CN114107375A

CN114107375A - Method for reducing protein content of rice and improving cooking taste quality by using CRISPR/Cas9 technology

Info

Publication number: CN114107375A
Application number: CN202111430116.5A
Authority: CN
Inventors: 严长杰; 杨宜豪; 沈子颜; 郭旻; 孙生远
Original assignee: Yangzhou University
Current assignee: Yangzhou University
Priority date: 2021-11-29
Filing date: 2021-11-29
Publication date: 2022-03-01
Anticipated expiration: 2041-11-29
Also published as: CN114107375B

Abstract

The invention discloses a method for reducing the protein content of rice and improving the cooking taste quality by using a CRISPR/Cas9 technology, which is characterized in that a rice glutelin synthetic gene is mutated by a gene editing technology so as to reduce the expression quantity of the rice glutelin synthetic gene or block the generation of protein of the rice glutelin synthetic gene. Experiments prove that the reduction of the content of the rice gluten is more obvious along with the increase of the number of knocked-out genes of the gluten synthesis gene, and the total protein of the rice is reduced to different degrees; although the prolamin and the globulin have a certain compensation effect, the reduction of the gluten content can quickly reduce the rice variety with higher total protein content to the requirement of high-quality rice on the market, usually about 7 percent; the reduction of the protein content of the rice reduces the hardness of the rice and improves the quality of the cooked taste without any negative effect on the processing and appearance quality of the seeds.

Description

Method for reducing protein content of rice and improving cooking taste quality by using CRISPR/Cas9 technology

Technical Field

The invention belongs to the technical field of plant genetic engineering, and particularly relates to a method for reducing the protein content of rice and improving the quality of cooking taste by using a CRISPR/Cas9 technology.

Background

Rice is one of the most important grain crops in China and even in the world, and plays a vital role in guaranteeing the grain safety in the world. In recent decades, China makes a major breakthrough in rice yield, and the front of the world is the main rice-producing country.

Starch is the most important component of rice, and accounts for more than 80% of endosperm of rice. In the current production practice, the taste quality of rice is improved mainly by cultivating rice varieties with different amylose contents by utilizing different allelic variation of Waxy coded starch synthase GBSSI so as to meet the requirements of different consumer groups, for example, Wxb allelic genes of japonica rice are brought into the quality of indica rice, and the problem that the amylose content in the previous indica rice varieties is higher is solved; wxmp from local varieties is used for improving the quality of japonica rice to form 'soft rice' varieties with the amylose content of 8-12%. However, although the improvement of rice quality around starch has been greatly progressed, the quality of the existing rice still cannot meet the requirements of domestic consumers, and a large gap still exists between the quality of the existing rice and the quality of the indica-japonica rice in foreign countries.

A great deal of research shows that the content and the composition of the rice protein as the second largest storage substance next to starch also seriously affect various quality characters of rice, particularly the quality of cooking taste. Generally, the higher the protein content in rice, the poorer the taste quality of rice, and the extremely significant negative correlation between the two is shown. In production practice, the protein content of high-quality rice is about 7%, such as Yuehao in Japan and Yuanyun 131 in northeast China. However, as the protein content of rice is very easily influenced by environmental factors and the genetic control system is complex, so far, gene resources and methods for improving the protein character of rice are lacked, and further improvement of the rice quality is severely restricted. Therefore, establishing a rapid and efficient breeding method is an important way for improving the quality of crops.

Disclosure of Invention

This section is for the purpose of summarizing some aspects of embodiments of the invention and to briefly introduce some preferred embodiments. In this section, as well as in the abstract and the title of the invention of this application, simplifications or omissions may be made to avoid obscuring the purpose of the section, the abstract and the title, and such simplifications or omissions are not intended to limit the scope of the invention.

The present invention has been made keeping in mind the above and/or other problems occurring in the prior art.

In order to solve the technical problems, the invention provides the following technical scheme: a method for preparing transgenic rice, which comprises mutating glutelin synthesis gene of receptor rice genome to reduce glutelin expression amount or block glutelin generation, so as to obtain the transgenic rice.

As a preferable embodiment of the method for producing transgenic rice of the present invention, wherein: the glutelin synthetic gene of the receptor rice genome is mutated by adopting a gene editing mode;

the rice glutelin synthesis gene comprises one or more of OsGluA1, OsGluA2, OsGluA3, OsGluB2, OsGluB6, OsGluB7, OsGluC and OsGluD.

As a preferable embodiment of the method for producing transgenic rice of the present invention, wherein: the gene editing is carried out by using a CRISPR/Cas9 system, and the CRISPR/Cas9 system is any one of the following systems:

(a) including specific gRNA and Cas9 proteins; the target sequence recognition region in the specific gRNA is shown as 511-533 th nucleotides in SEQ ID NO.1, and/or is shown as 511-533 th nucleotides in SEQ ID NO.2, and/or is shown as 508-530 th nucleotides in SEQ ID NO.3, and/or is shown as 874-896 th nucleotides in SEQ ID NO.4, and/or is shown as 874-896 th nucleotides in SEQ ID NO.5, and/or is shown as 967-987 th nucleotides in SEQ ID NO.6, and/or is shown as 339-361 th nucleotides in SEQ ID NO.7, and/or is shown as 925-945 th nucleotides in SEQ ID NO. 8;

(b) the gene comprises a specific DNA molecule and a coding gene of Cas9 protein, and the specific DNA molecule is transcribed to obtain the specific gRNA;

(c) a plasmid comprising a plasmid having the specific DNA molecule and a plasmid having a gene encoding the Cas9 protein;

(d) comprises a specific recombinant plasmid which expresses the specific DNA molecule and a coding gene of the Cas9 protein.

As a preferable embodiment of the method for producing transgenic rice of the present invention, wherein: the target sequence of gRNA in the CRISPR/Cas9 system comprises one or more of SEQ ID NO.9, SEQ ID NO.10, SEQ ID NO.11 and SEQ ID NO. 12.

Another object of the present invention is to provide a method for producing transgenic rice, comprising,

carrying out gene editing on receptor rice by adopting the CRISPR/Cas9 system to obtain transgenic rice;

or, the specific recombinant plasmid is introduced into receptor rice to obtain transgenic rice.

As a preferable embodiment of the method for producing transgenic rice of the present invention, wherein: and introducing the specific recombinant plasmid into receptor rice, transforming the specific recombinant plasmid into crop callus through agrobacterium tumefaciens mediation, and planting the crop callus to obtain transgenic rice through screening, differentiation, rooting and positive detection.

As a preferable embodiment of the method for producing transgenic rice of the present invention, wherein: the crops comprise one of rice, rice and corn.

Another object of the present invention is to provide a method for producing a gene-edited rice plant free of transgenes, comprising,

transgenic rice prepared according to the above method or transgenic rice prepared according to the above method;

selfing the transgenic rice to obtain selfed progeny;

and screening the transgenic-free gene editing rice from the selfing progeny.

