CN114107384A - Vector targeting EML4-ALK fusion gene variant 1 in human non-small cell lung cancer cell strain and application - Google Patents

Abstract

The invention relates to the technical field of biology, and in particular relates to a vector of an EML4-ALK fusion gene variant 1 in a targeted human non-small cell lung cancer cell strain and application thereof. The vector is a lentiviral vector comprising functional elements such as green fluorescent gene EGFP, puromycin resistance gene, Cas9 protein coding gene, sgRNA target points aiming at EML4 and ALK respectively and the like. The vector can specifically affect the expression of the EML4-ALK fusion gene variant 1, does not affect the normal expression of the EML4 and ALK genes, and can be used for treating related diseases caused by the EML4-ALK variant 1 in clinic.

Description

Vector targeting EML4-ALK fusion gene variant 1 in human non-small cell lung cancer cell strain and application

Technical Field

The invention relates to the technical field of biology, and in particular relates to a vector of an EML4-ALK fusion gene variant 1 in a targeted human non-small cell lung cancer cell strain and application thereof.

Background

Lung cancer is one of the most common causes of death worldwide, with non-small cell lung cancer (NSCLC) being one of the leading causes of death. Most patients have been diagnosed with advanced disease and generally have only been treated conservatively. The identification of the molecular mechanisms of the onset of the disease and the targeted treatment are of great benefit for the improvement and prevention of clinical lung cancer treatment.

In 2007, in a Japanese non-small cell lung cancer (NSCLC) clinical study, it is found that a part of patients have the fusion of Anaplastic Lymphoma Kinase (ALK) and acanthomicrotubule-associated protein-like protein 4(EML4), can express an unconventional transformation fusion kinase, and can be used as a candidate therapeutic target and a diagnostic molecular marker of the NSCLC. This study showed that in non-small cell lung cancer (NSCLC) cells, a small inversion within chromosome 2p results in the formation of variant 1 of the EML4-ALK fusion gene, which includes a portion of EML4 and ALK. In addition, the presence of EML4-ALK fusions was reported in 3% -13% of lung tumors in a clinical study mainly involving east asian patients, corresponding to nearly 7 million such patients diagnosed each year worldwide. Further studies have found that EML4-ALK gene fusion is the most common and unique pathological feature in lung cancer patients and lung cancer cell lines. There are also some reports that EML4-ALK is found in other cancers, including breast and colorectal cancers.

Chromosomal inversion does not always occur at the same location, all of which involve the intracellular tyrosine kinase domain of ALK, starting from the portion encoded by exon 20. However, EML4 was truncated to varying degrees and produced various EML4-ALK variants. At least 11 different variants have been reported, the most common variants being E13-A20 (referring to the ALK (A) fused exon in EML4 (E)) and E6a/b-A20, also referred to as variants 1 and 3a/b, respectively. These two are the most common variations of EML4-ALK, detected in 33% and 29% of non-small cell lung cancer patients, respectively. NSCLC cell line NCI-H3122 and DFCI032 contain E13; a20 variant, whereas NCI-H2228 contained E6 a/b.

Currently, conventional chemotherapy and the like and inhibitor therapy for ALK kinase are mainly used for non-small cell lung cancer of EML4-ALK, but the effect is not significant. In recent years, the use of gene-targeted drugs has been proposed as first-line therapy, a gene-level therapy based on specific mutations of cancer cells. The CRISPR/Cas9 system is a powerful tool for gene editing that has been developed in recent years, allowing precise editing of the genome of most species. When a cell is co-transfected with a gene encoding Cas9 protein and sgRNA, the sgRNA can target a target sequence, and the Cas9 protein can break a corresponding DNA double strand. However, since EML4-ALK is a gene fusion due to gene translocation, conventional gene editing protocols for EML4 and ALK would affect the expression of the normal EML4 and ALK genes while targeting the EML4-ALK fusion gene variant 1.

Disclosure of Invention

In order to solve the technical problems in the prior art, the invention provides a vector targeting the EML4-ALK fusion gene variant 1 in the human non-small cell lung cancer cell line NCI-H3122, which can specifically affect the expression of the EML4-ALK fusion gene variant 1 without affecting the normal expression of the EML4 and ALK genes.

The technical scheme of the invention is as follows.

The invention provides a vector of EML4-ALK fusion gene variant 1 in a targeted human non-small cell lung cancer cell strain, which comprises the following functional elements: green fluorescent gene GFP, puromycin resistance gene, Cas9 protein encoding gene, sgRNA target point EML4-sgRNA aiming at EML4, and sgRNA target point ALK-sgRNA aiming at ALK.

In one embodiment of the invention, the vector takes CMV-Puro (mutant) -T2A-EGFP-pLentiCRISPRV2GFP as an initial vector, and the sequence is shown as SEQ ID NO. 1. The vector simultaneously contains functional elements such as Cas9 protein, green fluorescent protein GFP, puromycin resistance gene and the like.

Preferably, the puromycin resistance gene and the green fluorescent protein GFP are connected in series by a T2A element, expression of which is initiated by the CMV promoter.

Preferably, the Cas9 protein is expressed from the EF1a promoter.

Preferably, the sgRNA targets are all initiated by U6 without interfering with each other.

Preferably, the nucleotide sequence of the EML4-sgRNA is shown in SEQ ID NO. 2; the nucleotide sequence of the ALK-sgRNA is shown in SEQ ID NO. 3.

The invention also provides a preparation method of the carrier, which comprises the following steps:

s1: selecting and screening an EML4-sgRNA target site;

s2: selecting and screening an ALK-sgRNA target site;

s3: and constructing a vector simultaneously containing EML4-sgRNA and ALK-sgRNA.

The invention also provides a cell expressing the vector.

In one embodiment of the invention, the cell is a mammalian tumor cell.

In one embodiment of the invention, the cell is a human non-small cell lung cancer cell.

In one embodiment of the invention, the human non-small cell lung cancer cell is specifically NCI-H3122.

The invention also provides the application of the vector or the cell.

In one embodiment of the invention, the application is an application in preparing a medicament for preventing and treating tumor diseases.

Preferably, the neoplastic disease is lung cancer.

In one embodiment of the present invention, the function verification of the carrier includes: the cell functions of the EML4-ALK knockout cell line, the EML4-ALK control cell line and the NCI-H3122 primary cell line were subjected to WB detection, cell proliferation detection and colony formation detection.

In one embodiment of the present invention, the cell proliferation potency assay uses the CCK8 assay. The results are shown in FIG. 9. The EML4-ALK knockout group (pg) cells had significantly reduced proliferation rates compared to con and NC groups.

In one embodiment of the invention, the proteins detected by WB include the apoptosis inhibitor gene Survivin and the cancer suppressor gene BIM. Survivin has tumor specificity, is only expressed in tumor and embryonic tissues, and is closely related to the differentiation, proliferation, infiltration and metastasis of tumor cells. BIM is named as BCL2-like 11, is a member of BCL-2 protein family, and is one of the most active pro-apoptotic proteins. The results are shown in FIG. 10: the expression of an apoptosis suppressor gene Survivin in an EML4-ALK gene knockout group (pg) is obviously reduced, and the expression of an cancer suppressor gene BIM in an EML4-ALK gene knockout group (pg) is obviously increased. This indicates that the EML4-ALK gene knockout is beneficial to inhibiting the rapid growth of tumor cells.

