CN114149499A - Monoclonal antibody against human EMC10 and application thereof in treating and/or preventing obesity - Google Patents

Abstract

The invention discloses a monoclonal antibody against human EMC10 and application thereof in treating and/or preventing obesity. The invention firstly discloses a monoclonal antibody of anti-human EMC10, which can specifically recognize the epitope with the amino acid sequence shown as SEQ ID No. 5. The invention further provides application of the monoclonal antibody in preparing a product for treating or/and preventing obesity. The monoclonal antibody for resisting EMC10 provided by the invention can obviously reduce the body weight of obese mice and improve metabolic disorders related to obesity, can be used for preparing products for treating or preventing obesity, and provides a brand-new treatment target for obesity.

Description

Monoclonal antibody against human EMC10 and application thereof in treating and/or preventing obesity

Technical Field

The invention belongs to antibody medicines in the biomedical industry, and particularly relates to a monoclonal antibody resisting human EMC10 and application thereof in treating and/or preventing obesity.

Background

The incidence of obesity is increasing year by year under the influence of factors such as dietary structure, lifestyle and environment. Obesity can greatly increase the incidence and mortality of type 2 diabetes, cardiovascular disease, and tumors, placing a heavy burden on human health and economic development. The search for new causes of obesity and the elucidation of pathological mechanisms in the causes are particularly urgent and have great significance for developing new drugs for intervening and treating obesity and restraining and reducing the harm of obesity to human beings.

Fat is one of the main substances of energy sources of the body, and disorder of lipid metabolism is a serious consequence of metabolic diseases and an important factor of the onset of the metabolic diseases. Many hormones or secretory proteins exist in the body to regulate lipid metabolism, such as classical insulin, thyroid hormone, glucocorticoid and growth hormone, which play important roles in regulating glycolipid metabolism and energy homeostasis. In recent years, certain non-classical endocrine tissue organs have also been found to secrete hormones or cytokines, including adipose-secreted adipokines such as: leptin, adiponectin, Resistin (Resistin), TNF α, IL-6, PAI-1, MCP-1, and the like; liver factors secreted by the liver, such as: fetuin A (Fetuin-A), FGF-21, sex hormone binding protein (SHBG), etc.; muscle factors secreted by muscles, such as: myostatin, irisin, IL-6, IL-15, and the like; and cardiac factors secreted by the heart (such as Atrial Natriuretic Peptide (ANP)); they also play an important role in regulating lipid metabolism, energy balance and the pathogenesis of obesity. Because the hormones or factors can be detected in serum or plasma, the hormones or factors are expected to become molecular markers for obesity diagnosis and potential targets for treatment. Some factors among the hormones or cytokines have been proved to be useful as molecular markers for evaluating obesity, such as leptin and adiponectin, but there are few target drugs that can be used for treating obesity, so that there is a need to continuously search for novel cytokines or secreted proteins that can be used for treating obesity.

EMC10 was originally cloned from a cDNA library from human insulinoma tissue, then named: the nucleotide sequence of the gene INM02, INM02(EMC10) and the amino acid sequence encoded thereby are, for example, the GenBank database (accession number: AY194293) (Wang XC, Xu SY, Wu XY, Song HD, Mao YF, Fan HY, Yu F, Mou B, Gu YY, Xu LQ, Zhou XO, Chen Z, Chen JL, Hu RM.Gene expression profiling human profiling tissue: genes involved in the engineering section gene pathway and cloning of novel full-length cDNAs.Endocr Relat cancer.2004,11: 295-. So far, several studies have revealed various biological functions of EMC 10. Using the ELISA method established by Wang X et al, we have internationally reported that EMC10 is a secreted protein that can be detected in human serum, and found that Emc10(Inm02) gene expression is regulated by glucose in mouse islet beta cells, suggesting that it may play an important role in carbohydrate metabolism (Wang X, Gong W, Liu Y, Yang Z, Zhou W, Wang M, Yang Z, Wen J, Hu R. molecular cloning of a novel secreted peptide, INM02, and regulation of expression by glucose. J Endocrinol.2009,202: 355-364.). Then another panel reported that EMC10 was cloned from human purified hematopoietic stem cells, which panel named it as HSS1 and another sheared isomer as HSM 1; meanwhile, EMC10(HSS1) was found to inhibit proliferation, migration, invasion of glioma cell lines and neovascularization of endothelial cells in vitro, so that EMC10 was considered as a potential target for treating glioblastoma (Junes-Gill KS, Gallaher TK, Gluzman-Polorak Z, Miller JD, Wheeler CJ, Fan X, basic LA. hHSS1: a novel segmented factor and cope of a having lower probability of growing probability chromosome 19q13.33.J neurool.2011, 102(2): 197. 211.; Junes-Gill KS, Lawreler CJ, BMC R, Ginner V, Shi L, basic LA. biological gene HSS-CE, BMC J, Cordner R, Mar V, Shi L, basic LA. biological gene, HSS-G, molecular dynamics, and cancer gene 1. 9: peptide, polysaccharide, peptide. It was also found that elevated Mrita22 (mouse homolog of human EMC10) was able to produce a mouse model of schizophreniaCapable of inhibiting the development of neuronal cell dendrites and crest processes, and capable of completely remedying the defects in the development of hippocampal dendrites and crest processes of the mouse model described above by reducing the level of Mrita22, suggesting that EMC10 plays an important role in the formation of mouse neuronal dendrites and crest processes (Xu B, Hsu PK, Stark KL, Karayiorgou M, Gogos JA. Depression of a neural inhibitor due to miRNA dynamic regulation in a schematic-related microdetermination. cell.2013,152(1-2): Diaminoulou A, Sun Z, Mukai J, Xu B, fen K, Karayiorgou M, Gokai JA. Loss-of-functional in Mi 22/Emc10 genes 6184, science 6136. type A. 11-11. 7. Nature D. 7. A. D. 12. D. No. 7. 12A. No. 7. 12. A. describes FIGS. Recently, researchers from germany found that, in a mouse model of myocardial infarction, Emc10 deletion resulted in decreased angiogenesis in the infarct rim region and impaired left ventricular contraction and relaxation functions, administration of EMC10 to myocardial infarction mice increased angiogenesis in the infarct rim region and improved impaired left ventricular function after myocardial infarction, suggesting that EMC10 is a growth factor with angiogenesis function that promotes tissue repair after myocardial infarction (Reboll MR, Korf-Klingebiel M, Klede S, Polten F, Brinkmann E, Reimann I,

HJ, Bobadillea M, Faix J, Kensah G, Gruh I, Klintschar M, Gaestel M, Niessen HW, Pich A, Bauersacach J, Gogos JA, Wang Y, Wollert KC. EMC10 (Endoplastic diagnostic um Membrane Protein complete Subunt 10) Is a Bone Marrow-Derived atmospheric Growth Factor producing Tissue repair.2017; 136(19):1809-1823.). The study by Zhou Y et al found that EMC10 deletion resulted in male mouse sterility, and that Emc10 gene-deficient sperm exhibited a variety of defects including morphological abnormalities, impaired sperm motility, impaired sperm capacitation, and loss of acrosome response. Molecular mechanism research shows that EMC10 deletion causes sodium/potassium-ATP enzyme inactivation and HCO3^-The induced activation of the cAMP/PKA signaling pathway is impaired and the level of tyrosine phosphorylation of sperm capacitation-related proteins decreases (Zhou Y, Wu F, Zhang M, Xiong Z, Yin Q, Ru Y, Shi H, Li J, Ma)o S,Li Y,Cao X,Hu R,Liew CW,Ding Q,Wang X,Zhang Y.EMC10 governs male fertility via maintaining sperm ion balance.J Mol Cell Biol.2018Dec 1；10(6):503-514.)。

Despite these research advances, the existence of a relationship between EMC10 and obesity has not been reported.

Disclosure of Invention

The technical problem to be solved by the present invention is how to treat and/or prevent obesity.

In order to solve the above technical problems, the present invention first provides a monoclonal antibody against human EMC 10.

The name of the monoclonal antibody of anti-human EMC10 provided by the invention is 4C2, and the monoclonal antibody can specifically recognize an epitope with an amino acid sequence shown as SEQ ID No.5, namely VVGVSVVTHP.

The monoclonal antibody of anti-human EMC10 provided by the invention is named 4C2, and contains a name V_HAnd having the designation V_LThe light chain variable region of (1), said V_HAnd V_LBoth consist of a determinant complementary region and a framework region; the V is_HAnd said V_LEach of the determinant complementary regions of (a) consists of a CDR1, a CDR2 and a CDR 3;

the V is_HThe amino acid sequence of CDR1 of (1) is shown in positions 31-35 of SEQ ID No. 1;

the V is_HThe amino acid sequence of CDR2 of (1) is shown in positions 50-68 of SEQ ID No. 1;

the V is_HThe amino acid sequence of CDR3 is shown in position 101-103 of SEQ ID No. 1;

the V is_LThe amino acid sequence of CDR1 of (1) is shown in positions 24-39 of SEQ ID No. 2;

the V is_LThe amino acid sequence of CDR2 of (1) is shown in positions 55-61 of SEQ ID No. 2;

the V is_LThe amino acid sequence of CDR3 of (1) is shown in positions 94-102 of SEQ ID No. 2.