Another object of the present invention is to provide a DNA molecule of rice comprising,

a DNA molecule formed by deleting 528 th base of the DNA molecule shown in SEQ ID NO.1 and 356-357 base of the DNA molecule shown in SEQ ID NO. 7;

or a DNA molecule formed by inserting 1 base behind the 527 position of the DNA molecule shown in SEQ ID NO.1, inserting 1 base behind the 527 position of the DNA molecule shown in SEQ ID NO.2 and deleting 891 base of the DNA molecule shown in SEQ ID NO. 4;

or, the DNA molecule is formed by deleting 525-528 bases of the DNA molecule shown in SEQ ID NO.1, deleting 528 bases of the DNA molecule shown in SEQ ID NO.2, inserting 1 base after 890 positions of the DNA molecule shown in SEQ ID NO.5 and deleting 356 bases of the DNA molecule shown in SEQ ID NO. 6;

or, the DNA molecule is formed by deleting 526 to 527 th bases of the DNA molecule shown in SEQ ID NO.1, deleting 528 to 535 th bases of the DNA molecule shown in SEQ ID NO.2, deleting 891 th bases of the DNA molecule shown in SEQ ID NO.5, and inserting 1 base after 938 th of the DNA molecule shown in SEQ ID NO. 8;

or, the DNA molecule formed by inserting 1 base behind the 527 st bit of the DNA molecule shown in SEQ ID NO.1, inserting 1 base behind the 527 st bit of the DNA molecule shown in SEQ ID NO.2, deleting 525-528 bases of the DNA molecule shown in SEQ ID NO.3, and inserting 1 base behind the 890 st bit of the DNA molecule shown in SEQ ID NO. 4;

or, the DNA molecule is formed by deleting 528 th base of the DNA molecule shown in SEQ ID NO.1, 528 th base of the DNA molecule shown in SEQ ID NO.2, 526 th base of the DNA molecule shown in SEQ ID NO.3, 887-890 th base of the DNA molecule shown in SEQ ID NO.5 and 343-381 st base of the DNA molecule shown in SEQ ID NO. 7;

or a DNA molecule formed by deleting 521-528 bases of the DNA molecule shown in SEQ ID NO.1, 527-535 bases of the DNA molecule shown in SEQ ID NO.2, inserting 1 base after 524 bases of the DNA molecule shown in SEQ ID NO.3, inserting 1 base after 890 bases of the DNA molecule shown in SEQ ID NO.4, 874-978 bases and 891 bases of the DNA molecule shown in SEQ ID NO.5, and 343-381 bases of the DNA molecule shown in SEQ ID NO. 7.

It is another object of the present invention to provide the use of the method according to any one of the above for improving the quality of cooked taste of rice.

Compared with the prior art, the invention has the following beneficial effects:

the method for improving the cooking taste quality of rice by reducing the protein content of the rice by performing multi-gene knockout on the rice glutelin synthesis gene family members by using the CRISPR/Cas9 technology is expected to further accelerate the rice quality breeding process.

Drawings

In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings needed to be used in the description of the embodiments will be briefly introduced below, and it is obvious that the drawings in the following description are only some embodiments of the present invention, and it is obvious for those skilled in the art to obtain other drawings based on these drawings without inventive exercise. Wherein:

fig. 1 is a schematic diagram of CRISPR/Cas9 knockout vector construction of example 1 of the invention.

FIG. 2 shows the type of mutation in OsGluA1 gene in example 1 of the present invention.

FIG. 3 shows the type of mutation in OsGluA2 gene in example 1 of the present invention.

FIG. 4 shows the type of mutation in OsGluA3 gene in example 1 of the present invention.

FIG. 5 shows the type of mutation in OsGluB2 gene in example 1 of the present invention.

FIG. 6 shows the type of mutation in OsGluB6 gene in example 1 of the present invention.

FIG. 7 shows the type of mutation in OsGluB7 gene in example 1 of the present invention.

FIG. 8 shows the type of OsGluC gene mutation in example 1 of the present invention.

FIG. 9 shows the OsGluD gene mutation pattern in example 1 of the present invention.

FIG. 10 is a schematic diagram of the combination of glutelin synthesis gene mutations in the context of Nanjing 9108 according to example 2 of the present invention.

FIG. 11 is SDS-PAGE analysis of different mutant types of rice proteins in example 3 of the present invention.

FIG. 12 is a protein component content analysis of rice of various mutant types according to example 3 of the present invention.

FIG. 13 is an analysis of rice taste quality-related traits of different mutant types in example 4 of the present invention; wherein (a) represents amylose content, (b) represents rice hardness, and (c) represents rice taste value.

Detailed Description

In order to make the aforementioned objects, features and advantages of the present invention more comprehensible, specific embodiments thereof are described in detail below with reference to examples of the specification.

In the following description, numerous specific details are set forth in order to provide a thorough understanding of the present invention, but the present invention may be practiced in other ways than those specifically described and will be readily apparent to those of ordinary skill in the art without departing from the spirit of the present invention, and therefore the present invention is not limited to the specific embodiments disclosed below.

Furthermore, reference herein to "one embodiment" or "an embodiment" means that a particular feature, structure, or characteristic described in connection with the embodiment is included in at least one implementation of the invention. The appearances of the phrase "in one embodiment" in various places in the specification are not necessarily all referring to the same embodiment, nor are separate or alternative embodiments mutually exclusive of other embodiments.

The objects edited by the present invention are glutelin synthesis-related genes, named OsGluA1, OsGluA2, OsGluA3, OsGluB2, OsGluB6, OsGluB7, OsGluC and OsGluD. Research shows that the expression of the glutelin synthesis related gene has important influence on the protein content of rice.

The rice variety selected by the invention is japonica rice 46(Oryza sativa L.). The variety is widely planted in Jiangsu province in recent years due to the characteristics of high yield and high quality, but the quality of the rice still needs to be further improved due to relatively high protein content of the rice. The invention utilizes a gene editing technology to edit OsGluA1, OsGluA2, OsGluA3, OsGluB2, OsGluB6, OsGluB7, OsGluC and OsGluD on the Nanjing 46 genome so as to reduce the protein expression quantity of a glutelin synthesis related gene or block the generation of the glutelin synthesis related gene. OsGluA1, OsGluA2, OsGluA3, OsGluB2, OsGluB6, OsGluB7, OsGluC and OsGluD have gene sequences shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7 and SEQ ID NO.8, respectively.

Example 1

(1) Selection of gRNA targets

According to the gene sequence alignment of OsGluA1, OsGluA2, OsGluA3, OsGluB2, OsGluB6, OsGluB7, OsGluC and OsGluD, sequence sections with high similarity are found out.

The nucleotide at the first position of the OsGluA1 gene sequence,

According to the CRISPR/Cas9 technical target site design principle, 4 target sequences sgRNA1, sgRNA2, sgRNA3 and sgRNA4 are selected in a sequence region with high similarity, and the 8 genes are targeted. Different editing types are generated by site-directed cleavage and random repair of CRISPR/Cas9 proteins.

The sequences of the

sgrnas

1, 2, 3, and 4 are shown below (bold bases are PAM sites).

Wherein the sgRNA1 targets the 511-533 th nucleotides of an OsGluA1 gene sequence, the 511-533 th nucleotides of an OsGluA2 gene sequence and the 508-530 th nucleotides of an OsGluA3 gene sequence;

the sgRNA2 targets 874-896 th nucleotides of an OsGluB2 gene sequence and 874-896 th nucleotides of an OsGluB6 gene sequence;

the sgRNA3 targets 339-361 th nucleotides of an OsGluC gene sequence;

the sgRNA4 targets nucleotides 967 to 987 of an OsGluB7 gene sequence and nucleotides 925 to 945 of the OsGluD gene sequence.

(2) Construction of expression vectors

The intermediate vector SK-gRNA is linearized by Aar I, and the system is as follows: 10x buffer Aar I10 uL, 50x oligonucleotide 2uL, Aar I1 uL, SK-gRNA 1-2ug, ddH₂And supplementing O to 100uL, carrying out enzyme digestion at 37 ℃ for 3h, and purifying the enzyme digestion product by using the kit. After the band size of the digested product was checked by 1% agarose gel electrophoresis, the digested product was recovered and purified by column chromatography, and 50uL of sterilized ddH was added₂And dissolving O, and measuring the concentration for later use.