In one embodiment of the present invention, a clonogenic assay is used to examine the amplification and proliferation potency of the NCI-H3122 cell line following the EML4-ALK fusion gene variant 1 knockout. The results are shown in FIG. 11: the clone formation number of the EML4-ALK gene knockout group (pg) is obviously lower than that of the control group, which shows that the clonogenic capacity of NCI-H3122 cells is obviously reduced after the ENL4-ALK gene is knocked out.

Additional aspects and advantages of the invention will be set forth in part in the description which follows and, in part, will be obvious from the description, or may be learned by practice of the invention.

The invention provides a targeted solution by combining CRISPR-Cas9 technology and EML4-ALK fusion gene characteristics. Specifically, the invention provides a genetic engineering vector which contains an sgRNA target simultaneously targeting an EML4 intron and an ALK intron, can specifically knock out a functional domain of an EML4-ALK fusion gene characteristically, does not influence the normal expression of an EML4 gene and an ALK gene, and is verified in a NSCLC cell strain NCI-H3122 containing the most common EML4-ALK variant 1 to prove the effectiveness of the sgRNA target. Therefore, the invention provides a potential gene therapy method aiming at the EML4-ALK variant 1, is beneficial to treating relevant diseases caused by the mutation in clinic, and has scientific research significance and clinical value for treating the non-small cell lung cancer.

Drawings

FIG. 1 is a gel electrophoresis chart for identifying the EML4-ALK gene fusion in NCI-H3122 in example 1 of the present invention.

FIG. 2 is a comparison chart of the sequencing results of the EML4-ALK fusion gene in NCI-H3122 in example 1 of the present invention.

FIG. 3 is a graph showing the effect of transfection of EML4-sgRNA in example 2 of the present invention.

FIG. 4 is a graph showing the effect of ALK-sgRNA transfection in example 2 of the present invention.

FIG. 5 is a diagram of gel electrophoresis of amplified EML 4-containing and ALK targets in example 2 of the present invention.

FIG. 6 is a map of sgRNA-Cas9 vectors containing targeting EML4 and ALK, respectively, in example 2 of the invention.

FIG. 7 is a gel electrophoresis chart showing the gene identification of the EML4-ALK knock-out cell line in example 3 of the present invention.

FIG. 8 is a comparative sequence chart showing the gene identification of EML4-ALK knock-out cell line in example 3 of the present invention.

FIG. 9 shows the CCK8 experiment for detecting the proliferation potency of EML4-ALK knockout cell line in example 4 of the present invention.

FIG. 10 shows the WB assay to detect the expression of proteins related to the EML4-ALK knockout cell line in example 4 of the present invention.

FIG. 11 shows a monoclonal generation experiment for testing the single cell clonogenic capacity of the EML4-ALK knockout cell strain of example 4 of the present invention.

Detailed Description

In order to explain technical contents, achieved objects, and effects of the present invention in detail, the following description is made with reference to the accompanying drawings in combination with the embodiments. The test methods used in the examples are all conventional methods unless otherwise specified; the materials, reagents and the like used are commercially available reagents and materials unless otherwise specified.

Example 1 identification of EML4-ALK fusion Gene variant 1 in human non-Small cell Lung cancer cell line NCI-H3122

1.1 genome extraction

The genome of the normal human non-small cell lung cancer cell line NCI-H3122 was extracted using a genome extraction kit (purchased from tiangen, cat # DP304-03) according to the instructions.

1.2 genomic PCR

Design of genomic amplification primers

EML4-ALK-GF1:TTCTGGCATGTGCAAGAAGT(SEQ ID NO.4)

EML4-ALK-GR1:ACCTGGCCTTCATACACCTC(SEQ ID NO.5)

EML4-ALK-GF2:GTTATCACAGCACCGCAGAC(SEQ ID NO.6)

The NCI-H3122 genome was amplified using EML-ALK-GF1 and EML-ALK-GR1, and the amplified DNA products were identified by gel electrophoresis, and the identification maps are shown in FIG. 1. The PCR products were sequenced with EML4-ALK-GF1 and EML4-ALK-GF2, respectively, and the sequencing results were aligned to the expected recombinant genomic sequence. The alignment results are shown in FIG. 2. As can be seen from the figure, the normal NCI-H3122 cell line (control) and the cell line (NC) transfected with the control plasmid were identified to contain a 5.5kb band, whereas the cell line (pg) transfected with the sgRNA-cas9 plasmid targeting EML4-ALK was identified to contain a 5.5kb band (normal band) and a 447bp fragment (knock-out band). The expected EML4-ALK fusion gene variant 1 exists in the human non-small cell lung cancer cell line NCI-H3122. And the sequences of the intron 11 part and intron 12 of the EML4 and the sequence of the ALK intron 21 are obtained respectively, so that the sgRNA targets aiming at the EML4 and the ALK respectively can be designed.

Example 2 vector construction targeting EML4-ALK fusion Gene variant 1

2.1 screening for suitable fragments of EML4-sgRNA target sequence

2.1.1 selection of EML4-sgRNA target sites

The genomic sequence of the obtained human EML4 intron 11 was sequenced according to example 1, the website was designed with reference to the sgRNA target, and 3 target sites were selected for testing. The test sequence is as follows:

EML4-sg1：5`-TGCTACTTACAATTAACGAT-3`；

EML4-sg2：5`-GCTACTTACAATTAACGATA-3`；

EML4-sg3：5`-CAGATTGTTTTAATGTCATT-3`。

2.1.2 EML4-sgRNA target site screening

A gRNA activity fluorescence detection kit (purchased from Beijing synbiotic gene, cat # HS-SR-0001A) is used for constructing a detection vector according to the operation steps of a product instruction book and carrying out a cell experiment. The experimental results are shown in fig. 3 (high fluorescence ratio of No.1 and No.2 targets, low fluorescence ratio of No.3 targets), and the fluorescence ratio is the highest in the cell experiments performed by the selected No.2 target sequence. According to the detection principle of the used gRNA activity fluorescence detection kit, the higher the fluorescence ratio, the higher the ratio of the cells with the target sequence cleaved (the target sequence is cleaved by the Cas9 protein, and then homologous recombination is carried out, the cells express fluorescence), so the target sequence is more easily cleaved by the Cas9 protein.

According to the experimental screening results, the invention selects EML4-sgRNA target sites EML4-sg 2:

5 '-GCTACTTACAATTAACGATA-3' (SEQ ID NO.2) for subsequent experiments.

2.2 screening for suitable fragments of ALK-sgRNA target sequences

2.2.1 selection of EML4-sgRNA target sites

The genomic sequence of the human gene ALK intron 21 obtained was sequenced according to example 1, the website was designed with reference to the sgRNA target, and 3 target sites were selected for testing. The test sequence is as follows:

ALK-sg1：5`-ATTTAGTGGACAAACACGAG-3`；

ALK-sg2：5`-TAGTGGACAAACACGAGAGG-3`；

ALK-sg3：5`-GGTAAGAAGGATTCCAACCA-3`。

2.2.2 ALK-sgRNA target site screening

A gRNA activity fluorescence detection kit (purchased from Beijing synbiotic gene, cat # HS-SR-0001A) is used for constructing a detection vector according to the operation steps of a product instruction book and carrying out a cell experiment. The experimental results are shown in FIG. 4 (high fluorescence ratio of No.3 target, slightly low fluorescence ratio of No.1 and No.3 target), and the selected No.3 target sequence has the highest fluorescence ratio in the cell experiment. According to the detection principle of the used gRNA activity fluorescence detection kit, the higher the fluorescence ratio, the higher the ratio of the cells with the target sequence cleaved (the target sequence is cleaved by the Cas9 protein, and then homologous recombination is carried out, the cells express fluorescence), so the target sequence is more easily cleaved by the Cas9 protein.

