by the EGFP fluorescence brightened cell cluster and the EGFP fluorescence unchanged cell cluster are compared, and potential genes for partially regulating SAM metabolism are obtained, wherein MAT2A is obviously enriched, and the reliability of the system is further proved (fig. 5).

The above embodiments are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principle of the present invention should be construed as equivalents thereof, and all such changes, modifications, substitutions, combinations, and simplifications are intended to be included in the scope of the present invention.

Sequence listing

<110> university of Tongji

<120> eukaryotic cell S-adenosylmethionine concentration sensing fluorescence reporting system

<130> L21100637F

<160> 34

<170> SIPOSequenceListing 1.0

<210> 1

<211> 20

<212> DNA

<213> 2con

<400> 1

ggagacgtct agacgtctcc 20

<210> 2

<211> 20

<212> DNA

<213> 2nat

<400> 2

ggagacatcc agacgtatcc 20

<210> 3

<211> 28

<212> DNA

<213> 3con

<400> 3

ggagacgtct agacgtctag acgtctcc 28

<210> 4

<211> 28

<212> DNA

<213> 3nat

<400> 4

ggagacgtct ggatgcctta acatcccc 28

<210> 5

<211> 36

<212> DNA

<213> 4con

<400> 5

ggagacgtct agacgtctag acgtctagac gtctcc 36

<210> 6

<211> 36

<212> DNA

<213> 4nat

<400> 6

ggagctatct ggatgtctaa acgtataagc gtatcc 36

<210> 7

<211> 44

<212> DNA

<213> 5con

<400> 7

ggagacgtct agacgtctag acgtctagac gtctagacgt ctcc 44

<210> 8

<211> 44

<212> DNA

<213> 5nat

<400> 8

ggcttcatct ttacatctgg acgtctaaac ggatagatgt gccc 44

<210> 9

<211> 44

<212> DNA

<213> NS44

<400> 9

ggatggctga atggagcggc gaatatatca gcccatacgc tgcc 44

<210> 10

<211> 44

<212> DNA

<213> NS1con

<400> 10

ggatggctga atggagcgag acgtctatca gcccatacgc tgcc 44

<210> 11

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

atggctgaat ggagcggcga ata 23

<210> 12

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

ttagtattcc cacgtctccg 20

<210> 13

<211> 70

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

gtaccgagct cggatccgcc accatggact ataaggacga cgacgacaag gggttggtgt 60

cctttgagga 70

<210> 14

<211> 78

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

tgatatattc gccgctccat tcagcacctg ggaggctcct gcttgaagct tctgctaggc 60

tccatggccc aaatccac 78

<210> 15

<211> 50

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

cttcaagcag gagcctccca ggtgctgaat ggagcggcga atatatcagc 50

<210> 16

<211> 47

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

ggccctctag actcgagcgg ccgctttagt attcccacgt ctccggg 47

<210> 17

<211> 40

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

ttgcggatta atggtaattc gtgatgcggt tttggcagta 40

<210> 18

<211> 40

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 18

ggatgttaag gcatccagac gtctagctct gcttatatag 40

<210> 19

<211> 40

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 19

gctttaccaa cagtaccgga atgccaagct tggatgttaa 40

<210> 20

<211> 44

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 20

tccggtactg ttggtaaagc caccgccacc atggtgagca aggg 44

<210> 21

<211> 42

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 21

gaagcggccg gccgccccga ctctagaatt acttgtacag ct 42

<210> 22

<211> 52

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 22

cagcgtatgg gctgatatat tcgccgctcc attcagccat agctctgctt at 52

<210> 23

<211> 48

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 23

gcggtggctt taccaacagt accggaatgc caagcttaca gcgtatgg 48

<210> 24

<211> 42

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 24

tgttggtaaa gccaccgcca ccatggtgag caagggcgag ga 42

<210> 25

<211> 42

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 25

agcggccggc cgccccgact ctagaattac ttgtacagct cg 42

<210> 26

<211> 43

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 26

gaattggcta gcgaattcat ggagcagaag ctgatctcag agg 43

<210> 27

<211> 50

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 27

acacaacata tccagtcact atggtcgact tagtattccc acgtctccgg 50

<210> 28

<211> 51

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 28

cccggagacg tgggaatact aagtcgacca tagtgactgg atatgttgtg t 51

<210> 29

<211> 45

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 29

ctccgtcgtg gtccttatag tccatagatc tggtgaattg ctggg 45

<210> 30

<211> 44

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 30

cccagcaatt caccagatct atggactata aggaccacga cgga 44

<210> 31

<211> 43

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 31

ttgagacaaa ggcttggcca tagggccggg attctcctcc acg 43

<210> 32

<211> 43

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 32

cgtggaggag aatcccggcc ctatggccaa gcctttgtct caa 43

<210> 33

<211> 67

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 33

ctttgctctt gtccagtcta gacattggac cagggttttc ttcaacatca ccacaagtga 60

ggagaga 67

<210> 34

<211> 67

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 34

ctttgctctt gtccagtcta gacattggac cagggttttc ttcaacatca ccacaagtga 60

ggagaga 67

Claims

1. A system for sensing the concentration of SAM of eukaryotic cells in real time is characterized in that the construction method comprises the following steps:

2. The system for sensing the concentration of SAM in eukaryotic cells in real time as claimed in claim 1, wherein the cell line is HEK 293T.

3. The system for sensing the concentration of SAM in eukaryotic cells in real time as claimed in claim 1, wherein the method for constructing the virus packaging system in step (2) is as follows: the cell line was infected with lentivirus generated after culturing by three plasmid transacclimatization of KRAB MetJ-PCW57.1 plasmid with P/G plasmid, VSVG plasmid.

4. A SAM concentration detection kit comprising the system for real-time sensing of SAM concentration in a eukaryotic cell according to any of claims 1 to 3.

5. A method for screening a gene regulating SAM metabolism, comprising the steps of:

constructing a cell line stably expressing Cas9 protein according to the reporter system of any one of claims 1-3, performing genome-wide screening using a GeCKO lentivirus library;

6. A KRAB MetJ expression vector.

7. Use of the 3nat and NS44 sequences according to claim 1 to construct a system for real-time sensing of SAM concentration in eukaryotic cells.