Primers glu1-F, glu1-R, glu2-F, glu2-R, glu3-F, glu3-R, glu4-F and glu4-R were synthesized based on the selected gRNA target sequences, and the primer sequences are shown below.

The primers were diluted with water to a concentration of 100uM, 20ul each of the primers was mixed together, the PCR tube of the mixed system was placed in a 100 ℃ metal bath for 5 minutes, and cooled at room temperature.

And (3) connecting the prepared target site joint into an intermediate vector SK-gRNA by using T4 ligase, wherein a 15uL connecting system is as follows: 10 XT 4 ligation buffer 1.5uL, target site linker 10uL, digested vector 3uL, T4 DNA ligase 0.5uL, ligation at 16 ℃ for 1 hour. And transforming the connecting product into escherichia coli DH5 alpha, culturing an ampicillin resistant LB plate overnight, selecting a positive strain, sending the positive strain to a company for sequencing, and obtaining intermediate vectors SK-gRNA-glu1, SK-gRNA-glu2, SK-gRNA-glu3 and SK-gRNA-glu4 with correct sequencing.

The obtained intermediate vectors SK-gRNA-glu1, SK-gRNA-glu2, SK-gRNA-glu3 and SK-gRNA-glu4 were digested for 2 hours at 37 ℃ according to the following systems, respectively.

10×NEB Cutsmart Buffer 5uL；SK-gRNA-glu1 15uL；Kpn I 0.5uL；Xho I 0.5 uL；ddH₂O to 50 uL.

10×NEB Cutsmart Buffer 5uL；SK-gRNA-glu2 15uL；Sal I 0.5uL；Xba I 0.5 uL；ddH₂O to 50 uL.

10×NEB Cutsmart Buffer 5uL；SK-gRNA-glu3 15uL；Nhe I 0.5uL；BamH I 0.5uL；ddH₂O to 50 uL.

10×NEB Cutsmart Buffer 5uL；SK-gRNA-glu4 15uL；Kpn I 0.5uL；Bgl II 0.5 uL；ddH₂O to 50 uL.

1% agarose gel electrophoresis, recovering and purifying DNA fragments by the kit, assembling 4 gRNAs together by a one-step method, and connecting an enzyme connecting system T4 of NEB company: 10 XT 4 ligation buffer 1.5 uL; SK-gRNA-glu2(Xba I/Sal I)4 uL; SK-gRNA-glu3(BamH I/Nhe I)4 uL; SK-gRNA-glu4(Kpn I/Bgl II)4 uL; SK-gRNA-glu1(Kpn I/Xho I)1 uL; t4 DNA ligase 0.5 uL. Ligation was performed at room temperature for 1 hour, and the ligation product was transformed into E.coli DH 5. alpha. and cultured overnight. The PCR was carried out using the primers on the vector to select positive clones and send them to the company for sequencing, and the intermediate vector with the correct sequencing was named SK-4G-glu1-glu2-glu3-glu 4. And the well-connected intermediate vector and plant expression vector pC1300-Cas9 are subjected to enzyme digestion for 2 hours at 37 ℃ according to the following system.

10×NEB Cutsmart Buffer 2uL；SK-4G-glu1-glu2-glu3-glu4 15uL；Kpn I 0.5uL； BamH I 0.5uL；ddH₂O to 20 uL.

10×NEB Cutsmart Buffer 2uL；pC1300-Cas9 5uL；Kpn I 0.5uL；BamH I 0.5 uL；ddH₂O to 20 uL.

1% agarose gel electrophoresis, kit recovery purification of gRNA fragments and 14.6kb linearization of pC1300-Cas9 fragments. By ddH₂Measurement of concentration after O solubilization the gRNA fragments were ligated into the expression vector as follows, T4 ligase ligation system from NEB: 10 XT 4 ligation buffer 1.5 uL; SK-4G-glu1-glu2-glu3-glu 4(Kpn I/BamH I)5.5 uL; pC1300-Cas9(Kpn I/BamH I)2 uL; t4 DNA ligase 0.5 uL; ddH₂O to 15uL, and ligation at room temperature for 1 hour.

The ligation product was transformed into E.coli DH 5. alpha. and cultured overnight. Colony PCR is carried out by using primers on the carrier, and positive clones are selected and sent to a company for sequencing. Gram of correct sequencingThe clone was named pC1300-Cas9-g^glu1-g^glu2-g^glu3-g^glu4The vector is schematically shown in FIG. 1.

The vectors SK-gRNA and pC1300-Cas9 are derived from the laboratory of King Kejian, Ching C, Shen L, Fu Y, et al.A. simple CRISPR/Cas9 system for multiplex genome evaluation in rice J, 2015,42:703-706.

(3) Transformation of Agrobacterium

The recombinant vector pC1300-Cas9-g in (2)^glu1-g^glu2-g^glu3-g^glu4And transforming the agrobacterium EHA105 strain by a heat shock method to obtain the recombinant agrobacterium containing the recombinant expression vector.

(4) Agrobacterium-mediated transformation of rice

The recombinant agrobacterium tumefaciens is used for infecting callus induced by mature embryos of a rice variety Nanjing 9108, and plants which are successfully regenerated, rooted and positive through PCR detection on a culture medium containing hygromycin resistance are transgenic positive plants.

(5) Transgenic rice and detection of mutant site

10 transgenic positive individuals are obtained, DNA is extracted, amplification primers GluA1-F, GluA1-R, GluA2-F, GluA2-R, GluA3-F, GluA3-R, GluB2-F, GluB2-R, GluB6-F, GluB6-R, GluB7-F, GluB7-R, GluC-F, GluC-R, GluD-F, GluD-R are designed before and after the edited region of the gluten synthesis gene, and the sequences of the primers are shown as follows.

GluA1-F GCCTTCTACTACCCCATT

GluA1-R GTTTTGCCTTACCCTCAG

GluA2-F GCTGTTGAGATTTGTAACCCTT

GluA2-R TTGTGCGATGGCTCCCTA

GluA3-F CGAGCAAGACCAACAATTGGAAGGC

GluA3-R CGTTCTTCGAATTGTCCCTTGCCTC

GluB2-F AGGGTTCAACAAGTATATGGCAG

GluB2-R TAGACATAATATCATATAAACCGT

GluB6-F ACGAAGAACACCGTCGAACA

GluB6-R ATTCAGCAACACTCTGGGCA

GluB7-F CAGTTCCAGTGCACCGGTAC

GluB7-R CTCGAGCACGCCCTTGAATT

GluC-F GTTTGAGCAAGCTCCAATAT

GluC-R GAAGTTGCTGGTGCTCGTCTCTC

GluD-F TTGGCAACCTGTACTCGCAC

GluD-R GCTCCGCTCTTTAGCCAAGG

And sequencing the PCR product, and analyzing the target point mutation type through a sequencing peak diagram and an analysis website (http:// skl. scau. edu. cn /), wherein the mutation type is shown in figures 2-9. From FIGS. 2 to 9, it can be seen that 8 genes are mutated to different degrees, including base insertions and deletions, and most of the mutations cause frame shift mutations of the genes. In FIGS. 2 to 9, the bold part is a PAM site, the underlined sequence is a target sequence, "d" represents a deletion of a base, "i" represents an insertion of a base, and "s" represents a substitution of a base.

Example 2

All seeds of T0 generation obtained from 10 transgenic positive individuals are planted to form 243T 1 generation plants, DNA is extracted, and the individuals without cas9 label are screened by using primers to obtain 33 plants in total, wherein the sequences of the primers are shown in the specification.

