CN114129560A - Application of agrimonine as autophagy-lysosome signal pathway blocker - Google Patents
Application of agrimonine as autophagy-lysosome signal pathway blocker Download PDFInfo
- Publication number
- CN114129560A CN114129560A CN202111502170.6A CN202111502170A CN114129560A CN 114129560 A CN114129560 A CN 114129560A CN 202111502170 A CN202111502170 A CN 202111502170A CN 114129560 A CN114129560 A CN 114129560A
- Authority
- CN
- China
- Prior art keywords
- autophagy
- lysosome
- agrimonine
- cells
- signal pathway
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/335—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin
- A61K31/365—Lactones
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
Landscapes
- Health & Medical Sciences (AREA)
- Animal Behavior & Ethology (AREA)
- Chemical & Material Sciences (AREA)
- Veterinary Medicine (AREA)
- Medicinal Chemistry (AREA)
- Public Health (AREA)
- General Health & Medical Sciences (AREA)
- Pharmacology & Pharmacy (AREA)
- Life Sciences & Earth Sciences (AREA)
- General Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Epidemiology (AREA)
- Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)
Abstract
The invention discloses application of agrimonine as an autophagy-lysosome signal pathway blocker. The research of the invention shows that the agrimonine can inhibit autophagy-lysosome pathway and autophagy. The agrimonine is extracted from the traditional Chinese herbal medicine centipeda minima, and the centipeda minima has been used for treating respiratory diseases for many years, and has the advantages of high safety, good development and utilization prospect and low price. The invention provides a new application of agrimonine, which is used as an autophagy-lysosome signal pathway blocker, HCT116 cells and HT29 cells processed by agrimonine are increased in autophagosome, and the degradation pathway of autophagy lysosome is blocked.
Description
Technical Field
The invention belongs to the technical field of medicines, and particularly relates to application of agrimonine as an autophagy-lysosome signal pathway blocker.
Background
Centipeda minima (L.) A.Br.et Aschers is a plant of Centipeda genus of Compositae family, also called Centipeda minima and Cochlearia gallinarum. Centipeda minima is recorded in the book "dietary materia Medica" of Nantang and the famous pharmacopoeia of compendia of materia Medica of China, "centipeda minima can promote the circulation of nasal qi, facilitate seven orifices, expectorate wind and phlegm, and stop oneself after being plugged in the nose". The centipeda minima grows in the shady and humid place with the altitude of 300-1900 m, and is mainly produced in Zhejiang, Hubei, Jiangsu, Guangdong and the like. Is mainly distributed in indian plains and Ceylon islands abroad.
The main components of the centipeda minima comprise volatile oil, steroids, terpenoids, flavonoids and other main effective components. Geraniin (6-OA) is used as sesquiterpene lactone [1] isolated from Centipeda minima belonging to Compositae, and has the following structural formula:
relevant reports show that 6-OA has antibacterial and antiallergic effects [2], can induce apoptosis of human leukemia cell HL60, and has obvious inhibiting effect on growth of solid tumor in C57BL/6 mouse [3 ]. In addition, 6-OA can block the cell cycle of nasopharyngeal carcinoma cells [4 ]. In lung cancer cells, 6-OA exerts its anti-lung cancer effect by generating Reactive Oxygen Species (ROS), and inhibition of the Nrf2 antioxidant system enhances this effect [5 ].
No article exists for showing the blocking effect of 6-OA on autophagy-lysosome signal path, and no patent application exists.
Disclosure of Invention
The invention aims to provide a new application of agrimonine as an autophagy-lysosome signal pathway blocker. The invention is mainly verified by in vitro experiments, and the result shows that the agrimonine can inhibit autophagy-lysosome pathway and autophagy.
In order to achieve the purpose, the invention adopts the following technical scheme: the agrimonine can be used for preparing autophagy-lysosome signal pathway blockers.
Further, the application of the agrimonine in preparing the medicament for treating the diseases related to the autophagy-lysosome signal pathway is also provided.
Preferably, the action concentration of the agrimonine is 1.6-6.4 uM.
In addition, the invention also requests to protect the application of the agrimonine in inhibiting the growth of colon cancer cells in vitro.