In the above monoclonal antibody against human EMC10, V is_HAnd V_LAll of the framework regions of (a) were derived from mice.

In the above monoclonal antibody against human EMC10, V is_HThe amino acid sequence of (A) can be shown as SEQ ID No. 1; the V is_LThe amino acid sequence of (A) can be shown as SEQ ID No. 2.

Wherein SEQ ID No.1 consists of 114 amino acid residues and SEQ ID No.2 consists of 113 amino acid residues.

The monoclonal antibody against human EMC10 may be any of the following antibodies:

a) from said V_HAnd said V_LLinking the obtained single-chain antibody;

b) a fusion antibody comprising a) said single chain antibody;

c) containing the V_HAnd said V_LThe Fab of (1);

d) containing the V_HAnd said V_LThe intact antibody of (a);

e) the monoclonal antibody secreted by hybridoma cell strain 4C2 with the preservation number of CGMCC No. 19950.

The monoclonal antibody against human EMC10 may be a murine monoclonal antibody.

Also within the scope of the present invention are biomaterials related to the above monoclonal antibodies, which may be any of B1) to B12):

B1) nucleic acid molecules encoding the monoclonal antibodies;

B2) an expression cassette comprising the nucleic acid molecule of B1);

B3) a recombinant vector comprising the nucleic acid molecule of B1);

B4) a recombinant vector comprising the expression cassette of B2);

B5) a recombinant microorganism comprising the nucleic acid molecule of B1);

B6) a recombinant microorganism comprising the expression cassette of B2);

B7) a recombinant microorganism containing the recombinant vector of B3);

B8) a recombinant microorganism containing the recombinant vector of B4);

B9) a transgenic animal cell line comprising the nucleic acid molecule of B1);

B10) a transgenic animal cell line comprising the expression cassette of B2);

B11) a transgenic animal cell line containing the recombinant vector of B3);

B12) a transgenic animal cell line comprising the recombinant vector of B4).

In the above biological material, the nucleic acid molecule may be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule may also be RNA, such as mRNA or hnRNA, etc.

In the above biological material, B1) the nucleic acid molecule may be a gene encoding the monoclonal antibody.

In the above biological material, the gene may be a DNA molecule as described in A) or B) below:

A) the V is_HThe coding sequence of CDR1 of (1) is shown in positions 91-105 of SEQ ID No.3, said V_HThe coding sequence of CDR2 is shown in position 148 and 204 of SEQ ID No.3, the V_HThe coding sequence of CDR3 is shown in position 301-309 of SEQ ID No. 3; the V is_LThe coding sequence of CDR1 of (1) is shown in positions 70-117 of SEQ ID No.4, said V_LThe CDR2 coding sequence of (A) is shown in position 163-183 of SEQ ID No.4, the V_LThe coding sequence of CDR3 is shown in position 280-306 of SEQ ID No. 4;

B) a DNA molecule having 90% or more identity to the DNA molecule defined in A) and encoding said monoclonal antibody or an antigen binding portion thereof.

Wherein SEQ ID No.3 consists of 342 nucleotides and SEQ ID No.4 consists of 339 nucleotides.

In the above biological materials, the expression cassette according to B2) is a DNA capable of expressing the monoclonal antibody or the antigen-binding portion thereof in a host cell, and the DNA may include not only a promoter for promoting gene transcription of the monoclonal antibody or the antigen-binding portion thereof but also a terminator for terminating gene transcription of the monoclonal antibody or the antigen-binding portion thereof. Further, the expression cassette may also include an enhancer sequence. The recombinant vector containing the monoclonal antibody gene expression cassette can be constructed by using the existing expression vector.

In the above biological material, the recombinant vector may be a plasmid, a cosmid, a phage, or a viral vector.

In the above biological material, the recombinant microorganism may be yeast, bacteria, algae or fungi.

In the above biological material, the transgenic animal cell line may be a non-propagating material.

In the above biological material, "identity" refers to sequence similarity to a native nucleic acid sequence. Identity can be assessed visually or by computer software. Using computer software, the identity between two or more sequences can be expressed in percent (%), which can be used to assess the identity between related sequences.

DNA molecules in which 90% or more identity in the biological material is at least 91%, 92%, 95%, 96%, 98% or 99% identity.

In order to solve the technical problems, the invention further provides the application of the monoclonal antibody or the biological material in preparing products for treating and/or preventing obesity.

The application of the monoclonal antibody of the invention or the biological material in any one of the following methods is also within the protection scope of the invention:

m1) for use in the manufacture of a product for reducing the weight of an animal;

m2) for the preparation of a product for reducing body fat content in an animal;

m3) for use in the manufacture of a product for reducing visceral fat volume in an animal;

m4) in the preparation of products for stimulating the production of heat by brown fat in animals.

In order to solve the above technical problems, the present invention further provides a method for treating and/or preventing obesity.

The method for treating and/or preventing obesity provided by the invention comprises the step of administering the monoclonal antibody to a receptor animal.

In the above, the animal is a mammal, such as a human or a mouse.

The product may be a medicament, vaccine, reagent or kit as hereinbefore described.

In the present invention, the treatment and/or prevention of obesity is mainly embodied in weight loss, reduction of body fat content and visceral fat volume, activation of brown fat function and increase of thermogenesis, reduction of blood sugar, serum insulin, free fatty acids, triglycerides and cholesterol, and the like.

In the above application, the reduction of body fat content in the animal may be a reduction in the volume and weight of white fat, including visceral and subcutaneous adipocytes. The reducing visceral fat volume in an animal can be reducing the volume of abdominal or epididymal adipocytes. The promotion of thermogenesis by activating the brown fat in an animal can be the reduction of lipid droplet accumulation in the brown fat in the animal, and the promotion of energy uptake and utilization by the brown fat.

The monoclonal antibody for resisting EMC10 provided by the invention can obviously reduce the body weight of obese mice and improve metabolic disorders related to obesity, can be used for preparing products for treating or preventing obesity, and provides a brand-new treatment target for obesity.

Deposit description

Reference biological material (strain): 4C2

Suggested classification nomenclature: mouse anti-human EMC10 monoclonal antibody hybridoma cell strain

The preservation organization: china general microbiological culture Collection center

The preservation organization is abbreviated as: CGMCC (China general microbiological culture Collection center)

Address: xilu No.1 Hospital No.3 of Beijing market facing Yang district

The preservation date is as follows: year 2020, 6 and 18

The preservation number is as follows: CGMCC No.19950

Drawings

FIG. 1 is a graph showing the results of identifying purified proteins by the Dot blot method, wherein 1 to 9 represent the weight of the proteins at 30, 15, 7.5, 3.75, 1.875, 0.9375, 0.46875, 0.234375 and 0.1171875ng, respectively.

FIG. 2 is a graph showing the results of identifying a purified protein by Western blot.

FIG. 3 is a graph showing the results of the phosphorylation levels of CREB after the simultaneous intervention of mouse EMC10 protein and different mouse anti-human EMC10 monoclonal antibodies on HeLa cells; in the figure, Ctr represents EMC10 protein alone, no EMC10 antibody; 1.2, 3 and 4 respectively represent antibodies containing 1F12, 4B12-1, 4B12-2 and 4C2, and also contain EMC10 protein.

FIG. 4 shows the results of detection of the wild-type and different truncation EMC10 proteins by western blot of anti-Flag-tagged antibody, in which WT represents the wild-type, i.e., EMC10 protein; the EMC10 truncates of the amino acids of 28-105, 66-145, 106-183, 146-225, 184-254, 146-175, 171-200, 196-225, 146-155, 156-165 and 166-175 deletion of 28-105, 66-145, 106-183, 146-225, 184-254, 146-175, 171-200, 196-225, 146-155, 156-165 and 166-175.

Fig. 5 shows the body weight gain of mice in the control IgG group, 1F12 and 4C2 antibody group, where P <0.05.

Fig. 6 shows the weight gain of mice in the control IgG group, 1F12 and 4C2 antibody group, where P <0.001 and P <0.0001.

Fig. 7 is a DEXA measurement of mouse fat and non-fat weight for control IgG group, 1F12 and 4C2 antibody group, where P <0.05.

FIG. 8 shows mice from control IgG, 1F12 and 4C2 antibody groups sacrificed after completion of the experiment and the weights of different tissue organs { Heart (Heart), Liver (Liver), epididymal fat (eWAT), inguinal subcutaneous fat (iWAT), retroperitoneal fat (Retro), mesenteric fat (Mesen), Brown fat (BAT), Spleen (Spleen), Kidney (Kidney), pancreas (Panc) }; in the figure, P <0.05.