According to the experimental screening result, the invention selects an ALK-sgRNA target site ALK-sg 3:

5 '-GGTAAGAAGGATTCCAACCA-3' (SEQ ID NO.3) for subsequent experiments.

2.3 construction of CRISPR vectors containing EML4-sgRNA2 and ALK-sgRNA3

2.3.1 amplification of a fragment containing both EML4-sgRNA2 and ALK-sgRNA3

Primers were designed for amplification based on the EML4-sgRNA2 and ALK-sgRNA3 target sequences. The size of the product is 454bp

(see FIG. 5). Recovery of the gel was performed using a gel recovery kit (purchased from Tiangen, cat # DP 209).

The primer sequence is as follows:

double sgRNA-F:

5`-tgtggaaaggacgaaacaccGCTACTTACAATTAACGATAGTTTAAGAGCTATGCT-3`(SEQ ID NO.7)

a double sgRNA-R;

5`-gctatttctagctctaaaacTGGTTGGAATCCTTCTTACCGGTGTTTCGTCCTTTC-3`(SEQ ID NO.8)

2.3.2 recombinant vector construction

2.3.2.1 cleavage of empty vector

The lentiviral vector CMV-Puro (mutant) -T2A-EGFP-pLentiCRISPRV2GFP (purchased from a Buerger organism, sequence shown in SEQ ID NO.1) was extracted using a kit for in-plasmid extraction (purchased from Magen, cat # P1155-03). The digestion was carried out for 1 hour at 37 ℃ with temperature control using BsmBI on a PCR instrument, and the digestion product was purified. The cleavage system is shown in Table 1

TABLE 1 original empty plasmid digestion System

Original empty plasmid	2ug
		Buffer	5ul
BsmBI	2ul
		ddH2O	Supplementing to 50ul

2.3.2.2 homologous joining

And (3) controlling the temperature of the obtained purified product after enzyme digestion and the PCR glue recovery product on a PCR instrument, connecting the purified product and the PCR glue recovery product at the constant temperature of 50 ℃ for 15min, and performing homologous recombination. The attachment system is shown in Table 2.

TABLE 2 ligation reaction System for homologous recombination

Components	Volume of
		Backbone plasmid linearization enzyme digestion recovery product	50ng
The gene or fragment to be inserted	100ng
		2×GenRec Assembly Master Mix	5ul
ddH2O	Make up to 10ul

2.3.2.3 clone construction and verification

The ligation-completed mixture was subjected to transformation experiments using competent cells (purchased from Bomaide, cat # BC102-02) according to the product instructions. And (4) selecting the monoclonal for sequencing, and comparing sequencing results to determine that the construction of the co-expression vector is successful. The constructed vector map is shown in FIG. 6.

Example 3 knock-out and screening of EML4-ALK fusion Gene variant 1 in human non-Small cell Lung cancer cell line NCI-H3122

3.1 culturing NCI-H3122 cells

The NCI-H3122 cells were recovered and cultured. The formulation of the cell culture medium is shown in table 3 below:

TABLE 3 composition of NCI-H3122 cell complete Medium

3.2 transfection of cells

The transfection reagent (cat number: HB-TRLF-1000) of Henan organism is adopted in the invention, and transfection is carried out according to the steps of the product instruction (NC-sgRNA-Cas9, control plasmid, no sg target spot; EML4-ALK-sgRNA-Cas9, including target spots aiming at EML4 and ALK respectively). On the third day after transfection (after 72 hours), the proportion of cells with green fluorescence was observed, and the more cells positive in the proportion of green fluorescence in the microscopic field, the stronger the green fluorescence, indicating that the transfection efficiency was higher.

3.3 puromycin screening Positive clones

Cells transfected with 3.2 cells were used, and puromycin was added to the complete medium of normal NCI-H3122 cells (see Table 1 for components), and cell selection was performed. The puromycin used in the invention has the screening concentration of 2 mu g/ml and the screening time of 3 days. After 3 days of screening, the cells were replaced with normal NCI-H3122 complete medium. Through puromycin screening, cells transfected successfully aiming at an EML4-ALK double sgRNA/Cas9 co-expression vector can be enriched.

3.4 genomic PCR identification of Positive clones

3.3 cells were collected, and the genome was extracted using a genome extraction kit (purchased from Tiangen, cat # DP 304-03).

The extracted genome was PCR amplified using the validated primer pairs EML-ALK-GF1 and EML-ALK-GR 2. The amplified DNA products were identified by gel electrophoresis, and the identification map is shown in FIG. 7. From the electrophoretogram, the cell transfected with EML4-ALK-sgRNA-Cas9 contained a small band compared with the normal NCI-H3122 cell in addition to the original fragment (5564bp) by genomic PCR amplification, which is consistent with the expectation (the expected fragment size is 446 bp). Sequencing the PCR product, and comparing the sequencing result with the expected gene sequence after double sgRNA knockout. The alignment results are shown in FIG. 8. As can be seen from the figure, after double sgRNA-cas9 gene editing of the EML4-ALK variant 1, the expected gene knockout of the EML4-ALK fusion gene variant 1 was found in the human non-small cell lung cancer cell line NCI-H3122, and therefore, it was judged that a cell line in which a part of the coding region of the EML4-ALK fusion gene variant 1 was knocked out was obtained and was named as EML4-ALK knockout (pg). Whereas the NC-sgRNA-Cas9 transfected sample contained only the original band and was named EML 4-ALK-control (NC).

Example 4 functional validation of EML 4-ALK-knockout cell line

4.1 CCK8 detection of proliferation of EML4-ALK knockout cell line

4.1.1 culturing Normal NCI-H3122 cells (control group, con), EML 4-ALK-control cells (NC) transfected with control plasmid, and EML 4-ALK-knock-out cells (pg) transfected with sgRNA plasmid, respectively. The NCI-H3122 cells in the logarithmic growth phase of each group were digested with 0.25% trypsin and counted.

4.1.2 cells were seeded into 96-well plates at a density of 5000 cells/well and culture continued.

4.1.3 after the cells attached, CCK8 assays were performed at 24h, 48h, 72h after transfection.

4.1.4 groups of cells at the time of examination, 1/10 volumes of CCK8 were added per well at 37 deg.C with 5% CO₂The culture was carried out in an incubator for 4 hours.

4.1.5 selecting 450nm wavelength, measuring the light absorption value of each hole on an enzyme-linked immunosorbent instrument, recording the result, and drawing a cell growth curve by taking time as an abscissa and an OD value as an ordinate. The results are shown in FIG. 9. The EML4-ALK knockout group (pg) cells had significantly reduced proliferation rates compared to con and NC groups.

4.2 WB detection of expression of tumor apoptosis and inhibition-associated protein of EML4-ALK knockout cell line

4.2.1 protein extraction

4.2.1.1 collection of samples: the centrifuged cells were washed with 1ml of physiological saline and transferred to a 1.5ml centrifuge tube.

4.2.1.2 mu.l PMSF (100mM) was added to 1ml of the lysate and shaken well on ice. (PMSF could be mixed with the lysate until no crystals were present after shaking.)

4.2.1.3 depending on the amount of cells, 500. mu.l of lysis solution containing PMSF was added to each tube of cells and lysed on ice for 30 min.

4.2.1.44 ℃ for 10min at 12000 rpm. The centrifuged supernatant was transferred to a 1.5ml centrifuge tube for quantitative detection of protein. If the protein concentration cannot be quantified timely, please preserve at-80 ℃.