Preferably, the colon cancer cells are HCT116 and HT29 cells.
Compared with the prior art, the invention has the following beneficial effects:
according to the invention, the agrimonine brevifolin is tested through in-vitro western blot test detection experiments, laser confocal experiments, observation of lysosome morphology under an electron microscope and other experiments, and the final test result shows that the agrimonine brevifolin with different concentrations is selected to treat the HCT116 and HT29 cells of colon cancer cells, the autophagy marker protein concentration of the agrimonine brevifolin is increased along with the increase of 6-OA drug concentration and is increased along with the increase of 6-OA treatment time, and meanwhile, the degradation path of autophagosomes can be effectively inhibited. The invention provides a new application of agrimonine in serving as an autophagy-lysosome signal pathway blocker, and can be further applied to treatment of diseases related to autophagy-lysosome signal pathways.
Drawings
FIG. 1 is a schematic view; graph showing the effect of various concentrations of Erodipine treatment on autophagy.
FIG. 2 is a diagram of: schematic representation of the effect of Erianin on lysosomes.
FIG. 3 is a diagram of: a schematic of the ghost of Erianin against lysosome size and autophagosomal formation.
FIG. 4 is a diagram of: the effect of the autophagy inhibitor Torin1, Eragrin brevifolin (6-OA), autophagy activator Baf-A1 on lysosomal autophagy is shown schematically.
FIG. 5 is a diagram: schematic representation of the effect of agrimonine on lysosomal autophagy.
Detailed Description
The present invention will be described in further detail with reference to the following examples. It should not be understood that the scope of the above-described subject matter of the present invention is limited to the following examples.
Example 1 Western blot assay to detect changes in autophagy protein in cells treated with 6-OA
First, experiment method
First, HCT116 and HT29 cells were treated with different concentrations of 6-OA (0. mu.M, 1.6. mu.M, 3.2. mu.M, 6.4. mu.M) for 24 h. HCT116 and HT29 cells were treated with 6-OA (3.2. mu.M) for 0 h, 6h, 12h, 24 h.
② cell lysis: washing with precooled PBS (0.01M, pH ═ 7.4) for three times, adding 100. mu.L RIPA cell lysate (Biyunyan, P0013B), lysing on ice for 30min, and mixing gently by inversion every 10 min; centrifuging at 13200rpm for 30min at 4 deg.C, and collecting supernatant for protein concentration determination;
preparing a sample: adding 30 μ g of protein into 20 μ L of 1 × protein loading buffer (Biyuntian, P0015), mixing, and decocting in boiling water bath for 10min to obtain sample;
fourthly, preparing glue: prepare 10% separation gel (5 mL): 1.3mL of 1.5mM Tris-HCl (pH8.8), 1.9mL of ddH2O 1.9, 1.7mL of 30% acrylamide, 50. mu.L of 10% SDS (sodium dodecyl sulfate), 50. mu.L of 10% ammonium persulfate and 3. mu.L of TEMED (tetramethylethylenediamine) (adding, mixing uniformly and quickly preparing the gel); prepare 5% concentrated gum (3 mL): 1.5mM Tris-HCl (pH8.8)0.38mL, ddH2O2.1 mL, 30% acrylamide 0.5mL, 10% SDS (sodium dodecyl sulfate) 30. mu.L, 10% ammonium persulfate 30. mu.L, TEMED (tetramethylethylenediamine 6. mu.L (mixed after adding, rapid gel preparation);
electrophoresis: loading an electrophoresis apparatus (Hunan instrument laboratory development Co., Ltd.), adding an electrophoresis buffer solution, and cooling and sampling the boiled sample of the third step; after the sample loading is finished, firstly running for 30min by using 80V voltage, then using 120V voltage until the bromophenol blue band approaches the tail end, and finishing electrophoresis;
sixthly, transferring the membrane: cutting a PVDF membrane with a corresponding size, soaking and activating the PVDF membrane by using methanol until the PVDF membrane changes color, arranging the PVDF membrane in the order of filter paper-gel-PVDF membrane-filter paper, connecting a membrane rotating power supply, and rotating the PVDF membrane on 235mA constant current ice for 150 min;
and (c) sealing: after membrane conversion, taking out the PVDF membrane, rinsing with TBST to remove residual membrane conversion buffer solution, and then sealing with 5% skimmed milk at room temperature for 2 h;
eighthly, primary antibody incubation: after blocking, residual milk was removed by TBST rinsing, and the corresponding primary antibody LC3(Cell Signaling Technology), p62(Cell Signaling Technology), beta-actin (Bioworld), diluted 1:1000 was added according to the protein indicator band cut, and incubated overnight at 4 ℃ (16 h);
ninthly, incubation with secondary antibody: recovering primary antibody, washing membrane with TBST for 30min, changing solution every ten minutes, adding corresponding secondary antibody (HS101-01, HS201-01, all-formula gold) diluted 1:4000, and incubating at room temperature for 2 h;
r developing: recovering the secondary antibody, washing the membrane for 30min by using TBST, and changing the solution every ten minutes; and reasonably controlling the exposure time for development.