Cas9-F ACCAGACACGAGACGACTAA

Cas9-R ATCGGTGCGGGCCTCTTC

Sequencing and analyzing the target gene, selecting a single plant with homozygous mutation at editing sites, screening 7 different gene mutation combinations which are named as I to VI respectively, and the schematic diagram of the mutation combinations is shown in figure 10.

I is knock-out of OsGluA1 and OsGluC, the OsGluA1 gene of I is a mutant gene obtained by deleting 528 th base of a wild-type gene, and the OsGluC gene of I is a mutant gene obtained by deleting 356-357 th base of the wild-type gene;

II is knock-out of OsGluA1, OsGluA2 and OsGluB2, the OsGluA1 gene of II is a mutant gene obtained by inserting 1 base after 527 th site of a wild-type gene, the OsGluA2 gene of II is a mutant gene obtained by inserting 1 base after 527 th site of a wild-type gene, and the OsGluB2 gene of II is a mutant gene obtained by deleting 891 th base of a wild-type gene;

III, knocking out OsGluA1, OsGluA2, OsGluB6 and OsGluC, wherein the OsGluA1 gene of the III is a mutant gene obtained by deleting 525-528 bases of a wild-type gene, the OsGluA2 gene of the III is a mutant gene obtained by deleting 528 bases of the wild-type gene, the OsGluB6 gene of the III is a mutant gene obtained by inserting 1 base after 890 bases of the wild-type gene, and the OsGluC gene of the III is a mutant gene obtained by deleting 356 bases of the wild-type gene;

IV is knock-out OsGluA1, OsGluA2, OsGluB6 and OsGluD, wherein the OsGluA1 gene of IV is a mutant gene obtained by deleting 526-527 th bases of a wild-type gene, the OsGluA2 gene of IV is a mutant gene obtained by deleting 528-535 th bases of a wild-type gene, the OsGluB6 gene of IV is a mutant gene obtained by deleting 891 st bases of a wild-type gene, and the OsGluD gene of IV is a mutant gene obtained by inserting 1 st base after 938 th position of a wild-type gene;

v is knock-out OsGluA1, OsGluA2, OsGluA3 and OsGluB2, the OsGluA1 gene of V is a mutant gene obtained by inserting 1 base after 527 th position of a wild-type gene, the OsGluA2 gene of V is a mutant gene obtained by inserting 1 base after 527 th position of a wild-type gene, the OsGluA3 gene of V is a mutant gene obtained by deleting 525-528 bases of a wild-type gene, and the OsGluB2 gene of V is a mutant gene obtained by inserting 1 base after 890 th position of a wild-type gene;

VI is knock-out OsGluA1, OsGluA2, OsGluA3, OsGluB6 and OsGluC, wherein the OsGluA1 gene of VI is a mutant gene obtained by deleting 528 th base of a wild-type gene, the OsGluA2 gene of VI is a mutant gene obtained by deleting 528 th base of a wild-type gene, the OsGluA3 gene of VI is a mutant gene obtained by deleting 526 th base of a wild-type gene, the OsGluB6 gene of VI is a mutant gene obtained by deleting 887-890 th bases of a wild-type gene, and the OsGluC gene of VI is a mutant gene obtained by deleting 343-381 th bases of a wild-type gene;

VII is knock-out of OsGluA1, OsGluA2, OsGluA3, OsGluB2, OsGluB6 and OsGluC, the OsGluA1 gene of VII is a mutant gene obtained by deleting 521-528 bases of a wild-type gene, the OsGluA2 gene of VII is a mutant gene obtained by deleting 527-535 bases of a wild-type gene, the OsGluA3 gene of VII is a mutant gene obtained by inserting 1 base after 524 of a wild-type gene, the OsGluB2 gene of VII is a mutant gene obtained by inserting 1 base after 890 of a wild-type gene, the OsGluB6 gene of VII is a mutant gene obtained by deleting 874-978 bases and 891 bases of a wild-type gene, and the OsGluC gene of VII is a mutant gene obtained by deleting 343-381 bases of a wild-type gene.

Example 3

In order to study whether the protein content of rice can be regulated by multiple gene mutation, total protein in wild type and 7 mutant grains is extracted and subjected to SDS-PAGE analysis, and the specific method steps are as follows.

Extraction of component proteins

After the seeds are ripe, the seeds are placed at room temperature for 3 months to balance water, and then the rice is hulled, ground and sieved, and after the rice flour is placed in a 42 ℃ oven for about 2 days, 1g (to 0.01g) is accurately weighed by a thousandth balance.

(1) Albumin: putting rice flour to be tested into a10 ml centrifuge tube, adding 3ml H₂O, shaking vigorously for 2h, centrifuging at 10000g for 20min, and taking supernatant;

(2) globulin: adding 3ml of 0.5M NaCl solution into the precipitate, shaking for 2h, centrifuging at 10000g for 20min, and taking supernatant;

(3) prolamin: adding 3ml of 70% ethanol into the precipitate, sealing a centrifuge tube with a sealing film, shaking in a water bath at 80 ℃ for 1h, centrifuging at 10000g for 25min, and slowly taking supernatant;

(4) and (3) gluten extraction: adding 0.1M NaOH solution into the precipitate, shaking at 4 deg.C for 1h, centrifuging at 10000g for 25min, and collecting supernatant;

(5) extracting each protein component repeatedly for 3 times, combining the supernatants and fixing the volume to 50mL, sucking 3mL of the fixed volume solution and placing the solution into a10 mL test tube, adding 1mL of 0.1% Coomassie brilliant blue G250 colorimetric solution to fix the volume to 10mL, and then carrying out color comparison at 595nm by using a UV-754 spectrophotometer.

Protein SDS-PAGE detection and staining

(1) A small amount of detergent was added to clean the glass plate for gel formation (Bio-Rad, thickness: 1mm &0.75mm) or directly cleaned with alcohol, and then the cleaned glass plate was dried at room temperature.

(2) And (4) putting the dried glass plate on a glue making frame after the glass plate is arranged (the bottom is aligned). Preparing the separation gel with corresponding concentration in a centrifuge tube.

(3) Carefully adding the prepared separation gel into a glass plate to the position 1.5-2 cm from the top end by using a liquid shifter, and then carefully adding ddH₂And (3) sealing the O-shaped sealant (added to the top end of the glass plate) to ensure that the separation sealant is flat. And (4) placing at room temperature until a boundary line appears.

(4) And cleaning the comb for preparing the glue, and airing for later use.

(5) Carefully separate ddH on top of gel with filter paper₂And (4) sucking dry O in a centrifuge tube to prepare the concentrated gel.

(6) Carefully but quickly applying the concentrated gel to the gel in the glass plate, carefully inserting the comb immediately after the gel is applied, and allowing the comb to stand at room temperature until a boundary is formed between the comb and the gel.

(7) Removing the glass plate from the gel preparation rack, loading into electrophoresis rack, carefully and vertically pulling out comb, and applying dH₂O-washes the wells to remove acrylamide monomer that may not have polymerized.

(8) The newly prepared 1 xTris-glycine electrophoresis buffer solution is filled in the electrophoresis frame, and the 1 xTris-glycine electrophoresis buffer solution below the electrophoresis frame can be repeatedly used for a plurality of times.

(9) Preparing a protein sample, namely taking the sample to be detected, adding a protein loading buffer solution with the final concentration of 1 multiplied, uniformly mixing, performing denaturation at the temperature of more than 95 ℃ for 5min, immediately placing on ice for cooling for more than 2min, centrifuging at the room temperature of 12000rpm for 3min, then taking a proper amount of sample application, selecting a proper protein Marker according to the size of the protein to be researched, and taking 3-5 mu l of sample loading.