4.2.2 protein quantification and processing (BCA method)

4.2.2.1 when the BCA kit is used, the Solution A in the BCA kit is shaken and uniformly mixed, an appropriate amount of BCA working Solution is prepared by adding 1 volume of Solution B (50:1) to 50 volumes of Solution A according to the number of samples, and the mixture is fully and uniformly mixed to obtain the light green working Solution. The BCA working solution is stable within 24h at room temperature.

4.2.2.2 standards (1mg/ml BSA) were added to the 96 well plates in amounts of 0, 1, 2, 4, 6, 8, 10. mu.l, respectively, and all standards were made up to 10. mu.l with deionized water.

4.2.2.3 Add 1. mu.l of sample to 96-well plate and make up to 10. mu.l with deionized water.

4.2.2.4 mu.l BCA working solution was added to each well, gently pipetted and mixed (care was taken not to generate air bubbles to avoid affecting the reading) and incubated at 37 ℃ for 30 min.

4.2.2.5 after cooling to room temperature, the absorbance of A562 was measured using a microplate reader.

4.2.2.6 the concentration of protein in the sample is calculated from the standard curve.

4.2.2.7 protein denaturation treatment: protein solution and 5 × loading buffer according to the volume ratio of 4: 1 (the protein concentration is 0.8 times of the actual concentration), boiling in boiling water for 10min, cooling, and performing SDS-PAGE electrophoresis, or storing at-80 deg.C to avoid repeated freeze thawing.

4.2.2.8 formula for calculating protein concentration

The exemplary standard notes are: y ═ aX + b (Y is OD value, X is measured concentration)

Sample protein concentration ═ [ (Y-b)/a ] × dilution factor

4.2.3 Western Blot

4.2.3.1 preparation of separation gel and concentrated gel: according to the molecular weight of the target protein, separating gel and concentrated gel are prepared;

4.2.3.2 Loading: the volume of the solution containing 20. mu.g of protein was calculated as the amount of the sample. Supplementing the sample wells with 1 × loading buffer until the total volume of each sample well is consistent;

4.2.3.3 electrophoresis: the voltage of the concentrated gel is 80V for 40min, and the voltage of the separated gel is 120V for 30-50 min. Stopping electrophoresis when bromophenol blue runs to the bottom of the gel, and performing membrane transfer;

4.2.3.4 transfer film: constant pressure 100V, 0.45 μm PVDF membrane;

4.2.3.5 sealing: completely immersing the PVDF membrane in 5% mil-PBST or 5% BSA-PBST, and gently shaking at room temperature for 60min or overnight at 4 ℃;

4.2.3.6 Primary antibody incubation: primary antibody was diluted with 5% BSA-PBST and incubated overnight at 4 ℃;

4.2.3.7 washing the membrane: taking out PVDF membrane the next day, washing membrane with PBST for 5 times, each time for 6 min;

4.2.3.8 secondary antibody incubation: PBST diluted secondary antibody, room temperature incubation for 60 min;

4.2.3.9 washing the membrane: PBST membrane washing for 5 times, 6min each time;

4.2.3.10 developing: and mixing the ECL A liquid and the ECL B liquid according to the volume of 1:1, uniformly dripping the mixed liquid on a film, setting exposure time and exposure type according to requirements, starting exposure, storing a picture after the exposure is finished, and exporting the picture.

4.2.4 image analysis

The Image was subjected to gradation analysis using Image analysis software Image J.

The results are shown in FIG. 10: the expression of an apoptosis suppressor gene Survivin in an EML4-ALK gene knockout group (pg) is obviously reduced, and the expression of an cancer suppressor gene BIM in an EML4-ALK gene knockout group (pg) is obviously increased. This indicates that the EML4-ALK gene knockout is beneficial to inhibiting the rapid growth of tumor cells.

4.3 clonogenic assay to detect the Single-cell clonogenic Capacity of EML4-ALK knockout cell line

4.3.1 Normal NCI-H3122 cells (control group, con), EML 4-ALK-control cells (NC) transfected with control plasmid, and EML 4-ALK-knock-out cells (pg) transfected with sgRNA plasmid were cultured, respectively. The NCI-H3122 cells in the logarithmic growth phase of each group were digested with 0.25% trypsin and counted.

4.3.2 cells are inoculated in 35mm cell culture dishes in the number of 500 cells per dish, 2mL of culture medium is added into each dish, the rotation is performed slightly, the cells are dispersed uniformly, and the cells are treated according to experimental groups after being attached to the wall.

4.3.3 placing at 37 deg.C, 5% CO₂The cells were cultured in a cell incubator for 14 days.

4.3.4 after macroscopic colonies appeared, the cell culture medium was discarded, rinsed 2 times carefully with PBS, and fixed with 4% paraformaldehyde at room temperature for 20 min.

4.3.5 discard the fixative and rinse 1 time with PBS. After the crystal violet is dyed at room temperature for 10min, the dye liquor is washed off by running water and dried in the air.

4.3.6 Place the plate upside down on a piece of white paper, place it in the bright place, and take a picture with a common camera.

4.3.7 the dishes were placed on a piece of transparent film with a grid and the colonies were counted directly with the naked eye.

4.3.8 the clone formation rate was calculated. The clone formation rate was ═ (number of clones/seeded cells) × 100%.

The results are shown in FIG. 11: the clone formation number of the EML4-ALK gene knockout group (pg) is obviously lower than that of the control group, which shows that the clonogenic capacity of NCI-H3122 cells is obviously reduced after the ENL4-ALK gene is knocked out.

Lung cancer is one of the most common causes of death worldwide, with non-small cell lung cancer (NSCLC) being one of the leading causes of death. According to the research, the EML4-ALK gene fusion is an important pathogenic factor causing non-small cell lung cancer in east Asia region, and has different variation types. Among them, the EML4-ALK variant 1(E13-A20) is the most common type. Current treatments for non-small cell lung cancer caused by EML4-ALK mainly involve either conventional chemotherapy or the use of inhibitors against ALK kinase. However, chemotherapy has very serious side effects and does not have gene targeting. The ALK inhibitor can destroy the normal ALK gene in the cell while targeting the EML4-ALK fusion gene, so that the specificity of the target is not strong. The solution provided by the invention is based on a CIRCR/Cas 9 system, selects a target spot of a specific targeting EML4-ALK fusion gene intron, and does not influence the expression of the normal EML4 gene and ALK gene in cells. And the sgRNA targeting the intron of the EML4 and ALK genes is simultaneously connected to one vector, so that the EML4-ALK fusion gene variant 1 can be specifically knocked out.

The invention uses the provided vector targeting EML4-ALK fusion gene variant 1 in the human non-small cell lung cancer cell strain NCI-H3122 to construct and identify a gene editing tool cell strain knocked out by EML4-ALK fusion gene variant 1 in a human non-small cell lung cancer cell strain NCI-H3122 containing EML4-ALK variant 1 (E13-A20). Through different cell function tests and detection means such as WB (white cell line) inspection, CCK (clinical laboratory kit) 8 inspection, clone formation detection and the like, the cell proliferation capacity of the EML4-ALK fusion gene variant 1 knockout cell is slowed down, the expression of apoptosis inhibition related protein is reduced, the protein expression of cancer suppressor genes is increased, the significant difference between a cell strain after gene knockout and an original cell is proved, and a new selection scheme is provided for clinically treating non-small cell lung cancer caused by the EML4-ALK fusion gene variant 1. Therefore, the invention provides a vector which can specifically knock out the EML4-ALK fusion gene variant 1 without influencing the expression of the normal EML4 and ALK genes, verifies the effect at the cellular level and has important clinical value and scientific research significance.