Second, experimental results
The results of the experiment are shown in FIG. 1. As can be seen from FIG. 1, after HCT116 and HT29 cells were treated with different concentrations of 6-OA (0. mu.M, 1.6. mu.M, 3.2. mu.M, 6.4. mu.M), the autophagy marker proteins LC3, p62 increased with increasing 6-OA drug concentration and increased 6-OA treatment time. Elevated levels of p62 are generally considered to be a marker for inhibition of autophagy activity. The autophagy marker proteins LC3 and P62 accumulate because of the drug addition, lysosome destruction, pH change and incapability of degrading the proteins.
Experimental example 2 laser confocal experiment
First, experiment method
Construction of pLVX-Puro-GFP-LC3 plasmid: the construction method is carried out by using a homologous recombination method and adopting a C112-Clonexpress II One Step Cloning Kit (Novozam, Cat # C112-01), and the specific steps are as follows:
amplification specific primers were designed in combination with the Clonexpress II recombinant reaction System (Novozan Biotechnology Ltd.) and the target gene LC3 and GFP sequences were amplified using high fidelity PCR polymerase. The unloaded PLVX-puro is cut by fast-cutting enzyme ECOR I (TaKaRa), and the target gene LC3 and GFP sequence are connected with the cut PLVX-puro by ligase Exnase II, wherein the connection conditions are as follows: ligation was carried out at 37 ℃ for 0.5h, immediately followed by cooling in an ice bath for 5min, and then the ligation product was gently mixed with 100. mu.L of E.coli DH 5. alpha. competent cells (OD value of 0.5), and allowed to stand on ice for 30 min; water bath at 42 deg.C for 90s, and ice water bath incubating for 2 min; adding 450 μ L LB medium, shaking at 37 deg.C and 200rpm for 45 min. 100 μ L of the bacterial suspension was spread evenly on an LB medium plate containing Amp, and the plate was inverted and cultured overnight at 37 ℃. Picking the single colony into 50 mu L of fresh liquid LB culture medium by using a sterile toothpick, mixing uniformly, taking 3 candidate monoclonals for amplification culture: one part of the extracted plasmid is sent to the company for sequencing; and another part of seed preservation: storing in a liquid nitrogen tank at-80 deg.C.
The primers for pLVX-Puro-GFP-LC3 were as follows:
an upstream primer:
CCCAAGCTGGCTAGCGCCACCATGGTGAGCAAGGGCGAGGAGGATA
a downstream primer:
TGACCCGCAAGCCCGGTGCCTGACGCCCCCTCTCCCTCCCCCCCCCCT
② transfection: the pLVX-Puro-GFP-LC3 recombinant plasmid was transfected into human colorectal cancer cells HCT116 and HT29 cell lines.
The prepared pLVX-Puro-GFP-LC3 recombinant plasmid is transfected into HCT116 and HT29 cell strains of human colorectal cancer cells by Lip3000 according to the specification of Lip3000 respectively, HCT116 and HT29 cells over expressing GFP-LC3 are paved on a special confocal dish, the cells are treated by 6-OAP (3.2 mu M) after the cells are attached to the wall the next day, and the rupture condition of lysosomes is observed under a laser confocal microscope after the cells are treated by drugs for 24 h.