(10) Constant voltage protein electrophoresis, wherein 100-120V electrophoresis is used in the concentrated gel at the beginning, and the voltage can be increased to 120-150V electrophoresis after the protein moves into the separation gel. The degree of protein separation is determined according to the position of the Marker so as to separate the target protein to the maximum.

(11) After the protein electrophoresis is started, a staining solution and reagents related to the staining solution are prepared.

(12) Coomassie brilliant blue development: the gel after electrophoresis was fixed in a fixative (10% glacial acetic acid, 40% ethanol, 50% distilled water) for 15 min. Washing with water for 15min for 3-4 times. Dyeing overnight, and the dye solution formula is as follows: 0.12G of Coomassie brilliant blue G250, 10G of ammonium sulfate, 10ml of phosphoric acid, 20ml of methanol and 70ml of distilled water. Decolorizing for more than 5 hr (shaking in distilled water).

As is evident from the gel, the 37-39kDa bands corresponding to OsGluA1, OsGluA2, OsGluA3 and OsGluB2 in the 7 mutants were significantly weaker and narrower than those of the parent, and similar phenomena were observed for the 22-23kDa glutelin a subunit. Thus, compared with the wild type, the accumulation of the glutelin is obviously reduced after the multi-gene knockout. In addition, the mutants had increased levels of 21kDa alpha-globulin and 10kDa, 13kDa and 16kDa prolamins. The specific results are shown in FIG. 11.

The quantitative analysis result of the component protein content shows that the gluten content of 7 different mutation types is respectively and remarkably reduced by 6.9%, 19.2%, 23.8%, 27.1%, 35.1%, 35.4% and 45.6%, and the reduction range is larger along with the increase of the number of the knockout genes (figure 12).

Example 4

In order to investigate whether the change in the protein content of rice affects the quality of cooked taste of rice, the determination of the Amylose (AC) content of rice and the determination of taste and hardness of rice were performed.

Determination of Amylose (AC) content of rice

The AC is measured according to the standard NY147-88 issued by the Ministry of agriculture, and the steps are slightly changed as follows:

(1) standing at room temperature for 3 months after the seeds are mature to balance water, and then hulling, grinding and sieving with a 100-mesh sieve;

(2) placing the sieved rice flour in a 42 ℃ oven for 2 days;

(3) accurately weighing 50mg +/-0.1 mg of rice flour on a ten-thousandth electronic balance, and placing the rice flour in a 50ml test tube;

(4) slowly adding 0.5ml of 95% ethanol solution along the tube wall, and slightly shaking to fully disperse the rice flour in the alcohol;

(5) slowly adding 4.5ml of 1.0N NaOH solution along the tube wall, shaking gently and mixing uniformly, and rotating the test tube to fully and uniformly mix the rice flour adhered to the tube wall;

(6) standing for one night;

(7) adding 20ml of distilled water into a 100ml volumetric flask, and sucking 5ml of overnight dispersion liquid into the volumetric flask;

(8) then 1.0ml of 1N acetic acid solution was added thereto to acidify the sample;

(9) adding 1.5ml of 0.02% iodine solution, shaking, metering to 100ml, and standing for 15 min;

(10) absorbing samples with the same volume and measuring the light absorption value at the wavelength of 620 mm;

(11) and (5) making a standard curve according to the light absorption value of the standard sample, and calculating the AC content of the sample to be detected.

Measurement of taste and hardness of cooked rice

The taste value of the test sample was measured using a rice taste meter model STA 1A.

(1) And (6) cooking rice. STA1A Rice taste meter stainless steel pot cooked rice, namely weighing 30g rice, putting into the stainless steel pot, connecting with a rice washing device, and washing with running water for 30 s. 40.5g of water was added to a stainless steel pot (i.e., sample amount: 1: 1.35). Covering with filter paper, fixing with rubber band, and soaking for 30 min. Putting into an electric cooker for steaming rice. And (5) after the power supply is automatically disconnected (about 30min) and the temperature is preserved for 10min, the power supply is pulled out. Taking out the stainless steel tank, taking off the filter paper, slightly stirring the rice, and covering the filter paper after stirring. Cooling in a cooler for 20min, and standing at room temperature for 1 h.

(2) And (5) making the rice cake. And filling 8g of rice into a special metal cup, and pressing into a rice cake.

(3) And (6) correcting the reference plate. The taste meter was calibrated with a black and white plate.

(4) And (4) measuring. The rice cake was inserted into a taste meter to measure and the instrument displayed the appearance, hardness, viscosity, balance and overall score values of the sample.

Amylose (AC) content measurements showed no significant difference from the control for all mutants except type VII (figure 13 a). In addition, two important indexes, namely, the taste value and the rice hardness, reflecting the rice cooking taste quality are further evaluated, the taste value of most mutants is obviously improved, the rice hardness is obviously reduced, and the cooking taste quality of the mutants is improved (fig. 13b and c).

The method for reducing the protein content of rice and improving the cooking taste quality of the rice specifically comprises the steps of carrying out polygene knockout on the glutelin synthetic gene by using a CRISPR/Cas9 gene editing technology, carrying out PCR amplification and sequencing on an editing section, and simultaneously removing vector plasmids on a genome through rice selfing to finally obtain plants with different mutation combinations.

Experiments prove that the reduction of the content of the rice gluten is more obvious along with the increase of the number of knocked-out genes of the gluten synthesis gene, and the total content of the rice protein is reduced to different degrees along with the reduction of the content of the gluten; although the prolamin and the globulin have a certain compensation effect, the reduction of the gluten content can quickly reduce the rice variety with higher total protein content to the requirement of high-quality rice on the market, usually about 7 percent; the reduction of the protein content of the rice reduces the hardness of the rice and improves the quality of the cooked taste without any negative effect on the processing and appearance quality of the seeds.

It should be noted that the above-mentioned embodiments are only for illustrating the technical solutions of the present invention and not for limiting, and although the present invention has been described in detail with reference to the preferred embodiments, it should be understood by those skilled in the art that modifications or equivalent substitutions may be made on the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention, which should be covered by the claims of the present invention.

Sequence listing

<110> Yangzhou university

<120> method for reducing rice protein content and improving cooking taste quality by using CRISPR/Cas9 technology

<160> 12

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1500

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

atggcatcca taaatcgccc catagttttc ttcacagttt gcttgttcct cttgtgcaat 60

ggctctctag cccagcagct attaggccag agcactagtc aatggcagag ttctcgtcgt 120

ggaagtccaa gagaatgcag gttcgatagg ttgcaagcat ttgagccaat tcggagtgtg 180

aggtctcaag ctggcacaac tgagttcttc gatgtctcta atgagcaatt tcaatgtacc 240

ggagtatctg ttgtccgtcg agttattgaa cctagaggcc ttctactacc ccattacact 300

aatggtgcat ctctagtata tatcatccaa gggagaggta taacagggcc aactttccca 360

ggctgtcctg agtcctacca acaacagttc caacaatcag gccaagccca attgaccgaa 420

agtcaaagcc aaagtcaaaa gttcaaggat gaacatcaaa agatccaccg tttcagacaa 480

ggagatgtaa ttgcattgcc tgctggtgta gctcattggt gctacaatga tggtgaagtg 540

ccagttgttg ccatatatgt cactgatctc aacaacggtg ctaatcaact tgaccctagg 600

caaagggatt tcttgttagc tggaaataag agaaaccctc aagcatacag gcgtgaggtt 660

gaggagcggt cacagaacat atttagtggc tttagcactg aactacttag cgaggctctt 720

ggcgtaagca gccaagtggc aaggcagctc caatgtcaaa atgaccaaag aggagaaatt 780

gtccgtgtcg aacacgggct cagtttgctg cagccatatg catcattgca ggagcaggaa 840

caaggacaag tgcaatcaag agagcgttat caagaaggac aatatcagca aagtcaatat 900

ggaagtggct gctctaacgg tttggatgag accttttgca ccctgagggt aaggcaaaac 960

atcgataatc ctaaccgtgc tgatacatac aatccaagag ctggaagggt tacaaatctc 1020

aacacccaga atttccccat tcttagtctt gtacagatga gtgcagtcaa agtaaatcta 1080

taccagaatg cactcctttc accattttgg aacatcaacg ctcacagcgt cgtgtatatt 1140

actcaaggcc gtgcccgggt tcaagttgtc aacaacaatg gaaagacagt gttcaacggc 1200

gagcttcgcc gcggacagct gcttattata ccacaacact atgcagttgt aaagaaggca 1260

caaagagaag gatgtgctta cattgcattc aagaccaatc ctaactctat ggtaagccac 1320

attgcaggaa agagttccat cttccgtgct ctcccaaatg atgttctagc aaatgcatat 1380

cgcatctcaa gagaagaggc tcagaggctc aagcataata gaggagatga gttcggtgca 1440

ttcactccaa tccaatacaa gagctaccaa gacgtttata atgcggcaga atcctcttag 1500

<210> 2

<211> 1500

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

atggcatcca taaatcgccc catagttttc ttcacagttt gcttgttcct cttgtgcgat 60

ggctccctag cccagcagct attaggccag agcactagtc aatggcagag ttctcgtcgt 120

ggaagtccga gaggatgtag atttgatagg ttgcaagcat ttgagccaat tcggagtgtg 180

aggtctcaag ctggcacaac tgagttcttc gatgtctcta atgagttgtt tcaatgtacc 240

ggagtatctg ttgtccgccg agttattgaa cctagaggcc tactactacc ccattacact 300

aatggtgcat ctctagtata tatcatccaa gggagaggta taacagggcc gactttccca 360

ggctgtcctg agacctacca gcagcagttc caacaatcag ggcaagccca attgaccgaa 420

agtcaaagcc aaagccataa gttcaaggat gaacatcaaa agattcaccg tttcagacaa 480

ggagatgtta tcgcgttgcc tgctggtgta gctcattggt gctacaatga tggtgaagtg 540

ccggttgttg ccatatatgt cactgatatc aacaacggtg ctaatcaact tgaccctcga 600

cagagggatt tcttgttagc tggaaataag agaaaccctc aagcatacag gcgtgaagtt 660

gaggagtggt cacaaaacat atttagtggc tttagcactg aactgcttag cgaggctttt 720

ggcataagca accaagttgc aaggcagctc cagtgtcaaa atgaccaaag aggagaaatt 780

gtccgcgttg aacgcgggct cagtttgctg caaccatatg catcattgca agagcaggaa 840

caaggacaaa tgcaatcaag agagcattat caagaaggag gatatcagca aagtcaatat 900

gggagtggct gccctaacgg tttggatgag accttttgca ccatgagggt aaggcaaaac 960

atcgataatc ctaaccgtgc tgatacatac aacccaagag ctggaagggt tacaaatctc 1020

aacagccaga atttccccat tcttaatctt gtacagatga gcgccgttaa agtaaatcta 1080

taccagaatg cactcctttc accgttctgg aacatcaacg ctcacagcat cgtgtatatt 1140

actcaaggcc gagcccaggt tcaagttgtc aacaacaatg gaaagacggt gttcaacgga 1200

gagcttcgtc gtggacagct acttattgta ccacaacact atgtagttgt aaagaaggca 1260

caaagagaag gatgtgctta cattgcattc aagacaaacc ctaactctat ggtaagccac 1320

attgcaggaa agagttccat cttccgtgct ctcccaactg atgttctagc aaatgcatat 1380

cgcatctcaa gagaagaggc tcagaggctc aagcataaca gaggagatga gttcggtgca 1440

ttcactcccc tccaatacaa gagctaccaa gacgtttata atgtggcgga atcctcttaa 1500

<210> 3

<211> 1491

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

atggcaacca tcaaattccc tatagttttc tccgtcgttt gcttgttcct cttgtgtaat 60

ggttcgttag cccaacttct tagccaaagt actagtcaat ggcaaagttc tcgccgtgga 120

agtccaagag agtgcagatt tgatcggttg caagcatttg agccgattcg cactgtaagg 180

tcccaagctg gtacaactga gttttttgat gtctctaatg agttgtttca atgtactgga 240

gtatttgttg tccgtcgagt tatcgaacct agaggtcttc tgttacctca ctactccaat 300

ggagcaactt tggtatatgt catccaaggc agaggtataa caggaccaac tttcccagga 360

tgtcctgaga cctatcaaca acagtttcag caatccgagc aagaccaaca attggaaggc 420

caaagccaaa gccataaatt tagagatgaa catcaaaaga tccaccgttt tcaacagggg 480

gatgtagttg cattgcctgc tggtgttgct cattggtgct acaatgatgg tgatgcacca 540

attgttgcca tatatgtcac tgatatatac aatagtgcta accaacttga tcctagacac 600

agggatttct ttttagctgg caacaataag ataggtcaac aattgtatag atatgaggca 660

agggacaatt cgaagaacgt ctttggtgga tttagtgttg aactacttag cgaggctctt 720

ggcataagca gtggagtagc aagacaactc cagtgccaaa atgaccaaag aggagaaata 780

gttcgtgttg agcatgggct ttccttgctc caaccatatg catcgttgca agagcaacaa 840

caagaacagg tgcaatcgag agactatggc caaacacaat atcaacaaaa acaacttcaa 900

ggtagttgct ctaatggttt ggatgagacc ttttgtacca tgagggtaag gcaaaatatc 960

gacaacccaa acctcgcaga tacatacaac cccagagcag gaaggatcac atatctaaat 1020

ggccaaaagt tccccattct taatcttgta cagatgagtg ccgttaaagt aaatttatat 1080

cagaacgcac tcctttcacc tttttggaac atcaacgctc atagtgtcgt gtatattact 1140

caaggtcgtg cccgagttca agtcgtcaac aacaatggaa agacagtgtt cgatggagag 1200

ctccgtcgtg ggcagcttct aattatacca caacaccatg tagtcattaa aaaggcacaa 1260

agggaaggat gctcatatat tgcattgaaa accaaccctg actccatggt tagccacatg 1320

gcaggaaaga attccatctt ccgcgcactt cctgacgatg ttgtagcaaa tgcatatcgt 1380

atctcaagag aagaagctag gaggctcaag cacaacaggg gagatgagtt aggtgtgttc 1440

actcctagtc atgcctacaa gagctaccaa gacatatctg tgagtgcata a 1491

<210> 4

<211> 1488

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

atggcaacta ccattttctc tcgtttttct atatactttt gtgctatgct attatgccag 60

ggttctatgg cccaactatt taatccaagc acaaacccat ggcatagtcc tcggcaagga 120

agttttaggg agtgtaggtt tgatagacta caagcatttg agccacttcg aaaagtaagg 180

tcagaagctg gggtgactga gtacttcgat gagaagaatg aattattcca atgcacaggt 240

acttttgtca tccgacgtgt cattcaacct caaggccttt tggtacctcg atatagcaat 300

actcctggcc tggtctacat cattcaaggg aggggttcta tgggtttaac cttccccggt 360

tgcccagcga cttatcagca acaattccaa caattttcgt ctcaaggcca aagtcaaagc 420

caaaagttta gggatgagca tcaaaagatc catcaattta gacaaggaga tgttgttgca 480

ctcccagctg gtgttgcaca ttggttctac aatgatggtg atgcatcggt tgttgccata 540

tatgtttatg acataaacaa cagtgcaaat caacttgaac caaggcaaaa ggagttccta 600

ttagctggta acaacaatag ggttcaacaa gtatatggca gctcaattga gcaacactct 660

agccaaaaca tattcaacgg attcggtact gagctactaa gtgaggcttt aggcatcaac 720

acagtagcag caaagaggct gcagagccaa aatgatcaga gaggagagat cgtacatgtg 780

aaaaatggcc ttcaattgtt gaaaccgact ttgacacaac aacaagaaca agcacaagct 840

caataccaag aagttcaata tagtgaacaa caacaaacat cttcccgatg gaacggattg 900

gaggagaact tctgcacaat caaggcaaga gtaaacattg aaaatcctag tcgtgctgat 960

tcatacaacc cacgtgctgg aaggatttca agtgtcaaca gccagaagtt ccccatcctt 1020

aacctcatcc aaatgagtgc taccagagta aacctatacc agaatgctat tctctcacca 1080

ttctggaatg tcaatgctca tagtttggtc tatatgattc aagggcaatc tcgagttcaa 1140

gtcgttagta actttggaaa gactgtgttc gatggtgtcc ttcgccctgg acaactattg 1200

atcattccac aacattatgc tgtcttgaag aaagcagagc gtgaaggatg ccaatatatt 1260

gcaatcaaga caaacgctaa cgccttcgtc agccaccttg caggaaaaaa ctcagtattc 1320

cgcgccttac cagttgatgt ggtcgctaat gcttaccgca tctcacggga gcaagcccga 1380

agcatcaaga acaatagggg agaagagcac ggtgccttca ctcctagatt tcaacaacaa 1440

tactacccag gattctcgaa tgagtccgaa agtgagactt cagagtaa 1488

<210> 5

<211> 1488

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

atgactattt ccgttttctc tcgattttct atatactttt gtgttcttct cttgtgcaat 60

ggatctatgg cccaactatt tgatccagcc acaaaccaat ggcaaactca tcgacaagga 120

agctttaggg agtgtagatt tgagagacta caagcatttg agcctcttca gaatgtgagg 180

tcggaagctg gtgtgaccga gtactttgat gagacgaatg aattgtttca gtgcacaggt 240

acatttgtca tccgacgtgt tattcaacct caaggccttc taatacctcg atacgccaat 300

actcctggca tggtctacat catccaagga agaggttcta tgggtctaac cttccctgga 360

tgccccgcaa cttaccagca gcaatcccaa cagtttttgt ttcaaggcga aagtcagagc 420

caaaagttta tagatgagca ccaaaagatt catcaattta ggcaaggtga tatcgttgta 480

ctcccaacag gtgttgcaca ttggttctac aatgatggtg acacgcctgt tgttgcccta 540

tatgtttatg acataaacaa tagcgctaat caacttgaac caaggcatag ggagttctta 600

ttggctggta agaacaatag ggtacaacaa gtgtatggtc gctcaattca gcaacactct 660

gggcaaaaca tattcaatgg attcagtgtt gagccactaa gtgaggcttt aaacatcaac 720

acagtaacaa caaagaggct acaaagccaa aatgaccaaa gaggagagat catacatgta 780

aagaatggcc ttcaattgct gaaaccaact ttgacacaac gacaagaaca agaacaagct 840

caataccaag aagtccaata tagtgaaaaa ccacaaacat cttcccgatg gaacggttta 900

gaggagaact tgtgcacaat caagacgagg ttaaacattg aaaatccaag tcgtgctgat 960

tcatacgatc cacgtgctgg aaggatcaca agtcttgata gtcagaaatt ccctatcctt 1020

aatatcatcc aaatgagtgc tactagagta aatctatacc agaatgctat tctcacacca 1080

ttctggaatg taaatgctca tagtttgatg tatgtgattc gagggcgtgc tcgagtccaa 1140

gtcgtcagta actttggaaa gactgtgttc gacggtgttc ttcgtccaga acaactattg 1200

attattccac aaaactatgt tgtcttaaag aaagcacaac atgaaggatg ccaatatatt 1260

gcaatcaaca caaacgctaa tgccttcgtg agccaccttg caggggtaga ctcagtattc 1320

catgccttac cagttgatgt tatcgctaat gcgtattgca tctcaaggga agaggctcga 1380

agactcaaga acaacagggg agacgagtat ggtccattcc ctcctagatt acaacaacaa 1440

atctacccag aattctcgaa tgaatctaaa ggcgagactt cagagtaa 1488

<210> 6

<211> 1500

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

atggcaacta ttgcattctc tcgattttct atatgctttt gtgtccttct cctttgccat 60

ggttctatgg ctcagatatt tagtctaggc ataaatccat ggcaaaatcc tcgacaaggg 120

ggttctaggg agtgtaggtt tgataggctc caagcgtttg agccgcttag gaaagtgagg 180

catgaagctg gggttacaga gtactttgat gagaagaatg agcagttcca gtgcaccggt 240

acattagtaa ttcgtcgcat tattgagcct cagggccttc ttttacctcg atactccaac 300

actcctggcc tagtatatat catccaaggg actggtgtac tgggattgac ctttcctggt 360

tgcccagcaa cttaccaaaa gcaatttagg cattttggtc ttgaaggagg aagccaaagg 420

caaggaaaaa aattaagaga tgaaaaccaa aagatccacc aatttaggca aggagatgtt 480

gttgcacttc cttctggtat accacactgg ttctataatg agggtgacac ccctgttgtt 540

gctttgtttg tttttgatgt aaacaacaat gctaatcaac tcgaaccaag acaaaaggag 600

ttcttgttag ctggtaacaa tatagagcaa caagtgtcca acccctcaat caacaaacat 660

tctgggcaaa acatattcaa tggattcaac actaagctat taagtgaggc cttaggcgtt 720

aacatagagg tgaccagaag gctacaaagt caaaatgacc gaagaggaga tatcattcga 780

gtaaagaatg gccttcgatt gataaaacca actatcacac aacaacagga acaaacacaa 840

gatcaatacc aacaaattca atatcataga gagcaacgat caacaagcaa atacaatggc 900

ttggatgaga acttctgtgc aattagggca aggttaaaca tagaaaaccc taatcatgct 960

gatacttaca accctcgtgc tggaaggatt acaaatctca atagccagaa gttctccatt 1020

cttaaccttg tccaaatgag tgctacaaga gtaaatctat accagaatgc tattctctca 1080

ccattctgga atattaatgc tcacagtttg gtgtatacaa ttcaagggcg tgctcgagtt 1140

caggttgtta gcaaccatgg aaaggctgta tttaatggtg ttcttcgtcc agggcaatta 1200

ctaattatac cacaaaatta tgtggttatg aagaaagcag agcttgaagg atttcaattt 1260

atcgcgttta agacaaaccc aaatgccatg gtaaaccaca tcgcggggaa gaactcagtt 1320

ctccgtgcaa tgcctgtgga tgtgatagct aatgcatatc gcatctcaag gcaggaagct 1380

cgtagcttga agaataatag gggagaagag attggtgctt tcactcctag atatcaacaa 1440

caaaaaatcc accaagagta ctcaaatcca aacgaaagtg agactcaaga ggtgatttaa 1500

<210> 7

<211> 1533

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

atggcttcca tgtctaccat tcttccattg tgccttggcc tccttctctt cttccaagtg 60

tccatggcac aattttcatt tgggggaagc ccacttcaga gcccacgtgg atttagggga 120

gaccaagata gtcgtcatca atgtcgtttt gagcacctca ccgcccttga ggcaacacac 180

cagcagagat ctgaagctgg attcactgag tactacaaca ttgaggcaag aaatgagttc 240

cgttgtgccg gagtgagcgt gaggcgctta gtcgtcgaga gcaagggctt agttttacca 300

atgtatgcta atgctcacaa gcttgtctac atcgtccaag gtcggggagt gtttgggatg 360