The above description is only an embodiment of the present invention, and not intended to limit the scope of the present invention, and all equivalent changes made by using the contents of the present specification and the drawings, or applied directly or indirectly to the related technical fields, are included in the scope of the present invention.

Sequence listing

<110> New Material Ltd of Hu nan Asia Dafenghui

<120> vector of EML4-ALK fusion gene variant 1 in targeting human non-small cell lung cancer cell strain and application

<160> 8

<170> SIPOSequenceListing 1.0

<210> 1

<211> 14365

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

gagggcctat ttcccatgat tccttcatat ttgcatatac gatacaaggc tgttagagag 60

ataattagaa ttaatttgac tgtaaacaca aagatattag tacaaaatac gtgacgtaga 120

aagtaataat ttcttgggta gtttgcagtt ttaaaattat gttttaaaat ggactatcat 180

atgcttaccg taacttgaaa gtatttcgat ttcttggctt tatatatctt gtggaaagga 240

cgaaacaccg gagacggacg tctctgtttt agagctagaa atagcaagtt aaaataaggc 300

tagtccgtta tcaacttgaa aaagtggcac cgagtcggtg cttttttgaa ttcgctagct 360

aggtcttgaa aggagtggga attggctccg gtgcccgtca gtgggcagag cgcacatcgc 420

ccacagtccc cgagaagttg gggggagggg tcggcaattg atccggtgcc tagagaaggt 480

ggcgcggggt aaactgggaa agtgatgtcg tgtactggct ccgccttttt cccgagggtg 540

ggggagaacc gtatataagt gcagtagtcg ccgtgaacgt tctttttcgc aacgggtttg 600

ccgccagaac acaggaccgg ttctagagcg ctgccaccat ggacaagaag tacagcatcg 660

gcctggacat cggcaccaac tctgtgggct gggccgtgat caccgacgag tacaaggtgc 720

ccagcaagaa attcaaggtg ctgggcaaca ccgaccggca cagcatcaag aagaacctga 780

tcggagccct gctgttcgac agcggcgaaa cagccgaggc cacccggctg aagagaaccg 840

ccagaagaag atacaccaga cggaagaacc ggatctgcta tctgcaagag atcttcagca 900

acgagatggc caaggtggac gacagcttct tccacagact ggaagagtcc ttcctggtgg 960

aagaggataa gaagcacgag cggcacccca tcttcggcaa catcgtggac gaggtggcct 1020

accacgagaa gtaccccacc atctaccacc tgagaaagaa actggtggac agcaccgaca 1080

aggccgacct gcggctgatc tatctggccc tggcccacat gatcaagttc cggggccact 1140

tcctgatcga gggcgacctg aaccccgaca acagcgacgt ggacaagctg ttcatccagc 1200

tggtgcagac ctacaaccag ctgttcgagg aaaaccccat caacgccagc ggcgtggacg 1260

ccaaggccat cctgtctgcc agactgagca agagcagacg gctggaaaat ctgatcgccc 1320

agctgcccgg cgagaagaag aatggcctgt tcggaaacct gattgccctg agcctgggcc 1380

tgacccccaa cttcaagagc aacttcgacc tggccgagga tgccaaactg cagctgagca 1440

aggacaccta cgacgacgac ctggacaacc tgctggccca gatcggcgac cagtacgccg 1500

acctgtttct ggccgccaag aacctgtccg acgccatcct gctgagcgac atcctgagag 1560

tgaacaccga gatcaccaag gcccccctga gcgcctctat gatcaagaga tacgacgagc 1620

accaccagga cctgaccctg ctgaaagctc tcgtgcggca gcagctgcct gagaagtaca 1680

aagagatttt cttcgaccag agcaagaacg gctacgccgg ctacattgac ggcggagcca 1740

gccaggaaga gttctacaag ttcatcaagc ccatcctgga aaagatggac ggcaccgagg 1800

aactgctcgt gaagctgaac agagaggacc tgctgcggaa gcagcggacc ttcgacaacg 1860

gcagcatccc ccaccagatc cacctgggag agctgcacgc cattctgcgg cggcaggaag 1920

atttttaccc attcctgaag gacaaccggg aaaagatcga gaagatcctg accttccgca 1980

tcccctacta cgtgggccct ctggccaggg gaaacagcag attcgcctgg atgaccagaa 2040

agagcgagga aaccatcacc ccctggaact tcgaggaagt ggtggacaag ggcgcttccg 2100

cccagagctt catcgagcgg atgaccaact tcgataagaa cctgcccaac gagaaggtgc 2160

tgcccaagca cagcctgctg tacgagtact tcaccgtgta taacgagctg accaaagtga 2220

aatacgtgac cgagggaatg agaaagcccg ccttcctgag cggcgagcag aaaaaggcca 2280

tcgtggacct gctgttcaag accaaccgga aagtgaccgt gaagcagctg aaagaggact 2340

acttcaagaa aatcgagtgc ttcgactccg tggaaatctc cggcgtggaa gatcggttca 2400

acgcctccct gggcacatac cacgatctgc tgaaaattat caaggacaag gacttcctgg 2460

acaatgagga aaacgaggac attctggaag atatcgtgct gaccctgaca ctgtttgagg 2520

acagagagat gatcgaggaa cggctgaaaa cctatgccca cctgttcgac gacaaagtga 2580

tgaagcagct gaagcggcgg agatacaccg gctggggcag gctgagccgg aagctgatca 2640

acggcatccg ggacaagcag tccggcaaga caatcctgga tttcctgaag tccgacggct 2700

tcgccaacag aaacttcatg cagctgatcc acgacgacag cctgaccttt aaagaggaca 2760

tccagaaagc ccaggtgtcc ggccagggcg atagcctgca cgagcacatt gccaatctgg 2820

ccggcagccc cgccattaag aagggcatcc tgcagacagt gaaggtggtg gacgagctcg 2880

tgaaagtgat gggccggcac aagcccgaga acatcgtgat cgaaatggcc agagagaacc 2940

agaccaccca gaagggacag aagaacagcc gcgagagaat gaagcggatc gaagagggca 3000

tcaaagagct gggcagccag atcctgaaag aacaccccgt ggaaaacacc cagctgcaga 3060

acgagaagct gtacctgtac tacctgcaga atgggcggga tatgtacgtg gaccaggaac 3120

tggacatcaa ccggctgtcc gactacgatg tggaccatat cgtgcctcag agctttctga 3180

aggacgactc catcgacaac aaggtgctga ccagaagcga caagaaccgg ggcaagagcg 3240

acaacgtgcc ctccgaagag gtcgtgaaga agatgaagaa ctactggcgg cagctgctga 3300

acgccaagct gattacccag agaaagttcg acaatctgac caaggccgag agaggcggcc 3360

tgagcgaact ggataaggcc ggcttcatca agagacagct ggtggaaacc cggcagatca 3420

caaagcacgt ggcacagatc ctggactccc ggatgaacac taagtacgac gagaatgaca 3480

agctgatccg ggaagtgaaa gtgatcaccc tgaagtccaa gctggtgtcc gatttccgga 3540

aggatttcca gttttacaaa gtgcgcgaga tcaacaacta ccaccacgcc cacgacgcct 3600

acctgaacgc cgtcgtggga accgccctga tcaaaaagta ccctaagctg gaaagcgagt 3660

tcgtgtacgg cgactacaag gtgtacgacg tgcggaagat gatcgccaag agcgagcagg 3720