Second, experimental results
The results of the experiment are shown in FIG. 2. As can be seen from fig. 2, the HCT116 cells and HT29 cells in the control group showed uniform green color overall, while the HCT116 cells and HT29 cells treated with 6-OAP formed a plurality of bright green fluorescence spots under a fluorescence microscope, and the HCT116 cells and HT29 cells treated with 6-OAP had increased autophagosomes and blocked degradation pathways of autophagosomes.
Experimental example 3 Observation of lysosome form under Electron microscope
First, experiment method
Collecting cells: the HCT116 cells treated with 6-OA were trypsinized and collected in a 1.5mL conical centrifuge tube and centrifuged at 1800 rpm for 10 min.
Fixing and cleaning: centrifuging, removing supernatant, immediately adding 3% glutaraldehyde, and storing in refrigerator at 4 deg.C for at least 2 hr. Washing with 0.1mol/L phosphate buffer solution for 2 times, each time for 10min, fixing with 1% osmic acid in refrigerator at 4 deg.C for 1h, and washing with 0.1mol/L phosphate buffer solution for 2 times, each time for 10 min. After osmate fixation, the cells were wrapped in a glass wiping paper and placed in penicillin vials for subsequent processing.
Thirdly, dewatering and soaking: gradient dehydration method, 30%, 50%, 70%, 90% ethanol: dehydrating 90% acetone and 100% acetone in a ratio of 1:1 for 2 times, each time for 10-15 min; the impregnation proceeds in a gradient, embedding agent: 100% acetone (1: 3, 1:1, 3: 1) is soaked for 1, 4, 12 hr or more.
Embedding and polymerization: opening the lens wiping paper, and transferring the cell blocks in the lens wiping paper into an embedding mold by using a toothpick; after embedding, the mixture is heated and polymerized in a constant-temperature drying oven. The polymerization temperature and time were respectively: 12h at 37 ℃; 45 ℃, 12h, 60 ℃ and 24-48 h.
Ultra-thin slicing: the polymerized embedded blocks of the sample are used to prepare 50-70 nm ultrathin sections on an ULTRCUT E type microtome. And (3) cutting the sample embedded in the centrifuge tube by using a single-sided blade, taking out an embedded block, and then carrying out block trimming and slicing.
Sixthly, electronic dyeing: and (3) carrying out double dyeing on the ultra-thin section of the sample by adopting a drop dyeing method, firstly dyeing the ultra-thin section with uranyl acetate for 30min, washing the ultra-thin section with double distilled water, then dyeing the ultra-thin section with lead citrate for 15min, and washing the ultra-thin section with the double distilled water.
And observing by an electron microscope.
Second, experimental results
The results of the experiment are shown in FIG. 3. FIG. 3 shows that the lysosomes of the control group were smaller when observed under an electron microscope. After treatment with 6-OA (3.2. mu.M, 6.4. mu.M), lysosomes were swollen, the lysosomes in the drug-added group were larger in diameter than in the control group, and the number of autophagosomes increased.
Example 4 detection of autophagosome and autophagososome by mChery-GFP-LC 3 Dual fluorescence System
First, experiment method
Constructing pLVX-Puro-mCherry-GFP-LC3 plasmid: the plasmid construction method is as described above.
② transfection: plasmid pLVX-Puro-mCherry-GFP-LC3 was transfected into HCT116 cell line in the same manner as described above.
Thirdly, spreading the HCT116 cells obtained in the last step on a confocal special dish, treating the cells with 6-OAP (2.5 mu M), Torin1(2.5 mu M) and Baf-A1(2.5 mu M) after the cells are attached to the wall on the next day, and observing the red and green fluorescence condition of each pixel point under a laser confocal microscope after the cells are treated with the medicine for 24 hours.
Second, experimental results
The results of the experiment are shown in FIG. 4. From fig. 4, it can be seen that the autophagososome can cause pH drop and GFP quenching due to the acidic environment inside the lysosome, and therefore, the decrease of GFP indicates the smoothness of autophagosomal formation, and the less GFP, the smoother the flow from autophagosome to autophagosomal stage. Conversely, autophagosomal fusion is inhibited and the autophagosomal process is hindered. mCherry is always stably expressed, so the autophagy flow course can be evaluated by the ratio of GFP to the bright spots of mCherry. After treatment with 6-OA, fusion of autophagosomes with lysosomes was inhibited and the progress of autophagosomes was hindered, as compared to the autophagy inhibitor Baf-A1, the autophagy activator Torin 1.