gcactgcctg gttgtccaga gacgttccag tcagttaggt ctccctttga gcaagaggtg 420

gcaacagctg gtgaggctca atcatcaatc caaaaaatga gagacgagca ccagcaactt 480

caccaattcc accaaggtga tgtaatcgca gtgccagctg gagtagccca ctggctatat 540

aacaatggtg attctcctgt ggttgctttc actgtcatcg acaccagcaa caatgccaac 600

cagctcgatc ctaaaagaag ggagtttttc ttggctggaa agcctagaag tagctggcag 660

cagcaatcgt actcatacca gacagaacaa ctgagcagaa atcagaacat ctttgctggg 720

ttcagcccag atttactttc tgaagccctg agtgtgagca agcaaactgt gttgaggctc 780

caaggcctga gtgacccaag aggtgccatc attagagttg aaaatgggct ccaggcactg 840

cagccctctc tccaagttga gccagtgaaa gaggaacaaa cccaagctta cttgccaacc 900

aagcagctac agcccacctg gttgcgaagt ggtggagctt gcggccagca aaatgtccta 960

gatgaaatta tgtgtgcatt taagttgagg aagaacatag acaacccaca atccagtgac 1020

atatttaacc cccatggtgg aaggatcaca agggccaata gccagaattt cccaatactc 1080

aatatcatcc agatgagtgc caccagaatc gttctccaaa ataatgcctt gcttactcct 1140

cattggacgg taaacgcaca cacggtgatg tacgtgaccg ctggccaagg gcacatccag 1200

gtggtggatc accgtggtag gagtgtcttt gatggtgagc ttcaccaaca gcagatcttg 1260

ttgatcccac agaactttgc agtggtggtg aaggctcgac gtgaaggatt tgcatgggta 1320

tccttcaaga ccaatcacaa tgctgtcgac agtcagatcg cagggaaggc ctccattctt 1380

cgtgctctac ccgttgacgt ggtcgccaat gcttataggc tttcaaggga ggactctagg 1440

catgtaaagt tcaaccgcgg cgatgagatg gctgtctttg ctccgaggcg tgggccgcaa 1500

cagtatgctg agtggcagat caacgagaag taa 1533

<210> 8

<211> 1455

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

atggcaacta ctacctctct attgtcttcc tgtctctgtg ctcttctctt ggctccgctc 60

tttagccaag gtgtagatgc atgggaaagc cgacaagggg cttccaggca gtgcagattt 120

gataggttac aagcatttga gcccctaaga aaggtacgat cggaagctgg ggacacagag 180

tactttgatg agagaaatga gcagtttcga tgcgctggtg tctttgtcat tcggcgcgtg 240

attgagccac aaggccttgt ggtgcctcga tactcgaaca ctcctgctct agcctacata 300

atccaaggaa aaggttacgt aggattgact tttcctggtt gcccagcaac acaccaacaa 360

caattccaac tatttgaaca aagacagagc gaccaagctc ataagtttag agatgagcac 420

cagaagattc acgaatttag gcaaggggat gttgttgcac ttccggctag tgttgcacat 480

tggttctaca atggtggtga tacaccggct gttgttgtct atgtttatga cataaaaagt 540

tttgctaatc agcttgaacc aaggcagaag gagtttttat tagctggtaa caaccagaga 600

gggcaacaaa tatttgaaca ttccatcttt caacactctg gacaaaatat atttagtggg 660

ttcaatactg aggtacttag cgaggccctt ggaataaaca cggaggcttc caagaggctc 720

caaagtcaaa atgaccaaag gggagatatc attcgagtga agcacgggct tcaattgttg 780

aaacccacat taacacaacg acaggaagaa catcgtcaat atcaacaagt ccagtatcgt 840

gaaggacaat ataatggatt ggacgagaat ttctgtacaa taaaggcaag ggtaaacatt 900

gaaaatccta gccgcgctga ctactacaac cctcgtgctg gaaggataac ccttcttaac 960

aaccaaaagt tccctattct caaccttatt ggaatgggtg ctgcaagagt aaacttatac 1020

cagaatgctc ttctctcacc cttctggaac attaatgccc atagtgtagt gtatatcatc 1080

caaggaagtg tgcgagtaca ggttgccaat aatcaaggaa gatctgtgtt taatggtgta 1140

cttcatcagg ggcaactatt aatcatacca caaaaccatg ccgtcattaa gaaagccgag 1200

cacaatgggt gccagtatgt cgcaataaag acaatttcgg accctacggt gagttgggtt 1260

gctggaaaga actccatatt acgtgcattg cctgtagatg ttattgccaa tgcttatcgt 1320

atctcgaggg atgaagcccg acgtctaaag aataataggg cagatgagat tggccctttt 1380

actcctcgtt tcccccagaa gagccagcgg ggttaccagt tcctaactga aggcctctct 1440

ttaatcggca tgtaa 1455

<210> 9

<211> 23

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

gctcattggt gctacaatga tgg 23

<210> 10

<211> 23

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

caaacatctt cccgatggaa cgg 23

<210> 11

<211> 23

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

aggtcgggga gtgtttggga tgg 23

<210> 12

<211> 21

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

tacaaccctc gtgctggaag g 21

Claims

1. A method of producing transgenic rice, comprising: comprises mutating glutelin synthesis gene of receptor rice genome to reduce glutelin expression amount or block glutelin generation, and obtaining the transgenic rice.

2. The method of producing transgenic rice according to claim 1, wherein: the glutelin synthetic gene of the receptor rice genome is mutated by adopting a gene editing mode;

3. The method of producing transgenic rice according to claim 1 or 2, wherein: the gene editing is carried out by using a CRISPR/Cas9 system, and the CRISPR/Cas9 system is any one of the following systems:

4. The method of producing transgenic rice according to claim 3, wherein: the target sequence of gRNA in the CRISPR/Cas9 system comprises one or more of SEQ ID NO.9, SEQ ID NO.10, SEQ ID NO.11 and SEQ ID NO. 12.

5. A method of producing transgenic rice, comprising: comprises the steps of (a) preparing a mixture of a plurality of raw materials,

carrying out gene editing on receptor rice by adopting the CRISPR/Cas9 system as claimed in claim 3 or 4 to obtain transgenic rice;

alternatively, the specific recombinant plasmid of claim 3 is introduced into recipient rice to obtain transgenic rice.

6. The method of producing transgenic rice according to claim 5, wherein: the specific recombinant plasmid of claim 3 is transformed into crop callus through agrobacterium mediation, and through screening, differentiation, rooting and positive detection, transgenic rice is obtained.

7. The method of producing transgenic rice according to claim 6, wherein: the crops comprise one of rice, rice and corn.

8. A method of preparing a transgene-free, gene-edited rice plant, comprising: comprises the steps of (a) preparing a mixture of a plurality of raw materials,

transgenic rice produced by the method according to claims 1 to 4 or produced by the method according to claims 5 to 7;

selfing the transgenic rice to obtain selfed progeny;

and screening the transgenic-free gene editing rice from the selfing progeny.

9. A DNA molecule of rice, characterized in that: the DNA molecules of the rice comprise the DNA molecules,

10. Use of the method according to any one of claims 1 to 8 for improving the quality of cooked taste of rice.