aaatcggcaa ggctaccgcc aagtacttct tctacagcaa catcatgaac tttttcaaga 3780

ccgagattac cctggccaac ggcgagatcc ggaagcggcc tctgatcgag acaaacggcg 3840

aaaccgggga gatcgtgtgg gataagggcc gggattttgc caccgtgcgg aaagtgctga 3900

gcatgcccca agtgaatatc gtgaaaaaga ccgaggtgca gacaggcggc ttcagcaaag 3960

agtctatcct gcccaagagg aacagcgata agctgatcgc cagaaagaag gactgggacc 4020

ctaagaagta cggcggcttc gacagcccca ccgtggccta ttctgtgctg gtggtggcca 4080

aagtggaaaa gggcaagtcc aagaaactga agagtgtgaa agagctgctg gggatcacca 4140

tcatggaaag aagcagcttc gagaagaatc ccatcgactt tctggaagcc aagggctaca 4200

aagaagtgaa aaaggacctg atcatcaagc tgcctaagta ctccctgttc gagctggaaa 4260

acggccggaa gagaatgctg gcctctgccg gcgaactgca gaagggaaac gaactggccc 4320

tgccctccaa atatgtgaac ttcctgtacc tggccagcca ctatgagaag ctgaagggct 4380

cccccgagga taatgagcag aaacagctgt ttgtggaaca gcacaagcac tacctggacg 4440

agatcatcga gcagatcagc gagttctcca agagagtgat cctggccgac gctaatctgg 4500

acaaagtgct gtccgcctac aacaagcacc gggataagcc catcagagag caggccgaga 4560

atatcatcca cctgtttacc ctgaccaatc tgggagcccc tgccgccttc aagtactttg 4620

acaccaccat cgaccggaag aggtacacca gcaccaaaga ggtgctggac gccaccctga 4680

tccaccagag catcaccggc ctgtacgaga cacggatcga cctgtctcag ctgggaggcg 4740

acaagcgacc tgccgccaca aagaaggctg gacaggctaa gaagaagaaa gattacaaag 4800

acgatgacga taaggcaaca aacttctctc tgctgaaaca agccggagat gtcgaagaga 4860

atcctggacc gtgagacatt gattattgac tagttattaa tagtaatcaa ttacggggtc 4920

attagttcat agcccatata tggagttccg cgttacataa cttacggtaa atggcccgcc 4980

tggctgaccg cccaacgacc cccgcccatt gacgtcaata atgacgtatg ttcccatagt 5040

aacgccaata gggactttcc attgacgtca atgggtggag tatttacggt aaactgccca 5100

cttggcagta catcaagtgt atcatatgcc aagtacgccc cctattgacg tcaatgacgg 5160

taaatggccc gcctggcatt atgcccagta catgacctta tgggactttc ctacttggca 5220

gtacatctac gtattagtca tcgctattac catggtgatg cggttttggc agtacatcaa 5280

tgggcgtgga tagcggtttg actcacgggg atttccaagt ctccacccca ttgacgtcaa 5340

tgggagtttg ttttggcacc aaaatcaacg ggactttcca aaatgtcgta acaactccgc 5400

cccattgacg caaatgggcg gtaggcgtgt acggtgggag gtctatataa gcagggatcc 5460

ggcatgaccg agtacaagcc cacggtgcgc ctcgccaccc gcgacgacgt ccccagggcc 5520

gtacgcaccc tcgccgccgc gttcgccgac taccccgcca cgcgccacac cgtcgatccg 5580

gaccgccaca tcgagcgggt caccgagctg caagaactct tcctcacgcg cgtcgggctc 5640

gacatcggca aggtgtgggt cgcggacgac ggcgccgcgg tggcggtctg gaccacgccg 5700

gagagcgtcg aagcgggggc ggtgttcgcc gagatcggcc cgcgcatggc cgagttgagc 5760

ggttcccggc tggccgcgca gcaacagatg gaaggcctcc tggcgccgca ccggcccaag 5820

gagcccgcgt ggttcctggc caccgtcgga gtctcgcccg accaccaggg caagggtctg 5880

ggcagcgccg tcgtgctccc cggagtggag gcggccgagc gcgccggggt gcccgccttc 5940

ctggagacct ccgcgccccg caacctcccc ttctacgagc ggctcggctt caccgtcacc 6000

gccgacgtcg aggtgcccga aggaccgcgc acctggtgca tgacccgcaa gcccggtgcc 6060

gagggcagag gaagtcttct aacatgcggt gacgtggagg agaatcccgg ccctatggtg 6120

tctaagggcg aagagctgtt caccggggtg gtgcccatcc tggtcgagct ggacggcgac 6180

gtaaacggcc acaagttcag cgtgtccggc gagggcgagg gcgatgccac ctacggcaag 6240

ctgaccctga agttcatctg caccaccggc aagctgcccg tgccctggcc caccctcgtg 6300

accaccctga cctacggcgt gcagtgcttc agccgctacc ccgaccacat gaagcagcac 6360

gacttcttca agtccgccat gcccgaaggc tacgtccagg agcgcaccat cttcttcaag 6420

gacgacggca actacaagac ccgcgccgag gtgaagttcg agggcgacac cctggtgaac 6480

cgcatcgagc tgaagggcat cgacttcaag gaggacggca acatcctggg gcacaagctg 6540

gagtacaact acaacagcca caacgtctat atcatggccg acaagcagaa gaacggcatc 6600

aaggtgaact tcaagatccg ccacaacatc gaggacggca gcgtgcagct cgccgaccac 6660

taccagcaga acacccccat cggcgacggc cccgtgctgc tgcccgacaa ccactacctg 6720

agcacccagt ccgccctgag caaagacccc aacgagaagc gcgatcacat ggtcctgctg 6780

gagttcgtga ccgccgccgg gatcactctc ggcatggacg agctgtacaa gtaaacgcgt 6840

taagtcgaca atcaacctct ggattacaaa atttgtgaaa gattgactgg tattcttaac 6900

tatgttgctc cttttacgct atgtggatac gctgctttaa tgcctttgta tcatgctatt 6960

gcttcccgta tggctttcat tttctcctcc ttgtataaat cctggttgct gtctctttat 7020

gaggagttgt ggcccgttgt caggcaacgt ggcgtggtgt gcactgtgtt tgctgacgca 7080

acccccactg gttggggcat tgccaccacc tgtcagctcc tttccgggac tttcgctttc 7140

cccctcccta ttgccacggc ggaactcatc gccgcctgcc ttgcccgctg ctggacaggg 7200

gctcggctgt tgggcactga caattccgtg gtgttgtcgg ggaaatcatc gtcctttcct 7260

tggctgctcg cctgtgttgc cacctggatt ctgcgcggga cgtccttctg ctacgtccct 7320

tcggccctca atccagcgga ccttccttcc cgcggcctgc tgccggctct gcggcctctt 7380

ccgcgtcttc gccttcgccc tcagacgagt cggatctccc tttgggccgc ctccccgcgt 7440

cgactttaag accaatgact tacaaggcag ctgtagatct tagccacttt ttaaaagaaa 7500

aggggggact ggaagggcta attcactccc aacgaagaca agatctgctt tttgcttgta 7560

ctgggtctct ctggttagac cagatctgag cctgggagct ctctggctaa ctagggaacc 7620

cactgcttaa gcctcaataa agcttgcctt gagtgcttca agtagtgtgt gcccgtctgt 7680

tgtgtgactc tggtaactag agatccctca gaccctttta gtcagtgtgg aaaatctcta 7740

gcagggcccg tttaaacccg ctgatcagcc tcgactgtgc cttctagttg ccagccatct 7800

gttgtttgcc cctcccccgt gccttccttg accctggaag gtgccactcc cactgtcctt 7860

tcctaataaa atgaggaaat tgcatcgcat tgtctgagta ggtgtcattc tattctgggg 7920

ggtggggtgg ggcaggacag caagggggag gattgggaag acaatagcag gcatgctggg 7980

gatgcggtgg gctctatggc ttctgaggcg gaaagaacca gctggggctc tagggggtat 8040

ccccacgcgc cctgtagcgg cgcattaagc gcggcgggtg tggtggttac gcgcagcgtg 8100

accgctacac ttgccagcgc cctagcgccc gctcctttcg ctttcttccc ttcctttctc 8160

gccacgttcg ccggctttcc ccgtcaagct ctaaatcggg ggctcccttt agggttccga 8220

tttagtgctt tacggcacct cgaccccaaa aaacttgatt agggtgatgg ttcacgtagt 8280

gggccatcgc cctgatagac ggtttttcgc cctttgacgt tggagtccac gttctttaat 8340

agtggactct tgttccaaac tggaacaaca ctcaacccta tctcggtcta ttcttttgat 8400

ttataaggga ttttgccgat ttcggcctat tggttaaaaa atgagctgat ttaacaaaaa 8460

tttaacgcga attaattctg tggaatgtgt gtcagttagg gtgtggaaag tccccaggct 8520

ccccagcagg cagaagtatg caaagcatgc atctcaatta gtcagcaacc aggtgtggaa 8580

agtccccagg ctccccagca ggcagaagta tgcaaagcat gcatctcaat tagtcagcaa 8640

ccatagtccc gcccctaact ccgcccatcc cgcccctaac tccgcccagt tccgcccatt 8700

ctccgcccca tggctgacta atttttttta tttatgcaga ggccgaggcc gcctctgcct 8760

ctgagctatt ccagaagtag tgaggaggct tttttggagg cctaggcttt tgcaaaaagc 8820

tcccgggagc ttgtatatcc attttcggat ctgatcagca cgtgttgaca attaatcatc 8880

ggcatagtat atcggcatag tataatacga caaggtgagg aactaaacca tggccaagtt 8940

gaccagtgcc gttccggtgc tcaccgcgcg cgacgtcgcc ggagcggtcg agttctggac 9000

cgaccggctc gggttctccc gggacttcgt ggaggacgac ttcgccggtg tggtccggga 9060

cgacgtgacc ctgttcatca gcgcggtcca ggaccaggtg gtgccggaca acaccctggc 9120

ctgggtgtgg gtgcgcggcc tggacgagct gtacgccgag tggtcggagg tcgtgtccac 9180

gaacttccgg gacgcctccg ggccggccat gaccgagatc ggcgagcagc cgtgggggcg 9240

ggagttcgcc ctgcgcgacc cggccggcaa ctgcgtgcac ttcgtggccg aggagcagga 9300

ctgacacgtg ctacgagatt tcgattccac cgccgccttc tatgaaaggt tgggcttcgg 9360

aatcgttttc cgggacgccg gctggatgat cctccagcgc ggggatctca tgctggagtt 9420

cttcgcccac cccaacttgt ttattgcagc ttataatggt tacaaataaa gcaatagcat 9480

cacaaatttc acaaataaag catttttttc actgcattct agttgtggtt tgtccaaact 9540

catcaatgta tcttatcatg tctgtatacc gtcgacctct agctagagct tggcgtaatc 9600

atggtcatag ctgtttcctg tgtgaaattg ttatccgctc acaattccac acaacatacg 9660

agccggaagc ataaagtgta aagcctgggg tgcctaatga gtgagctaac tcacattaat 9720

tgcgttgcgc tcactgcccg ctttccagtc gggaaacctg tcgtgccagc tgcattaatg 9780

aatcggccaa cgcgcgggga gaggcggttt gcgtattggg cgctcttccg cttcctcgct 9840

cactgactcg ctgcgctcgg tcgttcggct gcggcgagcg gtatcagctc actcaaaggc 9900

ggtaatacgg ttatccacag aatcagggga taacgcagga aagaacatgt gagcaaaagg 9960

ccagcaaaag gccaggaacc gtaaaaaggc cgcgttgctg gcgtttttcc ataggctccg 10020

cccccctgac gagcatcaca aaaatcgacg ctcaagtcag aggtggcgaa acccgacagg 10080

actataaaga taccaggcgt ttccccctgg aagctccctc gtgcgctctc ctgttccgac 10140

cctgccgctt accggatacc tgtccgcctt tctcccttcg ggaagcgtgg cgctttctca 10200

tagctcacgc tgtaggtatc tcagttcggt gtaggtcgtt cgctccaagc tgggctgtgt 10260

gcacgaaccc cccgttcagc ccgaccgctg cgccttatcc ggtaactatc gtcttgagtc 10320

caacccggta agacacgact tatcgccact ggcagcagcc actggtaaca ggattagcag 10380

agcgaggtat gtaggcggtg ctacagagtt cttgaagtgg tggcctaact acggctacac 10440

tagaagaaca gtatttggta tctgcgctct gctgaagcca gttaccttcg gaaaaagagt 10500

tggtagctct tgatccggca aacaaaccac cgctggtagc ggtggttttt ttgtttgcaa 10560

gcagcagatt acgcgcagaa aaaaaggatc tcaagaagat cctttgatct tttctacggg 10620

gtctgacgct cagtggaacg aaaactcacg ttaagggatt ttggtcatga gattatcaaa 10680

aaggatcttc acctagatcc ttttaaatta aaaatgaagt tttaaatcaa tctaaagtat 10740

atatgagtaa acttggtctg acagttacca atgcttaatc agtgaggcac ctatctcagc 10800

gatctgtcta tttcgttcat ccatagttgc ctgactcccc gtcgtgtaga taactacgat 10860

acgggagggc ttaccatctg gccccagtgc tgcaatgata ccgcgagacc cacgctcacc 10920

ggctccagat ttatcagcaa taaaccagcc agccggaagg gccgagcgca gaagtggtcc 10980

tgcaacttta tccgcctcca tccagtctat taattgttgc cgggaagcta gagtaagtag 11040

ttcgccagtt aatagtttgc gcaacgttgt tgccattgct acaggcatcg tggtgtcacg 11100

ctcgtcgttt ggtatggctt cattcagctc cggttcccaa cgatcaaggc gagttacatg 11160

atcccccatg ttgtgcaaaa aagcggttag ctccttcggt cctccgatcg ttgtcagaag 11220

taagttggcc gcagtgttat cactcatggt tatggcagca ctgcataatt ctcttactgt 11280

catgccatcc gtaagatgct tttctgtgac tggtgagtac tcaaccaagt cattctgaga 11340

atagtgtatg cggcgaccga gttgctcttg cccggcgtca atacgggata ataccgcgcc 11400

acatagcaga actttaaaag tgctcatcat tggaaaacgt tcttcggggc gaaaactctc 11460

aaggatctta ccgctgttga gatccagttc gatgtaaccc actcgtgcac ccaactgatc 11520

ttcagcatct tttactttca ccagcgtttc tgggtgagca aaaacaggaa ggcaaaatgc 11580

cgcaaaaaag ggaataaggg cgacacggaa atgttgaata ctcatactct tcctttttca 11640

atattattga agcatttatc agggttattg tctcatgagc ggatacatat ttgaatgtat 11700

ttagaaaaat aaacaaatag gggttccgcg cacatttccc cgaaaagtgc cacctgacgt 11760

cgacggatcg ggagatctcc cgatccccta tggtgcactc tcagtacaat ctgctctgat 11820

gccgcatagt taagccagta tctgctccct gcttgtgtgt tggaggtcgc tgagtagtgc 11880

gcgagcaaaa tttaagctac aacaaggcaa ggcttgaccg acaattgcat gaagaatctg 11940

cttagggtta ggcgttttgc gctgcttcgc gatgtacggg ccagatatac gcgttgacat 12000

tgattattga ctagttatta atagtaatca attacggggt cattagttca tagcccatat 12060

atggagttcc gcgttacata acttacggta aatggcccgc ctggctgacc gcccaacgac 12120

ccccgcccat tgacgtcaat aatgacgtat gttcccatag taacgccaat agggactttc 12180

cattgacgtc aatgggtgga gtatttacgg taaactgccc acttggcagt acatcaagtg 12240

tatcatatgc caagtacgcc ccctattgac gtcaatgacg gtaaatggcc cgcctggcat 12300

tatgcccagt acatgacctt atgggacttt cctacttggc agtacatcta cgtattagtc 12360

atcgctatta ccatggtgat gcggttttgg cagtacatca atgggcgtgg atagcggttt 12420

gactcacggg gatttccaag tctccacccc attgacgtca atgggagttt gttttggcac 12480

caaaatcaac gggactttcc aaaatgtcgt aacaactccg ccccattgac gcaaatgggc 12540

ggtaggcgtg tacggtggga ggtctatata agcagcgcgt tttgcctgta ctgggtctct 12600

ctggttagac cagatctgag cctgggagct ctctggctaa ctagggaacc cactgcttaa 12660

gcctcaataa agcttgcctt gagtgcttca agtagtgtgt gcccgtctgt tgtgtgactc 12720

tggtaactag agatccctca gaccctttta gtcagtgtgg aaaatctcta gcagtggcgc 12780

ccgaacaggg acttgaaagc gaaagggaaa ccagaggagc tctctcgacg caggactcgg 12840

cttgctgaag cgcgcacggc aagaggcgag gggcggcgac tggtgagtac gccaaaaatt 12900

ttgactagcg gaggctagaa ggagagagat gggtgcgaga gcgtcagtat taagcggggg 12960

agaattagat cgcgatggga aaaaattcgg ttaaggccag ggggaaagaa aaaatataaa 13020

ttaaaacata tagtatgggc aagcagggag ctagaacgat tcgcagttaa tcctggcctg 13080

ttagaaacat cagaaggctg tagacaaata ctgggacagc tacaaccatc ccttcagaca 13140

ggatcagaag aacttagatc attatataat acagtagcaa ccctctattg tgtgcatcaa 13200

aggatagaga taaaagacac caaggaagct ttagacaaga tagaggaaga gcaaaacaaa 13260

agtaagacca ccgcacagca agcggccgct gatcttcaga cctggaggag gagatatgag 13320

ggacaattgg agaagtgaat tatataaata taaagtagta aaaattgaac cattaggagt 13380

agcacccacc aaggcaaaga gaagagtggt gcagagagaa aaaagagcag tgggaatagg 13440

agctttgttc cttgggttct tgggagcagc aggaagcact atgggcgcag cgtcaatgac 13500

gctgacggta caggccagac aattattgtc tggtatagtg cagcagcaga acaatttgct 13560

gagggctatt gaggcgcaac agcatctgtt gcaactcaca gtctggggca tcaagcagct 13620

ccaggcaaga atcctggctg tggaaagata cctaaaggat caacagctcc tggggatttg 13680

gggttgctct ggaaaactca tttgcaccac tgctgtgcct tggaatgcta gttggagtaa 13740

taaatctctg gaacagattt ggaatcacac gacctggatg gagtgggaca gagaaattaa 13800

caattacaca agcttaatac actccttaat tgaagaatcg caaaaccagc aagaaaagaa 13860

tgaacaagaa ttattggaat tagataaatg ggcaagtttg tggaattggt ttaacataac 13920

aaattggctg tggtatataa aattattcat aatgatagta ggaggcttgg taggtttaag 13980

aatagttttt gctgtacttt ctatagtgaa tagagttagg cagggatatt caccattatc 14040

gtttcagacc cacctcccaa ccccgagggg acccgacagg cccgaaggaa tagaagaaga 14100

aggtggagag agagacagag acagatccat tcgattagtg aacggatcgg cactgcgtgc 14160

gccaattctg cagacaaatg gcagtattca tccacaattt taaaagaaaa ggggggattg 14220

gggggtacag tgcaggggaa agaatagtag acataatagc aacagacata caaactaaag 14280

aattacaaaa acaaattaca aaaattcaaa attttcgggt ttattacagg gacagcagag 14340

atccagtttg gttaattaag gtacc 14365

<210> 2

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

gctacttaca attaacgata 20

<210> 3

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

ggtaagaagg attccaacca 20

<210> 4

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

ttctggcatg tgcaagaagt 20

<210> 5

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

acctggcctt catacacctc 20

<210> 6

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

gttatcacag caccgcagac 20

<210> 7

<211> 56

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

tgtggaaagg acgaaacacc gctacttaca attaacgata gtttaagagc tatgct 56

<210> 8

<211> 56

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

gctatttcta gctctaaaac tggttggaat ccttcttacc ggtgtttcgt cctttc 56

Claims (10)

1. A vector targeting EML4-ALK fusion gene variant 1 in a human non-small cell lung cancer cell line is characterized by comprising the following functional elements: a green fluorescent gene GFP, a puromycin resistance gene, a Cas9 protein encoding gene, a sgRNA target point EML4-sgRNA aiming at EML4, and a sgRNA target point ALK-sgRNA aiming at ALK.

2. The vector of claim 1, wherein the starting vector is CMV-Puro mutant-T2A-EGFP-pLentiCRISPRV 2 GFP.

3. The vector of claim 2, wherein the puromycin resistance gene and the green fluorescent protein GFP are linked in series by a T2A element, expression of which is initiated by a CMV promoter; the Cas9 protein is expressed from the EF1a promoter; the sgRNA targets are all started by U6 and are not interfered with each other.

4. The vector according to claim 1 or 3, wherein the nucleotide sequence of the EML4-sgRNA is shown in SEQ ID No. 2; the nucleotide sequence of the ALK-sgRNA is shown in SEQ ID NO. 3.

5. A method for preparing the carrier of any one of claims 1 to 4, comprising the steps of:

s1: selecting and screening an EML4-sgRNA target site;

s2: selecting and screening an ALK-sgRNA target site;

s3: and constructing a vector simultaneously containing EML4-sgRNA and ALK-sgRNA.

6. A cell expressing the vector of any one of claims 1-4.

7. The cell of claim 6, wherein the cell is a human non-small cell lung cancer cell.

8. The cell of claim 7, wherein the human non-small cell lung cancer cell is specifically NCI-H3122.

9. Use of the vector according to any one of claims 1 to 4, or the cell according to any one of claims 6 to 8, for the preparation of a medicament for the prevention or treatment of a neoplastic disease.

10. The use according to claim 9, wherein the neoplastic disease is lung cancer.

Images