Experimental example 5 laser confocal experiment
First, experiment method
In the same way as experimental example 2, pLVX-Puro-GFP-LC3 recombinant plasmids prepared above were transfected into human colorectal cancer HCT116 and HT29 cell lines respectively by Lipo3000 according to Lipo3000 instructions, HCT116 and HT29 cells over-expressing GFP-LC3 were spread on a confocal special dish respectively, cells were treated with 6-OAP (3.2. mu.M) after the cells were attached to the wall the next day, and after 24h of drug treatment, lysosome red fluorescent probes were used for staining, the staining method was performed according to instructions, and lysosome rupture was observed under a laser confocal microscope.
Second, experimental results
The results of the experiment are shown in FIG. 5. FIG. 5 shows that HCT116 cell line, control lysosome had a strong co-localization with LC3, and lysosome co-localization with LC3 was reduced after treatment with 6-OA. HT29 cell strain, control lysosome and LC3 have stronger co-localization, and after 6-OA treatment, the co-localization of the lysosome and LC3 is weakened, the lysosome is enlarged and broken, and the content overflows.
Reference documents:
[1]Taylor R S L,Towers G H N.Antibacterial constituents of the Nepalese medicinal herb, Centipeda minima[J].Phytochemistry,1998,47(4):631-634.
[2]Yu H W,Wright C W,Cai Y,et al.Antiprotozoal activities of Centipeda minima[J]. Phytotherapy Research,1994,8(7):436-438.
[3]ChangLong L,HeZhen W,YongPing H,et al.6-O-angeloylenolinn induces apoptosis through a mitochondrial/caspase and NF-κB pathway in human leukemia HL60 cells[J]. Biomedicine&Pharmacotherapy,2008,62(6):401-409.
[4]Su M,Chung H Y,Li Y.6-O-angeloylenolinn induced cell-cycle arrest and apoptosis in human nasopharyngeal cancer cells[J].Chemico-biological interactions,2011,189(3):167-176.
[5]Wang Y,Yu R Y,Zhang J,et al.Inhibition of Nrf2 enhances the anticancer effect of 6-O-angeloylenolinn in lung adenocarcinoma[J].Biochemical Pharmacology,2017,129:43-53.
the foregoing embodiments are merely illustrative of the principles and utilities of the present invention and are not intended to limit the invention. Any person skilled in the art can modify or change the above-mentioned embodiments without departing from the spirit and scope of the present invention. Accordingly, it is intended that all equivalent modifications or changes which can be made by those skilled in the art without departing from the spirit and technical spirit of the present invention be covered by the claims of the present invention.
Claims (5)
1. The agrimonine can be used for preparing autophagy-lysosome signal pathway blockers.
2. Application of Erianin in preparing medicine for treating autophagy-lysosome signal pathway related diseases is provided.