FIG. 9 shows the results of HE staining of brown adipose, subcutaneous adipose and epididymal adipose tissue sections from mice sacrificed in the control IgG group and 4C2 antibody group after the end of the experiment.

FIG. 10 is a graph of blood glucose (6 hours fasting) and non-fasting insulin, non-esterified fatty acids, triglycerides, cholesterol levels in high-fat diet mice with control IgG, 1F12, and 4C2 antibody intervention; in the figure, P <0.05.

FIG. 11 is a graph of the energy metabolism status of high fat diet mice with control IgG and 4C2 antibody intervention in metabolism cage study, where IgG: mouse control IgG, 4C 2: mouse anti-human EMC10 monoclonal antibody 4C 2.

Detailed Description

The present invention is described in further detail below with reference to specific embodiments, which are given for the purpose of illustration only and are not intended to limit the scope of the invention. The examples provided below serve as a guide for further modifications by a person skilled in the art and do not constitute a limitation of the invention in any way.

The experimental procedures in the following examples are conventional unless otherwise specified. Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

Example 1, obtaining of monoclonal antibody 4C2 against human EMC10 and its use in weight loss and amelioration of obesity-related metabolic disorders

This example demonstrates whether it is possible to reduce the body weight and improve obesity-related metabolic disorders in obese mice by intervention with a monoclonal antibody against human EMC 10.

First, obtaining of mouse anti-human EMC10 monoclonal antibody

Preparation of mouse anti-human EMC10 monoclonal antibody

Monoclonal antibodies against human EMC10 were prepared from 8 mice. The method comprises the following specific steps:

1. construction of EMC10 eukaryotic expression recombinant plasmid

Constructing a recombinant plasmid pRAG2a-EMC 10: the DNA fragment shown in the 82 nd to 762 th positions of SEQ ID NO.7 is used for replacing a small fragment between the Nhe I and Xho I restriction sites of the eukaryotic expression vector pRAG2a to obtain a recombinant plasmid pRAG2a-EMC 10.

2. Transfection and expression

(1) Culturing>1×10⁸HEK 293F cells were ready for use.

(2) Mu.g of the recombinant plasmid pRAG2a-EMC10 was diluted to 1ml with a diluent (Opti-MEM) and gently mixed.

(3 dilution of 200. mu.l Lipofectamine with Diluent (Opti-MEM)^TM2000 liposomes to a final volume of 1 ml. Mixing, and standing at room temperature for 5 min.

(4) The diluted plasmid was added to the diluted Lipofectamine ^TM2000 liposomes, mixing themThe final volume was 2ml and mixed gently.

(5) Incubate at room temperature for 30 min.

(6) Transfer 1X 10⁸HEK 293F cells were transferred to 500ml shake flasks and their final volume was brought to 98ml by the addition of fresh, pre-warmed Expression Medium.

(7) 2ml of incubated DNA-Lipofectamine was added^TM2000 of a mixture.

(8)8％CO₂Culturing at 37 deg.C and 125rpm for 4-5 days.

(9) The supernatant was collected at 4 ℃. The supernatant contained EMC10 mature protein (shown as positions 28-254 of SEQ ID NO.6 of the sequence Listing) from which the signal peptide was cut.

3. Purified protein and SDS-PAGE identification

(1) The supernatant obtained in (9) of step 2 was taken, and binding buffer (8M urea, 20mM sodium phosphate, 500mM NaCl, pH 7.8) was added, followed by filtration through a 0.45 μ M filter and collection of the filtrate.

(2) Balancing: binding buffer of 5 column volumes equilibrated the nickel column.

(3) Loading: and (2) loading the filtrate obtained in the step (1).

(4) Impurity washing: 5 column volumes were combined buffer washed until no material flowed through the flow-through.

(5) And (3) elution: 5 column volumes of ion buffer (8M Urea, 20mM NaH)₂PO₄500mM NaCl, pH 4.0) and collecting the eluted product.

(6) SDS-PAGE detection

Only one band of about 36KD is shown, which indicates that the electrophoresis pure target protein is obtained.

4. Dot blot and Western blot identification

(1) And identifying the purified protein obtained in the step 3 by adopting a Dot blot method. The adopted anti-EMC 10 antibody is a rabbit anti-human EMC10 polyclonal antibody (a polyclonal antibody obtained by immunizing a New Zealand white rabbit with EMC10 protein shown in SEQ ID NO.6 of a sequence table as immunogen); the secondary antibody was goat anti-rabbit HRP antibody (Thermo Fisher, Catalog # 65-6120).

The results are shown in FIG. 1. As can be seen, at 2000-fold dilution, the sample protein was diluted to about 0.47ng with a positive result (No. 7); about 0.23ng no positive result (No. 8).

(2) And identifying the purified protein obtained in the step 3 by adopting a Western blot method. The adopted anti-EMC 10 antibody is a rabbit anti-human EMC10 polyclonal antibody (a polyclonal antibody obtained by immunizing a New Zealand white rabbit with EMC10 protein shown in SEQ ID NO.6 of a sequence table as immunogen); the secondary antibody was goat anti-rabbit HRP antibody (Thermo Fisher, Catalog # 65-6120).

The results are shown in FIG. 2. As can be seen, the sample with 10ng has positive band around 36 KD.

The results of Dot blot and Western blot identification show that EMC10 protein eukaryotic expression is successful.

5. Animal immunization

6 female BALB/c mice of 6-8 weeks old are selected, the purified protein obtained in the step 3 is mixed with Freund's complete adjuvant in a volume ratio of 1:1 for primary immunization, 100 mu g of the mixture is injected subcutaneously, the immunization is strengthened once every 2-3 weeks, and 100 mu g of the mixture is injected subcutaneously. And (3) performing blood sampling detection after the four-time immunization, and determining the titer of antiserum against EMC10 protein by an indirect ELISA method (the titer is represented by the maximum dilution multiple of serum with the sample hole OD value/negative hole OD value being more than or equal to 2.1), when the titer is more than 1:10000, 1-2 mice were selected for cell fusion arrangement.

The indirect ELISA method for determining the titer of the antiserum against EMC10 protein specifically comprises the following steps:

(1) wrapping a plate: a sample of the self-prepared EMC10 standard (purified by expression in step 3 of example 1) was pipetted and dissolved in 0.1M PBS buffer to prepare a coating solution at a concentration of 1. mu.g/ml, and the solution was coated at 100. mu.l/well overnight at 4 ℃.

(2) Washing the plate: the well liquid was discarded, spun dry, plate washed 2 times, each soaking for 1-2 minutes, approximately 200 μ L/well, spun dry and patted dry on absorbent paper.

(3) And (3) sealing: blocking solution 250. mu.l/well, 37 ℃ for 2 h.

(4) Washing the plate: and (4) discarding liquid in the holes, spin-drying, and washing the plate for 5 times, wherein the method is the same as the step (2).

(5) And (3) detection: sucking the serum to be detected and dissolving in an antibody diluent (0.1M PBS) to prepare working solutions with dilution times of 1000, 3000, 9000 and 27000 times, adding 100 mu L of the working solution with different concentrations into each hole, paying attention to no air bubbles, adding the working solution to the bottom of the ELISA plate when adding the sample, keeping the sample from touching the hole wall as far as possible, and slightly shaking and uniformly mixing. The ELISA plates were covered with a membrane and incubated at 37 ℃ for 2 h.

(6) Washing the plate: and (4) discarding liquid in the holes, spin-drying, and washing the plate for 5 times, wherein the method is the same as the step (2).

(7) Rabbit anti-mouse-HRP (horse radish peroxidase) was added to each well in an amount of 100. mu.L, followed by coating and incubation at 37 ℃ for 1 hour.

(8) And (4) discarding liquid in the holes, spin-drying, and washing the plate for 5 times, wherein the method is the same as the step (2).

(9) Color development: substrate color development A, B liquid 1:1 (volume ratio), adding 100 mu L of the mixture into each well, adding a film on an ELISA plate, and incubating for 15 minutes at 37 ℃ in a dark place.

(10) The reaction was stopped by adding 50. mu.L of stop solution to each well, whereupon the blue color turned immediately yellow. The order of addition of the stop solution should be as similar as possible to the order of addition of the substrate solution.

(11) The optical density (OD value) of each well was immediately measured with a microplate reader at 450/630nm dual wavelength and read. The power supply of the microplate reader should be turned on in advance, the instrument should be preheated, and the detection program is set.

(12) And (5) judging a result: the sample well OD/negative well (i.e., blank control well) OD is positive when the OD is greater than or equal to 2.1. The results show that sample wells with serum anti-EMC 10 antibody dilution factor greater than 10,000 are positive, indicating that the antibody titer is greater than 1: 10000.

6. cell fusion

(1) Myeloma cell preparation: one week prior to fusion, SP2/0 cells were expanded in DMEM medium containing 10% FBS. At the time of confluency, the cells grew out of approximately 6T 25 cell culture flasks, and SP2/0 cells were harvested into 50ml centrifuge tubes at the day of confluency and centrifuged at 1000rpm for 5 min. The supernatant was discarded, and then 20ml of DMEM basal medium was added, and the cells were blown off and counted.

(2) Preparation of splenocytes: serum ELISA titers after four immunizations were 1: mice above 10000 were immunized 3 days before the fusion, and 100. mu.g of EMC10 protein purified in step three and Freund's complete adjuvant were intraperitoneally injected in a volume ratio of 1: 1. Mice to be fused were euthanized by cervical dislocation on the day of fusion. Soaking in 75% ethanol for 5 min. Spleens were aseptically removed and placed in a petri dish containing 10ml DMEM basal culture. The spleen was removed from the screen and placed in another dish, transferred to the screen, and ground using a syringe. DMEM was added to the screen and the screen was washed to collect more splenocytes into the dish. The cells were transferred to a10 ml centrifuge tube, and the spleen cells were washed twice with serum-free DMEM, centrifuged at 1000rpm for 5min, and the spleen cells were collected and counted.

(3) Cell fusion: and mixing myeloma cells and spleen cells, so that the number ratio of the myeloma cells to the spleen cells is 1: preferably 20. The cells were placed in 50ml centrifuge tubes, diluted with DMEM basal medium, and then centrifuged at 1000rpm for 5 min. The supernatant was discarded. The tubes were shaken to homogenize the cells. 0.8ml of 50% PEG was slowly added for 90 seconds, and then 20-30ml of DMEM medium was added to stop the PEG. The fused cells were placed in a 37 ℃ water bath and reacted for 10 minutes. Centrifuged at 1000rpm for 5min, and the supernatant was discarded and HAT DMEM medium was added. The fused cells were plated in 96-well plates at 100. mu.l per well. The cell culture plate was then placed in CO₂Culturing in an incubator.

The cloning rate of the hybridoma cells is over 50 percent, a small amount of cell fragments exist, and the cell growth state is good when the hybridoma cells are checked 4 days after fusion. The screening assay was started 10 days after fusion.

7. Fusion screening and subcloning

(1) Fusion screening: the day before the assay, 5. mu.g/ml antigen (EMC10 protein purified in step three) was coated with PBS on ELISA plates overnight. On the next day, 100. mu.l/well of cell supernatant was aspirated for ELISA detection, and positive wells (sample wells OD/negative wells (blank control wells) OD. gtoreq.2.1, were judged as positive wells) based on the ELISA results. And (4) picking and checking the positive holes detected by the whole plate by using a single-channel pipettor, carrying out secondary confirmation detection, and further confirming the positive holes. The determined positive well cells were subcloned.

(2) Subcloning: and (3) blowing and beating the cells in the positive holes, counting, adding 4ml of DMEM culture medium into the centrifuge tube, taking 100 mu l of cell suspension into the centrifuge tube, uniformly blowing, then keeping 1ml, supplementing DMEM to 4ml, uniformly blowing, and keeping 100 mu l (about 2 drops) at the bottom of the tube. Adding DMEM into a centrifuge tube to 5ml, dropwise adding the DMEM into the first three rows of a 96-well plate after uniformly mixing, keeping 1.8-2ml of DMEM at the bottom of a drop tube of each hole, replenishing DMEM into 5ml, dropwise adding the DMEM into D, E, F three rows of the 96-well plate after uniformly blowing, keeping 1.5-1.8ml of DMEM at the bottom of the tube, replenishing DMEM into 2.8-3ml of DMEM, dropwise adding the DMEM into G, H rows of the 96-well plate after uniformly blowing, keeping a drop in each hole, observing under a microscope after 7-10 days, detecting a hole with clone growth, marking a hole with a monoclonal cell, picking a monoclonal cell which is positive as much as possible to perform subcloning again, and picking out the hole with the monoclonal cell to perform expanded culture for a fixed strain after detecting that the cell is 100% positive.

Finally, 8 hybridoma cell strains which can stably secrete monoclonal antibodies against EMC10 protein are obtained and are respectively numbered as 8C11, 6B9, 1F12, 4B12-1, 1H11, 4C2, 4B12-2 and 8A 3.

8. Preparation and purification of ascites

(1) Preparing ascites: each mouse was intraperitoneally injected with 0.5ml of liquid paraffin, and the pretreated mice were intraperitoneally injected with hybridoma within 30 days after 7 days. Injecting 1X 10 per mouse⁶Individual cell amount, hybridoma cells were injected. After 7 to 10 days, carefully withdraw as much liquid from the abdominal cavity with a syringe needle, and perform titer determination by indirect ELISA (titer is expressed as maximum dilution of serum with sample well OD value/negative well OD value ≥ 2.1, and negative well is blank control). Mice were sacrificed by cervical dislocation after the last harvest.

(2) And (3) purification: centrifuging the collected ascites to take supernatant, preparing a protein A agarose medium and loading the supernatant into a column, diluting the ascites by 10 times by using PBS, slowly loading the diluted ascites into the column, washing the diluted ascites by using phosphate buffer solution after loading until an ultraviolet detector reaches a minimum value, eluting the diluted ascites by using glycine elution buffer solution to obtain a required purified antibody, immediately dialyzing the antibody in the PBS at 4 ℃ overnight, and measuring the purity, concentration and titer every other day (the titer is represented by the maximum dilution multiple of serum with the sample hole OD value/negative hole OD value being more than or equal to 2.1, and the negative hole is blank control).

1ug/ml of mouse EMC10 protein and 1ug/ml of different mouse anti-human EMC10 monoclonal antibodies (1F12, 4B12-1, 4B12-2 and 4C2) were used to simultaneously intervene in HeLa cells, and the phosphorylation level of CREB was detected by using western blotting (earlier studies showed that EMC10 could inhibit phosphorylation of CREB), and the results are shown in FIG. 3, which shows that EMC10 protein could reduce phosphorylation of CREB, and 4B12-1 and 4C2 antibodies could restore the originally reduced CREB phosphorylation to the extent before EMC10 protein intervenes, indicating that 4B12-1 and 4C2 antibodies could block the effect of EMC10 protein, while 1F12 and 4B12-2 could not change the decrease of CREB phosphorylation caused by EMC10 protein, indicating that these two antibodies could not block the effect of EMC10 protein, and as a result: 2 monoclonal antibodies of mouse anti-human EMC10 which can block the biological effect of mouse EMC10 protein are screened out: 4B12-1 and 4C2, 1F12 were unable to block the biological effects of mouse EMC10 protein as a control antibody.

The western blotting method is as follows:

1ug/ml of mouse EMC10 protein and 1ug/ml of different mouse anti-human EMC10 monoclonal antibodies (1F12, 4B12-1, 4B12-2 and 4C2) were added to the culture medium to dry HeLa cells for 6 hours, total cell proteins were extracted, electrophoretically separated on 12% sodium dodecyl sulfate-polyacrylamide gel, transferred to polyvinylidene fluoride (PVDF) membrane, and then incubated with rabbit anti-p-CREB monoclonal antibody (CST, cat # 9198, 1:1000 dilution), rabbit anti-CREB 1 monoclonal antibody (ABClonal, cat # A10826, 1:1000 dilution) and rabbit anti-alpha-Tubulin polyclonal antibody (CST, cat # 2144, 1:2000 dilution), and secondary antibody was diluted with horseradish peroxidase-coupled goat anti-rabbit antibody (Sigma) (dilution 1:10000), and finally bands were shown by ECL Plus chemiluminescence (Amersham).

A monoclonal hybridoma cell line 4C2 which secretes a mouse anti-human EMC10 monoclonal antibody 4C2 (hereinafter referred to as 4C2 antibody) -a mouse anti-human EMC10 monoclonal antibody hybridoma cell line 4C2 (hereinafter referred to as 4C2 hybridoma cell or 4C2 cell) is preserved in China general microbiological culture Collection center (CGMCC, address: Beijing city rising region Beichen Xilu No.1 Hospital No. 3) in 6-18 days of 2020, and the preservation number is CGMCC No. 19950.

(II) sequence of mouse anti-human EMC10 monoclonal antibody 4C2

1.4C2 Total RNA extraction from hybridoma cells

Total RNA of a 4C2 cell sample is extracted by Trizol Reagent (Thermofish, USA), the concentration of the total RNA sample is determined by Nanodrop, 15 mu g of total RNA (the concentration: 511.3 ng/mu L, the volume: 30 mu L, A260/A280: 2.01) is obtained, 500ng of the total RNA sample is analyzed by agarose gel electrophoresis, and the result shows that 28S and 18S bands in the total RNA sample are clearly visible, and the brightness of the 28S band is more than 18S, which indicates that the integrity of the two RNAs is better.

2. Mouse antibody fragment amplification and sequence analysis

Specific primers were designed in the constant regions of antibody heavy chain (mouse IgG1 subtype) and light chain (kappa), respectively, and the sequences of the primers were as follows: mouse IgG1 CH outer (5 'to 3'): ACAATCCCTGGGCACAAT, Mouse CL-Kappa outer (5 'to 3'): ACACTCATTCCTGTTGAAGCTCTTGAC are provided. The antibody heavy chain fragment and light chain fragment were amplified separately using 5' RACE. The amplified fragment was inserted into a cloning vector pUC57(Addgene, USA), and sequencing was performed, which revealed that the heavy chain variable region (V) of murine anti-human EMC10 monoclonal antibody 4C2_H) The coding gene sequence of (1) is SEQ ID No.3, V_HHas the amino acid sequence of SEQ ID No.1, wherein, V_HThe amino acid sequence of CDR1 is shown in positions 31-35 of SEQ ID No.1, V_HThe amino acid sequence of CDR2 is shown in SEQ ID No.1 at positions 50-68, V_HThe amino acid sequence of CDR3 is shown in position 101-103 of SEQ ID No. 1; light chain variable region of murine anti-human EMC10 monoclonal antibody 4C2 (V)_L) The coding gene sequence of (1) is SEQ ID No.4, V_LHas the amino acid sequence of SEQ ID No.2, wherein, V_LThe amino acid sequence of CDR1 is shown in SEQ ID No.2 at positions 24-39, V_LThe amino acid sequence of CDR2 is shown in positions 55-61 of SEQ ID No.2, V_LThe amino acid sequence of CDR3 of (1) is shown in positions 94-102 of SEQ ID No. 2.

3. Eukaryotic expression vector construction

The heavy chain fragment V shown in SEQ ID No.3_HThe coding gene of (1) and the constant region of the heavy chain fragment of mouse IgG1 (C)_H) Splicing the coding genes, and inserting the spliced coding genes into a eukaryotic expression vector pAH (HAS Bind, Wuhai, China) to obtain an antibody heavy chain expression plasmid pAH-4C 2; the light chain fragment (V) shown as SEQ ID No.4_L) The coding gene of (a) is spliced with the coding gene of the mouse CL-kappa fragment (light chain fragment constant region), and is inserted into a eukaryotic expression vector pAK (HAS Bind, Wuhai, China) to obtain the antibody light-weight antibodyChain expression plasmid pAK-4C 2. Carrying out bidirectional sequencing on the antibody weight chain expression plasmid pAH-4C2 by adopting forward and reverse sequencing primers, and then carrying out sequence comparison analysis; detecting the antibody light chain expression plasmid pAK-4C2 by using a forward sequencing primer, and then carrying out sequence comparison analysis to obtain a heavy chain nucleotide sequence shown as SEQ ID No.8 (containing a coding sequence of a secretion signal peptide) and a protein shown as SEQ ID No.9 (the 1 st to 21 st sites are amino acid sequences of the secretion signal peptide, and the 22 th to 459 th sites are amino acid sequences of a 4C2 heavy chain of a mouse anti-human EMC10 monoclonal antibody); the nucleotide sequence of the light chain is shown as SEQ ID No.10 (containing a coding sequence of a secretion signal peptide), and the protein shown as SEQ ID No.11 is expressed (amino acid sequences of the secretion signal peptide are shown as 1 to 21, and amino acid sequences of a 4C2 light chain of a mouse anti-human EMC10 monoclonal antibody are shown as 22 to 240).

4. Eukaryotic expression and detection of antibodies

After the two eukaryotic expression plasmids (antibody heavy chain Plasmid pAH-4C2 and antibody light chain Plasmid pAK-4C2) were extracted (Plasmid Midiprep kit, AxyPrep, USA), the Plasmid mass was detected by agarose gel electrophoresis. The antibody heavy chain plasmid pAH-4C2 and the antibody light chain plasmid pAK-4C2 were co-transfected into 40mL HEK 293F cells, and after expression was completed, cell suspension culture supernatants were collected. To evaluate and confirm the activity of the expressed antibody, the expression supernatant was subjected to gradient dilution ELISA analysis in synchronization with 4C2 antibody (mouse anti-human EMC10 monoclonal antibody hybridoma cell line secreting mouse anti-human EMC10 monoclonal antibody 4C2), and the results are shown in tables 1 and 2: ELISA values for approximately 30-fold dilutions of the expression supernatant were comparable to 11ng/mL of 4C2 antibody.

TABLE 1 expression supernatant gradient dilution ELISA assay

TABLE 24C 2 antibody concentration gradient dilution ELISA assay

Therefore, the amino acid sequence of the heavy chain variable region of the mouse anti-human EMC10 monoclonal antibody hybridoma cell line secreted monoclonal antibody 4C2 of mouse anti-human EMC10 is shown as SEQ ID No.1 (the coding sequence is shown as SEQ ID No. 3), and the amino acid sequence of the light chain variable region is shown as SEQ ID No.2 (the coding sequence is shown as SEQ ID No. 4). The heavy chain variable region and the light chain variable region are both composed of a determinant complementary region and a framework region; the complementarity determining region of the heavy chain variable region consists of CDR1 (shown in 31-35 of SEQ ID No.1, the coding sequence is shown in 91-105 of SEQ ID No. 3), CDR2 (shown in 50-68 of SEQ ID No.1, the coding sequence is shown in 148-204 of SEQ ID No. 3) and CDR3 (shown in 101-103 of SEQ ID No.1, the coding sequence is shown in 301-309 of SEQ ID No. 3); the complementarity determining region of the light chain variable region consists of CDR1 (shown in SEQ ID No.2 at positions 24-39, the coding sequence is shown in SEQ ID No.4 at positions 70-117), CDR2 (shown in SEQ ID No.2 at positions 55-61, the coding sequence is shown in SEQ ID No.4 at positions 163-183) and CDR3 (shown in SEQ ID No.2 at positions 94-102, the coding sequence is shown in SEQ ID No.4 at positions 280-306). The mouse anti-human EMC10 monoclonal antibody 4C2 in the following experiment is mouse anti-human EMC10 monoclonal antibody hybridoma cell strain secreted mouse anti-human EMC10 monoclonal antibody 4C 2.

(III) epitope sequence of mouse anti-human EMC10 monoclonal antibody 4C2

Dividing the EMC10 protein (comprising 28-254 amino acids) with the signal peptide removed into 5 different truncation bodies, namely EMC10 truncation bodies (shown in A in figure 4) with 28-105 (delta 28-105), 66-145 (delta 66-145), 106-; then, 3 different truncations were constructed for the amino acid at position 146-; by repeating the above study, the epitope to which the 4C2 antibody is directed is finally determined to be in the 156-165 region (shown as C in FIG. 4), and the amino acid sequence of the EMC10 protein corresponding to this region is: VVGVSVVTHP are provided.

EMC10 epitope acquisition experiment:

(1) the gene sequences of the Wild Type (WT) and the different truncations (FIG. 4) of the EMC10 with Flag tag at the C-terminal were amplified by PCR and constructed on the pLEX-MCS vector without tag (Thermo Scientific).

(2) 293T cells were prepared in 10 cm dishes and serum-free DMEM (Gibco) was changed, the wild type and different truncation EMC10 plasmids were transfected into 293T cells, and after 5 hours 10% fetal bovine serum (Gibco) in DMEM was changed after 1 day.

(3) After another 1 day, the cells were collected with 400ul EBC buffer (50mM Tris-HCl pH 7.5, 120mM NaCl, 0.5% NP-40), lysed, centrifuged at 12000rpm for 10min at 4 ℃ and the supernatant collected.

(4) 2ug of monoclonal antibody 4℃ 2 against human EMC10 (prepared as step one) was added to the supernatant and incubated at 4 ℃ for 4 h.

(5) Protein A/G agarose (Santa Cruz Biotechnology) was added, incubated at 4 ℃ for 1h, and beads were washed with PBS.

(6) Add 1X loading (Beyotime) with SDS, cook at 100 ℃ for 5min, denature, anti Flag-tagged antibody (Cell Signaling Technology) western blot detect wild-type (i.e., EMC10 protein) and different truncations of EMC10 protein.

Second, application of mouse monoclonal antibody against human EMC10 in weight loss and improvement of obesity-related metabolic disorders

1. Effect on high fat diet-induced obesity in mice

Mice on a high fat diet (60% of dietary calories from fat) for 7 weeks, weighing around 35 grams, were randomly divided into three groups, i.e., a control IgG group, a control 1F12 group, and a 4C2 antibody group, with 8-10 mice per group. Each mouse of the 4C2 antibody group was administered with the murine anti-human EMC10 monoclonal antibody 4C2 at a dose of 3mg/kg body weight; each mouse in the control 1F12 group was administered the murine anti-human EMC10 monoclonal antibody 1F12 at a dose of 3mg/kg body weight; each mouse in the control IgG group was administered IgG to the mice at a dose of 3mg/kg body weight. The control IgG group, the 1F12 group, and the 4C2 antibody group were each injected 2 times per week for two weeks, during which the body weights of the mice in the different groups were measured, and the results of the body weight and the weight gain change of the mice in the different groups are shown in fig. 5 and 6, and the results were shown: the mice in the control IgG group (indicated as "IgG" in the figure) and the 1F12 group (indicated as "1F 12" in the figure) continued to gain weight, whereas the mice in the 4C2 antibody group (indicated as "4C 2" in the figure) showed significant weight loss, with a negative gain in weight of 4 grams in 2 weeks, with significant statistical differences in weight (P <0.05,. P <0.001,. P <0.0001) compared to the control IgG group and the 1F12 group.

Fat weight and non-fat weight of mice injected with control IgG group, 1F12 group and 4C2 antibody group two weeks after injection were measured using a dual energy X-ray absorption method (DEXA), and the results are shown in fig. 7, showing: the fat weight of the 4C2 antibody group (indicated as "4C 2" in the figure) was significantly reduced (× P <0.05) compared to the control IgG group (indicated as "IgG" in the figure) and the 1F12 group (indicated as "1F 12" in the figure), while the non-fat weight did not differ among the three groups, the control IgG group, the 1F12 group and the 4C2 antibody group; after sacrifice of the mice, different tissue organs (heart, liver, epididymal fat, inguinal subcutaneous fat, retroperitoneal fat, mesenteric fat, brown fat, spleen, kidney, pancreas) were weighed and the results are shown in fig. 8: mice in the 4C2 antibody group (indicated as "4C 2" in the figure) had significantly reduced subcutaneous fat and liver weights (P <0.05), epididymis, mesentery and retroperitoneum fat weights, compared to the control IgG group (indicated as "IgG" in the figure) and the 1F12 group (indicated as "1F 12" in the figure), while the weights of other tissue organs (heart, brown fat, spleen, kidney, pancreas) were not different between the control IgG, 1F12 group and the 4C2 antibody group.

The mice were sacrificed 2 weeks after antibody injection, and brown fat, subcutaneous fat and epididymal adipose tissue were collected, and the results are shown in fig. 9 and show: the volume of subcutaneous and epididymal fat cells of mice in the 4C2 antibody group (indicated as "4C 2" in the figure) was significantly smaller than that of mice in the control IgG group (indicated as "IgG" in the figure); the control IgG group (indicated as "IgG" in the figure) had a large accumulation of lipid droplets in the brown fat, while the 4C2 antibody group (indicated as "4C 2" in the figure) had a significant reduction in lipid droplets.

2. Effect on diet-induced metabolic disorders in mice

Mice on a high fat diet (60% of dietary calories from fat) for 7 weeks, weighing around 35 grams, were randomly divided into three groups, i.e., a control IgG group, a control 1F12 group, and a 4C2 antibody group, with 8-10 mice per group. Each mouse of the 4C2 antibody group was administered to the mouse anti-human EMC10 monoclonal antibody 4C2 at a dose of 3mg/kg body weight; each mouse of the control 1F12 group was administered to mice with the anti-human EMC10 monoclonal antibody 1F12 at a dose of 3mg/kg body weight; each mouse in the control IgG group was administered IgG to the mice at a dose of 3mg/kg body weight. The control IgG group, the 1F12 group and the 4C2 antibody group were injected 2 times per week for two weeks to study the metabolic-related markers in serum, and the blood glucose (6 hours fasting) and insulin, non-esterified fatty acids, triglycerides and cholesterol in the non-fasting state of the mice were measured, as shown in fig. 10, and the blood glucose, non-esterified fatty acids and triglycerides in the 4C2 antibody group (indicated as "4C 2" in the figure) were significantly lower than those in the control IgG group (indicated as "IgG" in the figure) and the 1F12 group (indicated as "1F 12" in the figure) (P <0.05), and the serum insulin and cholesterol were also significantly reduced.

3. Effect on mouse energy metabolism

Mice on a high fat diet (60% of dietary calories from fat) for 7 weeks, weighing around 35 grams, were randomly divided into two groups, a control IgG group and a 4C2 antibody group, with 8-10 mice per group. The energy metabolism of mice was studied using an Oxymax index pathology system (Oxymax, Columbus Instruments), and the mice were placed in a metabolism cage for 3 days, the first day was an adaptation period, the second and third days were experimental periods, the second day was an injection of antibody, and each mouse in the 4C2 antibody group was administered to the mouse anti-human EMC10 monoclonal antibody 4C2 at a dose of 3mg/kg body weight; each mouse in the control IgG group was administered IgG to the mice at a dose of 3mg/kg body weight. The mice were freely available for food and water in metabolic cages, divided daily into 12 hours of light/day (white areas in fig. 11) and 12 hours of night (grey areas in fig. 11). The system monitors the indexes of the mouse such as ingestion, drinking, activity, oxygen consumption, carbon dioxide exhalation, heat production and the like in the metabolism cage in real time through instruments carried by the system. As shown in fig. 11, the oxygen consumption, carbon dioxide exhalation and heat production of the mice in the 4C2 antibody group (indicated as "4C 2") were significantly higher than those in the control IgG group (P < 0.01).

The results show that the monoclonal antibody 4C2 resisting EMC10 can obviously reduce the body weight and the body fat content of obese mice by increasing energy consumption (heat production) and can improve the lipid metabolism disorder related to obesity, thereby providing a brand-new therapeutic target for obesity.

The present invention has been described in detail above. It will be apparent to those skilled in the art that the invention can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the invention and without undue experimentation. While the invention has been described with reference to specific embodiments, it will be appreciated that the invention can be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains. The use of some of the essential features is possible within the scope of the claims attached below.

SEQUENCE LISTING

<110> Huashan Hospital affiliated to Fudan university

<120> anti-human EMC10 monoclonal antibody and application thereof in treatment and/or prevention of obesity

<130> GNCFY200524

<160> 11

<170> PatentIn version 3.5

<210> 1

<211> 114

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 1

Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly

1 5 10 15

Ser Met Lys Leu Ser Cys Val Ala Ser Gly Phe Ile Phe Ser Ser Tyr

20 25 30

Trp Met Ser Trp Val Arg Gln Ser Pro Glu Lys Gly Leu Glu Trp Val

35 40 45

Ala Glu Ile Arg Leu Lys Ser Asp Asn Tyr Glu Thr His Tyr Ala Glu

50 55 60

Ser Val Lys Gly Lys Phe Thr Ile Ser Arg Asp Asp Ser Lys Ser Arg

65 70 75 80

Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Gly Ile Tyr

85 90 95

Tyr Cys Thr Asp Met Asp Tyr Trp Gly Gln Gly Thr Ser Val Thr Val

100 105 110

Ser Ser

<210> 2

<211> 113

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 2

Asp Val Leu Met Thr Gln Thr Pro Leu Ser Leu Pro Val Ser Leu Gly

1 5 10 15

Asp Gln Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Val His Ser

20 25 30

Asn Gly Asn Thr Tyr Leu His Trp Tyr Leu Gln Lys Pro Gly Gln Ser

35 40 45

Pro Lys Leu Leu Ile Tyr Lys Val Ser Asn Arg Phe Ser Gly Val Pro

50 55 60

Val Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile

65 70 75 80

Ser Arg Val Glu Ala Glu Asp Leu Gly Val Tyr Phe Cys Ser Gln Ser

85 90 95

Ile His Val Pro Trp Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys

100 105 110

Arg

<210> 3

<211> 342

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

gaagtgcagc tgttggagtc tggaggaggc ttggtgcaac ctggaggatc catgaaactc 60

tcctgtgtag cctctggatt tattttcagt agttattgga tgtcttgggt ccgccagtct 120

ccagaaaagg ggcttgagtg ggttgctgaa attagattga aatctgataa ttatgaaaca 180

cattatgcgg agtctgtgaa agggaagttc accatctcaa gagatgattc caaaagtcgt 240

ctctacctgc aaatgaacag cttaagagct gaagacactg gaatttatta ctgtaccgat 300

atggactact ggggtcaagg aacctcagtc accgtctcct ca 342

<210> 4

<211> 339

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

gatgttttga tgacccaaac tccactctcc ctgcctgtca gtcttggaga tcaagcctcc 60

atctcttgca gatctagtca gagccttgta cacagtaatg gaaacaccta tttacattgg 120

tacctgcaga agccaggcca gtctccaaag ctcctgatct acaaagtttc caaccgattt 180

tctggggtcc cagtcaggtt cagtggcagt ggatcaggga cagatttcac actcaagatc 240

agcagagtgg aggctgagga tctgggagtt tatttctgct ctcaaagtat acatgttccg 300

tggacgttcg gtggaggcac caagctggaa atcaaacgg 339

<210> 5

<211> 10

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 5

Val Val Gly Val Ser Val Val Thr His Pro

1 5 10

<210> 6

<211> 254

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 6

Met Ala Ala Ala Ser Ala Gly Ala Thr Arg Leu Leu Leu Leu Leu Leu

1 5 10 15

Met Ala Val Ala Ala Pro Ser Arg Ala Arg Gly Ser Gly Cys Arg Ala

20 25 30

Gly Thr Gly Ala Arg Gly Ala Gly Ala Glu Gly Arg Glu Gly Glu Ala

35 40 45

Cys Gly Thr Val Gly Leu Leu Leu Glu His Ser Phe Glu Ile Asp Asp

50 55 60

Ser Ala Asn Phe Arg Lys Arg Gly Ser Leu Leu Trp Asn Gln Gln Asp

65 70 75 80

Gly Thr Leu Ser Leu Ser Gln Arg Gln Leu Ser Glu Glu Glu Arg Gly

85 90 95

Arg Leu Arg Asp Val Ala Ala Leu Asn Gly Leu Tyr Arg Val Arg Ile

100 105 110

Pro Arg Arg Pro Gly Ala Leu Asp Gly Leu Glu Ala Gly Gly Tyr Val

115 120 125

Ser Ser Phe Val Pro Ala Cys Ser Leu Val Glu Ser His Leu Ser Asp

130 135 140

Gln Leu Thr Leu His Val Asp Val Ala Gly Asn Val Val Gly Val Ser

145 150 155 160

Val Val Thr His Pro Gly Gly Cys Arg Gly His Glu Val Glu Asp Val

165 170 175

Asp Leu Glu Leu Phe Asn Thr Ser Val Gln Leu Gln Pro Pro Thr Thr

180 185 190

Ala Pro Gly Pro Glu Thr Ala Ala Phe Ile Glu Arg Leu Glu Met Glu

195 200 205

Gln Ala Gln Lys Ala Lys Asn Pro Gln Glu Gln Lys Ser Phe Phe Ala

210 215 220

Lys Tyr Trp His Ile Ile Leu Gly Gly Ala Val Leu Leu Thr Ala Leu

225 230 235 240

Arg Pro Ala Ala Pro Gly Pro Ala Pro Pro Pro Gln Glu Ala

245 250

<210> 7

<211> 765

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

atggcggcag ccagcgctgg ggcaacccgg ctgctcctgc tcttgctgat ggcggtagca 60

gcgcccagtc gagcccgggg cagcggctgc cgggccggga ctggtgcgcg aggggctggg 120

gcggaaggtc gagagggcga ggcctgtggc acggtggggc tgctgctgga gcactcattt 180

gagatcgatg acagtgccaa cttccggaag cggggctcac tgctctggaa ccagcaggat 240

ggtaccttgt ccctgtcaca gcggcagctc agcgaggagg agcggggccg actccgggat 300

gtggcagccc tgaatggcct gtaccgggtc cggatcccaa ggcgacccgg ggccctggat 360

ggcctggaag ctggtggcta tgtctcctcc tttgtccctg cgtgctccct ggtggagtcg 420

cacctgtcgg accagctgac cctgcacgtg gatgtggccg gcaacgtggt gggcgtgtcg 480

gtggtgacgc accccggggg ctgccggggc catgaggtgg aggacgtgga cctggagctg 540

ttcaacacct cggtgcagct gcagccgccc accacagccc caggccctga gacggcggcc 600

ttcattgagc gcctggagat ggaacaggcc cagaaggcca agaaccccca ggagcagaag 660

tccttcttcg ccaaatactg gcacatcatc ctgggggggg ccgtgttgct cacagccctg 720

cgtcctgctg cgccagggcc cgcgccaccg ccacaggagg cctga 765

<210> 8

<211> 1380

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

atgagggcct ggatcttctt tctcctttgc ctggccggga gggctctggc agccccgcta 60

gcagaagtgc agctgttgga gtctggagga ggcttggtgc aacctggagg atccatgaaa 120

ctctcctgtg tagcctctgg atttattttc agtagttatt ggatgtcttg ggtccgccag 180

tctccagaaa aggggcttga gtgggttgct gaaattagat tgaaatctga taattatgaa 240

acacattatg cggagtctgt gaaagggaag ttcaccatct caagagatga ttccaaaagt 300

cgtctctacc tgcaaatgaa cagcttaaga gctgaagaca ctggaattta ttactgtacc 360

gatatggact actggggtca aggaacctca gtcaccgtct cctcagctaa aacgacaccc 420

ccatctgtct atccactggc ccctggatct gctgcccaaa ctaactccat ggtgaccctg 480

ggatgcctgg tcaagggcta tttccctgag ccagtgacag tgacctggaa ctctggatcc 540

ctgtccagcg gtgtgcacac cttcccagct gtcctgcagt ctgacctcta cactctgagc 600

agctcagtga ctgtcccctc cagcacctgg cccagcgaga ccgtcacctg caacgttgcc 660

cacccggcca gcagcaccaa ggtggacaag aaaattgtgc ccagggattg tggttgtaag 720

ccttgcatat gtacagtccc agaagtatca tctgtcttca tcttcccccc aaagcccaag 780

gatgtgctca ccattactct gactcctaag gtcacgtgtg ttgtggtaga catcagcaag 840

gatgatcccg aggtccagtt cagctggttt gtagatgatg tggaggtgca cacagctcag 900

acgcaacccc gggaggagca gttcaacagc actttccgct cagtcagtga acttcccatc 960

atgcacgagg actggctcaa tggcaaggag ttcaaatgca gggtcaacag tgcagctttc 1020

cctgccccca tcgagaaaac catctccaaa accaaaggca gaccgaaggc tccacaggtg 1080

tacaccattc cacctcccaa ggagcagatg gccaaggata aagtcagtct gacctgcatg 1140

ataacagact tcttccctga agacattact gtggagtggc agtggaatgg gcagccagcg 1200

gagaactaca agaacactca gcccatcatg gacacagatg gctcttactt cgtctacagc 1260

aagctcaatg tgcagaagag caactgggag gcaggaaata ctttcacctg ctctgtgtta 1320

catgagggcc tgcacaacca ccatactgag aagagcctct cccactctcc tggtaaatga 1380

<210> 9

<211> 459

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 9

Met Arg Ala Trp Ile Phe Phe Leu Leu Cys Leu Ala Gly Arg Ala Leu

1 5 10 15

Ala Ala Pro Leu Ala Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu

20 25 30

Val Gln Pro Gly Gly Ser Met Lys Leu Ser Cys Val Ala Ser Gly Phe

35 40 45

Ile Phe Ser Ser Tyr Trp Met Ser Trp Val Arg Gln Ser Pro Glu Lys

50 55 60

Gly Leu Glu Trp Val Ala Glu Ile Arg Leu Lys Ser Asp Asn Tyr Glu

65 70 75 80

Thr His Tyr Ala Glu Ser Val Lys Gly Lys Phe Thr Ile Ser Arg Asp

85 90 95

Asp Ser Lys Ser Arg Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu

100 105 110

Asp Thr Gly Ile Tyr Tyr Cys Thr Asp Met Asp Tyr Trp Gly Gln Gly

115 120 125

Thr Ser Val Thr Val Ser Ser Ala Lys Thr Thr Pro Pro Ser Val Tyr

130 135 140

Pro Leu Ala Pro Gly Ser Ala Ala Gln Thr Asn Ser Met Val Thr Leu

145 150 155 160

Gly Cys Leu Val Lys Gly Tyr Phe Pro Glu Pro Val Thr Val Thr Trp

165 170 175

Asn Ser Gly Ser Leu Ser Ser Gly Val His Thr Phe Pro Ala Val Leu

180 185 190

Gln Ser Asp Leu Tyr Thr Leu Ser Ser Ser Val Thr Val Pro Ser Ser

195 200 205

Thr Trp Pro Ser Glu Thr Val Thr Cys Asn Val Ala His Pro Ala Ser

210 215 220

Ser Thr Lys Val Asp Lys Lys Ile Val Pro Arg Asp Cys Gly Cys Lys

225 230 235 240

Pro Cys Ile Cys Thr Val Pro Glu Val Ser Ser Val Phe Ile Phe Pro

245 250 255

Pro Lys Pro Lys Asp Val Leu Thr Ile Thr Leu Thr Pro Lys Val Thr

260 265 270

Cys Val Val Val Asp Ile Ser Lys Asp Asp Pro Glu Val Gln Phe Ser

275 280 285

Trp Phe Val Asp Asp Val Glu Val His Thr Ala Gln Thr Gln Pro Arg

290 295 300

Glu Glu Gln Phe Asn Ser Thr Phe Arg Ser Val Ser Glu Leu Pro Ile

305 310 315 320

Met His Glu Asp Trp Leu Asn Gly Lys Glu Phe Lys Cys Arg Val Asn

325 330 335

Ser Ala Ala Phe Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Thr Lys

340 345 350

Gly Arg Pro Lys Ala Pro Gln Val Tyr Thr Ile Pro Pro Pro Lys Glu

355 360 365

Gln Met Ala Lys Asp Lys Val Ser Leu Thr Cys Met Ile Thr Asp Phe

370 375 380

Phe Pro Glu Asp Ile Thr Val Glu Trp Gln Trp Asn Gly Gln Pro Ala

385 390 395 400

Glu Asn Tyr Lys Asn Thr Gln Pro Ile Met Asp Thr Asp Gly Ser Tyr

405 410 415

Phe Val Tyr Ser Lys Leu Asn Val Gln Lys Ser Asn Trp Glu Ala Gly

420 425 430

Asn Thr Phe Thr Cys Ser Val Leu His Glu Gly Leu His Asn His His

435 440 445

Thr Glu Lys Ser Leu Ser His Ser Pro Gly Lys

450 455

<210> 10

<211> 723

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

atgagggcct ggatcttctt tctcctttgc ctggccggga gggctctggc agccccgcta 60

gcagatgttt tgatgaccca aactccactc tccctgcctg tcagtcttgg agatcaagcc 120

tccatctctt gcagatctag tcagagcctt gtacacagta atggaaacac ctatttacat 180

tggtacctgc agaagccagg ccagtctcca aagctcctga tctacaaagt ttccaaccga 240

ttttctgggg tcccagtcag gttcagtggc agtggatcag ggacagattt cacactcaag 300

atcagcagag tggaggctga ggatctggga gtttatttct gctctcaaag tatacatgtt 360

ccgtggacgt tcggtggagg caccaagctg gaaatcaaac gggcagatgc tgcaccaact 420

gtatccatct tcccaccatc cagtgagcag ttaacatctg gaggtgcctc agtcgtgtgc 480

ttcttgaaca acttctaccc caaagacatc aatgtcaagt ggaagattga tggcagtgaa 540

cgacaaaatg gcgtcctgaa cagttggact gatcaggaca gcaaagacag cacctacagc 600

atgagcagca ccctcacgtt gaccaaggac gagtatgaac gacataacag ctatacctgt 660

gaggccactc acaagacatc aacttcaccc attgtcaaga gcttcaacag gaatgagtgt 720

tag 723

<210> 11

<211> 240

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 11

Met Arg Ala Trp Ile Phe Phe Leu Leu Cys Leu Ala Gly Arg Ala Leu

1 5 10 15

Ala Ala Pro Leu Ala Asp Val Leu Met Thr Gln Thr Pro Leu Ser Leu

20 25 30

Pro Val Ser Leu Gly Asp Gln Ala Ser Ile Ser Cys Arg Ser Ser Gln

35 40 45

Ser Leu Val His Ser Asn Gly Asn Thr Tyr Leu His Trp Tyr Leu Gln

50 55 60

Lys Pro Gly Gln Ser Pro Lys Leu Leu Ile Tyr Lys Val Ser Asn Arg

65 70 75 80

Phe Ser Gly Val Pro Val Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp

85 90 95

Phe Thr Leu Lys Ile Ser Arg Val Glu Ala Glu Asp Leu Gly Val Tyr

100 105 110

Phe Cys Ser Gln Ser Ile His Val Pro Trp Thr Phe Gly Gly Gly Thr

115 120 125

Lys Leu Glu Ile Lys Arg Ala Asp Ala Ala Pro Thr Val Ser Ile Phe

130 135 140

Pro Pro Ser Ser Glu Gln Leu Thr Ser Gly Gly Ala Ser Val Val Cys

145 150 155 160

Phe Leu Asn Asn Phe Tyr Pro Lys Asp Ile Asn Val Lys Trp Lys Ile

165 170 175

Asp Gly Ser Glu Arg Gln Asn Gly Val Leu Asn Ser Trp Thr Asp Gln

180 185 190

Asp Ser Lys Asp Ser Thr Tyr Ser Met Ser Ser Thr Leu Thr Leu Thr

195 200 205

Lys Asp Glu Tyr Glu Arg His Asn Ser Tyr Thr Cys Glu Ala Thr His

210 215 220

Lys Thr Ser Thr Ser Pro Ile Val Lys Ser Phe Asn Arg Asn Glu Cys

225 230 235 240

Claims (10)

1. A monoclonal antibody characterized by: the monoclonal antibody can specifically recognize an epitope with an amino acid sequence shown as SEQ ID No. 5.

2. A monoclonal antibody characterized by: the monoclonal antibody has the name V_HAnd having the designation V_LThe light chain variable region of (1), said V_HAnd V_LBoth consist of a determinant complementary region and a framework region; the V is_HAnd said V_LEach of the determinant complementary regions of (a) consists of a CDR1, a CDR2 and a CDR 3;

the V is_HThe amino acid sequence of CDR1 of (1) is shown in positions 31-35 of SEQ ID No. 1;

the V is_HThe amino acid sequence of CDR2 of (1) is shown in positions 50-68 of SEQ ID No. 1;

the V is_HThe amino acid sequence of CDR3 is shown in position 101-103 of SEQ ID No. 1;

the V is_LThe amino acid sequence of CDR1 of (1) is shown in positions 24-39 of SEQ ID No. 2;

the V is_LThe amino acid sequence of CDR2 of (1) is shown in positions 55-61 of SEQ ID No. 2;

the V is_LThe amino acid sequence of CDR3 of (1) is shown in positions 94-102 of SEQ ID No. 2.

3. The monoclonal antibody of claim 2, characterized in that: the V is_HAnd V_LAll of the framework regions of (a) were derived from mice.

4. The monoclonal antibody of claim 2 or 3, characterized in that: the V is_HThe amino acid sequence of (A) is shown as SEQ ID No. 1; the V is_LThe amino acid sequence of (A) is shown in SEQ ID No. 2.

5. The monoclonal antibody of any one of claims 2-4, wherein: the monoclonal antibody is any one of the following antibodies:

a) from said V_HAnd said V_LLinking the obtained single-chain antibody;

b) a fusion antibody comprising a) said single chain antibody;

c) containing the V_HAnd said V_LThe Fab of (1);

d) containing the V_HAnd said V_LThe intact antibody of (a);

e) the monoclonal antibody secreted by hybridoma cell strain 4C2 with the preservation number of CGMCC No. 19950.

6. Biological material associated with a monoclonal antibody according to any one of claims 2 to 5, characterized in that: the biological material is any one of B1) to B12):

B1) nucleic acid molecules encoding the monoclonal antibodies;

B2) an expression cassette comprising the nucleic acid molecule of B1);

B3) a recombinant vector comprising the nucleic acid molecule of B1);

B4) a recombinant vector comprising the expression cassette of B2);

B5) a recombinant microorganism comprising the nucleic acid molecule of B1);

B6) a recombinant microorganism comprising the expression cassette of B2);

B7) a recombinant microorganism containing the recombinant vector of B3);

B8) a recombinant microorganism containing the recombinant vector of B4);

B9) a transgenic animal cell line comprising the nucleic acid molecule of B1);

B10) a transgenic animal cell line comprising the expression cassette of B2);

B11) a transgenic animal cell line containing the recombinant vector of B3);

B12) a transgenic animal cell line comprising the recombinant vector of B4).

7. The biomaterial of claim 6, wherein: B1) the nucleic acid molecule is a gene for coding the monoclonal antibody, and the gene can be the DNA molecule described in the following A) or B):

A) the V is_HThe coding sequence of CDR1 of (1) is shown in positions 91-105 of SEQ ID No.3, said V_HThe coding sequence of CDR2 is shown in position 148 and 204 of SEQ ID No.3, the V_HThe coding sequence of CDR3 is shown in position 301-309 of SEQ ID No. 3; the V is_LThe coding sequence of CDR1 of (1) is shown in positions 70-117 of SEQ ID No.4, said V_LThe CDR2 coding sequence of (A) is shown in position 163-183 of SEQ ID No.4, the V_LThe coding sequence of CDR3 is shown in position 280-306 of SEQ ID No. 4;

B) a DNA molecule having 90% or more identity to the DNA molecule defined in A) and encoding said monoclonal antibody or an antigen binding portion thereof.

8. Use of a monoclonal antibody according to any one of claims 1 to 5 or a biomaterial according to claim 6 or 7 for the manufacture of a product for the treatment or/and prevention of obesity.

9. Use of a monoclonal antibody according to any one of claims 1 to 5 or a biomaterial according to claim 6 or 7 in any one of:

m1) for use in the manufacture of a product for reducing the weight of an animal;

m2) for use in the manufacture of a product for reducing body fat content in an animal;

m3) for use in the manufacture of a product for reducing visceral fat volume in an animal;

m4) in the preparation of products for stimulating the production of heat by brown fat in animals.

10. Use according to claim 8 or 9, characterized in that: the product is a medicament, vaccine, reagent or kit.

Images