3. Use according to any one of claims 1 to 2, wherein the concentration of agrimonine is between 1.6 and 6.4 uM.
4. Application of Erianin in inhibiting growth of colon cancer cells in vitro is provided.
5. The use of claim 4, wherein the colon cancer cells are HCT116 and HT29 cells.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111149262 | 2021-09-29 | ||
| CN2021111492620 | 2021-09-29 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN114129560A true CN114129560A (en) | 2022-03-04 |
Family
ID=80385565
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111502170.6A Pending CN114129560A (en) | 2021-09-29 | 2021-12-09 | Application of agrimonine as autophagy-lysosome signal pathway blocker |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114129560A (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1907277A (en) * | 2006-08-01 | 2007-02-07 | 湖北中医学院 | Use of short-leave geranium component in preparation of tumor growth and proliferation inhibitor |
| CN102836151A (en) * | 2012-09-28 | 2012-12-26 | 白银博赛宁生物科技有限公司 | Application of Brevilin A when serving as JAK-STATs signal target inhibitor |
-
2021
- 2021-12-09 CN CN202111502170.6A patent/CN114129560A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1907277A (en) * | 2006-08-01 | 2007-02-07 | 湖北中医学院 | Use of short-leave geranium component in preparation of tumor growth and proliferation inhibitor |
| CN102836151A (en) * | 2012-09-28 | 2012-12-26 | 白银博赛宁生物科技有限公司 | Application of Brevilin A when serving as JAK-STATs signal target inhibitor |
Non-Patent Citations (3)
| Title |
|---|
| MAGNOLIA MUK-LAN LEE等: "Synthesis and Evaluation of Novel Anticancer Compounds Derived from the Natural Product Brevilin A", ACS OMEGA ., vol. 5, no. 24, pages 14586 - 14596 * |
| PENGTAO YOU等: "Brevilin A induces apoptosis and autophagy of colon adenocarcinoma cell CT26 via mitochondrial pathway and PI3K/AKT/mTOR inactivation", BIOMED PHARMACOTHER ., vol. 98, pages 619 - 625, XP055723963 * |
| 邓梦: "短叶老鹳草素抗肿瘤活性及作用机制研究", 医药卫生科技辑, pages 057 - 550 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109837306A (en) | Contain the excretion body and its preparation method and application of miRNA-204-5p | |
| CN105483081A (en) | MiRNA145-5p-modified umbilical cord mesenchymal stem cell exosome and preparation and application of miRNA145-5p-modified umbilical cord mesenchymal stem cell exosome | |
| KR102105532B1 (en) | Method for derivation of inducible Pluripotent stem cells and inducible Pluripotent stem cells produced using the same | |
| Zhou et al. | Puerarin inhibits hepatocellular carcinoma invasion and metastasis through miR-21-mediated PTEN/AKT signaling to suppress the epithelial-mesenchymal transition | |
| US20230071726A1 (en) | Use of myog gene as target in preparation of drug for treating cardiomyocyte apoptosis-associated cardiovascular disease | |
| Han et al. | Exosome-like nanovesicles derived from Phellinus linteus inhibit Mical2 expression through cross-kingdom regulation and inhibit ultraviolet-induced skin aging | |
| CN113274411A (en) | Application of genetically modified bone marrow mesenchymal stem cell-derived microvesicles in preparation of medicines for treating renal injury | |
| Ni et al. | lncRNA GHET1 down-regulation suppresses the cell activities of glioma | |
| CN105441463A (en) | Panaxnotoginseng transcription factor gene PnbHLH1 and application thereof | |
| CN103316342A (en) | Applications of miR-31 inhibitor in inhibition of angiostenosis after damage | |
| CN114129560A (en) | Application of agrimonine as autophagy-lysosome signal pathway blocker | |
| CN109674913A (en) | A kind of technique that addition compound bacteria fermentation prepares arisaema cum bile | |
| CN110025626B (en) | Application of morroniside in preparation of medicine for treating acute enteritis | |
| CN109748982B (en) | Preparation method and application of inonotus obliquus polysaccharide | |
| CN103768117A (en) | Application of Eclipta prostrate extract in preparation of anti-pulmonary fibrosis drugs | |
| KR20170057020A (en) | Cosmetic composition with the extract of Cornus officinalis for the improvement of skin redness or face redness | |
| CN105200057B (en) | The method for improving content of phenolic compounds in plant using miR397a | |
| Kanthale et al. | Pharmacognostic study of adhatoda vasica Nees | |
| CN106540274B (en) | A kind of application of miRNA in preparation treatment silicosis drug | |
| JP5937782B2 (en) | V-type collagen gene transcription promoter | |
| Yao et al. | Protective effects of Zishen Huoxue recipe against neuronal injury in the neurovascular unit of rats with vascular dementia by interfering with inflammatory cascade-induced pyroptosis | |
| Patel | Wood anatomy of the dicotyledons indigenous to New Zealand 16. Lauraceae | |
| CN113599412A (en) | Application of radix codonopsis and radix astragali composition in preparation of medicine for preventing and treating symptoms related to advanced tumor | |
| Nguyen | Study on extraction of tannins from the garcinia mangostana linn peel in Vietnam | |
| CN113876645B (en) | Usnea barbata extract, application thereof and skin external preparation containing same |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |