CN114106107A

CN114106107A - Immune peptide and preparation method thereof

Info

Publication number: CN114106107A
Application number: CN202111371339.9A
Authority: CN
Inventors: 马晓瑛; 陈炳国; 丁霞; 林学仁
Original assignee: Poyu Zhejiang Biotechnology Co ltd
Current assignee: Poyu Zhejiang Biotechnology Co ltd
Priority date: 2021-11-18
Filing date: 2021-11-18
Publication date: 2022-03-01

Abstract

The invention discloses an immune peptide and a preparation method thereof, wherein the immune peptide contains any one of amino acid sequences shown in SEQ ID NO. 1-5. The immune peptide disclosed by the invention has better antibacterial activity and lower hemolytic property, and has the characteristics of low toxicity and strong stability, and meanwhile, the immune peptide has short peptide chain length and low production cost.

Description

Immune peptide and preparation method thereof

Technical Field

The invention relates to the technical field of genetic engineering, in particular to an immune peptide (Mactide) and a preparation method thereof.

Background

The immune peptide is a biological short peptide with antibacterial activity, the number of amino acids is less than 100, the small peptide is usually positively charged and has broad-spectrum antibacterial property, is a defensive polypeptide active substance which is generated by an organism immune defense system and has the pathogenic effect against exogenous pathogens, is an important component of the organism innate immunity, and forms an immune defense system of a host together with interferon, complement and the like, and the bioactive small molecules are nonspecific immune response products and have broad-spectrum antibacterial effect, and have the inhibiting and killing effect on gram-positive bacteria, gram-negative bacteria and fungi without damaging normal cells in an animal body.

The immune peptide has the advantages of quick sterilization, wide antibacterial spectrum, small toxic and side effect, no immunogenicity and the like. In addition, due to the special sterilization mechanism, the pathogenic microorganisms which are inhibited or killed do not generate resistant strains, and the effect of killing bacteria cannot be weakened due to drug resistance.

Many researches show that the production process of natural polypeptide has a bottleneck, and the antibacterial activity and the stability of the product are not ideal. Thus, there is a need for a natural polypeptide that has been engineered to retain its existing antimicrobial activity, to have greatly reduced toxicity, to have enhanced stability, and to achieve cost reduction by reducing the length of the peptide chain.

In view of this, the invention is particularly proposed.

Disclosure of Invention

The invention aims to provide an immune peptide and a preparation method thereof. The immune peptide (Mactide) provided by the invention is a novel antibacterial polypeptide, has better antibacterial activity, lower hemolytic property and strong stability, and in addition, the peptide chain of the immune peptide is short in length and low in production cost.

The invention is realized by the following steps:

in a first aspect, the present invention provides an immunopeptide (Mactide) having an amino acid sequence selected from any one of SEQ ID nos. 1 to 5:

serial number	Encoding	Amino acid sequence
			1	SEQ ID NO.1	MRKRK RKRKK YKPII VPIIR K
2	SEQ ID NO.2	MRKEK RKRKK YEPII VPIIR K
			3	SEQ ID NO.3	RKEKR KRKKY EPIIV PIIRK
4	SEQ ID NO.4	GKEKR KRKKY EPIIV PIIRK
			5	SEQ ID NO.5	MGRKE KRKRK KYEPI IVPII RK

The immune peptide (Mactide) shown in SEQ ID NO.1-5 provided by the invention does not belong to any traditional polypeptide, belongs to a novel immune peptide, is optimized and modified on the basis of a traditional mammal source, and is produced by adopting a heterologous expression system of a genetic engineering recombination technology, so that the novel immune peptide has better antibacterial activity, lower hemolysis, lower toxicity and stronger stability.

In one aspect, the invention provides an isolated nucleic acid molecule encoding an immunity peptide (Mactide) as described above.

Further, in some embodiments of the present invention, the nucleotide sequence is shown in SEQ ID No.6 as follows:

ATGCGGAAAGAGAAGCGTAAGCGTAAGAAGTACGAGCCGATCATCGTCCCGATCATCCGGAAATGA。

the nucleotide sequence shown in SEQ ID NO.6 can encode the immune peptide (Mactide) shown in SEQ ID NO.2, and the nucleotide sequences of other immune peptides (Mactide) can be obtained by reasonably changing the amino acid codons on the basis of the nucleotide sequence.

The nucleotide sequence shown in SEQ ID NO.6 is a sequence after codon optimization, and the immune peptide (Mactide) is expressed in escherichia coli in a recombination way by adopting the nucleotide sequence, so that the expression efficiency is higher, and the yield of the immune peptide (Mactide) can be improved.

Further, in some embodiments of the invention, the amino acid sequence of the immunity peptide (Mactide) is shown in SEQ ID NO. 2.

In another aspect, the present invention provides a vector comprising a nucleic acid molecule as described above.

Further, in some embodiments of the invention, the vector contains a promoter that drives expression of the nucleic acid molecule.

Further, in some embodiments of the invention, the backbone of the vector is pET-28 a.

Further, in some embodiments of the invention, the nucleic acid molecule is located between the NcoI cleavage site and the XhoI cleavage site of the vector.

In another aspect, the present invention provides a recombinant cell comprising a vector as defined in any one of the above.

Further, in some embodiments of the invention, the recombinant cell is selected from the group consisting of e.coli BL21(DE 3).

In another aspect, the present invention provides a method of preparing the immunopeptide (Mactide) as described above, comprising: the recombinant cells as described above are cultured.

Further, in some embodiments of the invention, the method comprises: when the OD600 of the culture solution for culturing the recombinant cells reaches 0.5-1.5, an inducer is added for induction culture.

Further, in some embodiments of the invention, the temperature of the induction culture is 28-32 ℃ and the time of the induction culture is 6-8 h.

Further, in some embodiments of the invention, the inducer is IPTG.

Further, in some embodiments of the invention, the concentration of the inducer in the culture broth is controlled to be 0.1-1 mM.

Further, in some embodiments of the invention, when the recombinant cell is escherichia coli, the method comprises: after the culture is finished, collecting the thalli, centrifuging the thalli, collecting the thalli, resuspending the thalli in purified water, carrying out ultrasonic crushing, centrifuging again, and collecting a supernatant.

Further, in some embodiments of the invention, the method further comprises: and (4) performing cation chromatography on the supernatant, eluting with an elution solution, and collecting the eluate.

Further, in some embodiments of the invention, the chromatography medium used for cationic chromatography is SP-Sepharose Fast Flow medium.

Further, in some embodiments of the invention, the elution solution is a Tris-HCl solution containing 2M NaCl.

Further, the eluent is prepared by preparative HPLC, and elution peaks with high purity are collected;

further, the solution required by the high pressure chromatography is acetonitrile and trifluoroacetic acid solution;

further, in some embodiments of the invention, the method further comprises: and (3) dialyzing, desalting and replacing the flow-through liquid by adopting a dialysis membrane with the molecular weight cutoff of 1KD to obtain the immunopeptide (Mactide).

The invention has the beneficial effects that: the immune peptide (Mactide) disclosed by the invention has better antibacterial activity and lower hemolysis, and has the characteristics of low toxicity and strong stability, meanwhile, the immune peptide has short peptide chain length and low production cost, and in addition, the preparation method provided by the invention has high yield, and the prepared immune peptide has high purity.

Drawings

In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings needed to be used in the embodiments will be briefly described below, it should be understood that the following drawings only illustrate some embodiments of the present invention and therefore should not be considered as limiting the scope, and for those skilled in the art, other related drawings can be obtained according to the drawings without inventive efforts.

FIG. 1 shows the results of the hemolysis assay of the candidate polypeptide in example 2.

FIG. 2 shows the results of the detection of the expression efficiency of the nucleic acid sequences of different BAMP21 (SEQ ID NO.2 amino acid sequence as described above) in Experimental example 3;

lane 1 is Marker, lane 2 is the inducible expression level of example 2, lane 3 is the inducible expression level of control 1, lane 4 is the inducible expression level of control 2, and lane 5 is Please supplement.

FIG. 3 is a Tricine-SDS-PAGE electrophoresis of BAMP21 immunopeptide (Mactide) from example 6; lane 1 Marker, lane 2 purified immunopeptide.

FIG. 4 preparative HPLC preparative chromatography.

Detailed Description

In order to make the objects, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. The examples, in which specific conditions are not specified, were conducted under conventional conditions or conditions recommended by the manufacturer. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products available commercially.

The features and properties of the present invention are described in further detail below with reference to examples.

Example 1

Synthesizing candidate amino acid sequences in SEQ ID NO.1 to SEQ ID NO.5 by adopting a chemical solid phase synthesis mode; detecting the purity of the synthesized polypeptide by adopting high-pressure chromatography, and determining that the purity of the synthesized polypeptide is more than 98%; wherein the high pressure chromatography detection conditions are A: contains 0.05% (V/V) of trifluoroacetic acid, B: containing 0.05% acetonitrile, the detection wavelength was 210nm, and B increased linearly from 0 to 90% (V/V) within 40 minutes. After the qualified polypeptide of the synthetic candidate sequence is obtained, the Minimum Inhibitory Concentration (MIC) is taken as an evaluation index, and a gram-positive bacterium bacillus subtilis and a gram-negative bacterium escherichia coli are preferably taken as indicator bacteria for carrying out bacteriostatic activityAnd (6) evaluating. And (3) MIC checking: (1) adopting LB culture medium to dilute antibiotic medicine solution with different concentration; (2) adding the mixture into a 96-well polystyrene plate, adding 100ul of medicine solution into the 1 st to 11 th wells, wherein the medicine concentration is 640, 320, 160, 80, 40, 20, 10, 5, 2.5, 1.25 and 0.625ug/ml, and adding 100ul of LB culture medium into the 12 th well as a growth control; (3) the bacterial suspension is diluted by LB culture medium to prepare about 210⁶CFU/ml suspension; (4) adding 100ul of the bacterial suspension into a 96-well plate, culturing for about 20 hours at 37 ℃, measuring the light absorption value, and judging the minimum inhibitory concentration. The results of the experiment are as follows:

from MIC analysis, it can be found that the polypeptides of SEQ ID NO.1-SEQ ID NO.5 all have good bacteriostatic ability, wherein SEQ ID NO.2 has superior bacteriostatic ability, and therefore, the polypeptides are further developed as candidate sequences.

Example 2

The 5 candidate amino acid sequences synthesized in example 1 are selected to be preferred development objects by using hemolytic property as an evaluation index, and specific hemolytic detection data of the candidate amino acid sequences are shown in fig. 1, wherein the sequence of SEQ ID No.2 has lower hemolytic property as a subsequent preferred development object, and hereinafter, the polypeptide of SEQ ID No.2 is named as BAMP 21. Performing hemolytic detection by using fresh human red blood cells, (1) centrifuging 1000g of human red blood cells for 7 minutes by using a PBS (phosphate buffer solution) with pH =7.4, and washing for 2-3 times; (2) dissolving the candidate polypeptide into the same PBS solution, and adding the candidate polypeptide according to the same proportion of 0, 100uM, 200uM and 400uM to the washed human red blood cells; (3) incubating for 1 hour at 37 ℃; (4) centrifuging for 5 minutes by a centrifugal force of 1000 g; (5) the centrifuged supernatant was examined at a wavelength of 405 nm. The calculation formula is as follows:

example 3

1, constructing an expression vector containing the BAMP21 gene by the following method:

synthesizing a BAMP21 gene fragment by adopting a whole gene synthesis technology:

CCATGGATGCGGAAAGAGAAGCGTAAGCGTAAGAAGTACGAGCCGATCATCGTCCCGATCATCCGGAA ATGATGACTCGAG。

wherein, underlined letters are BAMP21 gene sequence (SEQ ID NO.6, which is designed according to the codon preference of Escherichia coli, and the encoded amino acid sequence is MRKEK RKRKK YEPII VPIIR K (SEQ ID NO.2), and 5 'end and 3' end have restriction enzymes NcoI and XhoI, respectively.

2 construction of recombinant E.coli containing expression vector of pET28a (+) -BAMP21

The method comprises the following steps:

the correctly sequenced recombinant vector pET-28a (+) -BAMP21 was transformed into BL21(DE3) E.coli by heat shock and screened on LB (kanamycin sulfate-containing, 100. mu.g/ml) plates. The heat shock method adopts heat shock at 42 ℃ for 1.5 minutes and stands on ice for 2 minutes; then adding LB broth without resistance to culture at 37 ℃ and 120rpm for about 1 hour; finally, the mixture was evenly spread on an LB resistant plate containing kanamycin sulfate, and was subjected to inverted culture at 37 ℃ overnight for screening of positive clones.

The resulting recombinant E.coli was named BL21(DE3) -BAMP 21.

Experimental example 1

Detection of expression of BAMP21 in the recombinant E.coli obtained in example 3

The detection method comprises the following steps: recombinant Escherichia coli BL21(DE3) -BAMP21 of example 3 was taken, and recombinant BL21(DE3) -BAMP21 was cultured in LB basal medium at 37 ℃ and 220rpm, and when the cell density OD600 reached 0.5-1.5, the temperature was lowered to 30 ℃ and 1mM IPTG was added for induction for 6-8 hours; collecting 0.1ml bacterial liquid, centrifuging, collecting thallus, adding 4 × loading buffer 20 μ l and purified water 60 μ l, decocting at 100 deg.C for 10min, centrifuging at 12000rpm, collecting supernatant, performing whole bacterial electrophoresis for detecting induced expression, and finding the result shown in FIG. 2.

In addition, a control group was set to compare the effect of different BAMP21 coding sequences on expression levels, and the BAMP21 coding sequences of the control group were as follows:

control group 1:

5’ATGCGAAAAGAGAAGCGAAAGCGAAAGAAGTACGAGCCGATCATCGTCCCGATCATCCGAAAATGA3’；

control group 2:

5’ATGCGAAAGGAGAAACGAAAACGAAAAAAATACGAGCCGATCATCGTCCCGATCATCCGAAAATGA 3’。

recombinant E.coli was prepared and expression tested in substantially the same manner as in example 3, except that the BAMP21 coding sequence of control group 1 or 2 (which was also designed according to the codon preference of E.coli) was used in place of the BAMP21 coding sequence of example 3, and the results are shown in FIG. 2.

In FIG. 2, lane 5 is a blank control without induction, lane 3 is the induction expression level of control 1, lane 4 is the induction expression level of control 2, and lane 2 is the induction expression level of example 2; it can be seen that the band in lane 2 is darker, indicating that the expression level of BAMP21 in the recombinant E.coli of example 3 is nearly 1-fold higher than that in the control group, indicating that the expression efficiency of BAMP21 coding sequence (SEQ ID NO. 6) in example 3 is higher than that of BAMP21 coding sequence in the control group.

Example 4

In order to obtain the BAMP21 polypeptide, a fermentative expression culture is required, under the following conditions:

the recombinant Escherichia coli BL21(DE3) -BAMP21 obtained in example 3 was used for seed culture, and after a certain amount of Escherichia coli was obtained, it was inoculated into a fermentation medium for IPTG inducible expression.

Wherein the fermentation culture media are LB culture media;

the induction time is that the OD600 of the thallus growth is in the range of 0.5-1.5, the concentration of an inducer IPTG is 1mM, and the induction time is 6-8 h;

the expression method of BAMP21 in the fermentation liquor is as follows:

after induction, 10ml of culture solution is taken, centrifuged at 10000rpm for 10min, washed once by PBS and resuspended in equal volume, the resuspended solution is subjected to ultrasonication, the crushed solution is centrifuged at 9000rpm for 20min, then the supernatant is taken, and the content of the immunopeptide is detected by the HPLC detection method in example 1.

The result shows that the expression level of BAMP21 can reach more than 20mg/L under the condition of shake flask culture.

Example 5

Purification of recombinant BAMP21

(1) The bacterial liquid BL21(DE3) -BAMP21 cultured in example 4 was centrifuged in a low-temperature high-speed centrifuge, and then the cells were collected;

(2) adding the collected thalli into purified water for resuspension, carrying out ultrasonic crushing after resuspension, centrifuging the fully crushed solution for 15min at 10000rpm and 4 ℃, and taking the supernatant;

(3) regulating the pH of the supernatant to 7-8 by adopting Tris dry powder, centrifuging for 25min at 10000rpm and 4 ℃, and taking the supernatant; (ii) a

(4) Performing cation chromatography on the clarified solution, wherein the chromatography medium used in the cation chromatography is SP-Sepharose Fast Flow medium, washing off the foreign proteins by using 0.02M Tris-HCl solution containing 1.5M NaCl, eluting by using 0.02M Tris-HCl solution containing 2M NaCl, and collecting the elution peak;

(5) the elution peak is prepared by preparative HPLC, wherein the A solution is 0.05% trifluoroacetic acid, the B solution is 0.05% acetonitrile, the concentration of the B solution is 20% within 2 minutes and is maintained for 20min, the concentration of the B solution is increased from 20% to 100% within 30min, the elution peak at the stage is collected, and the map is shown in FIG. 4;

(6) the elution peak is dialyzed by a dialysis membrane with 1KD for liquid exchange and desalination to obtain BAMP21 with antibacterial activity, namely high-purity immune peptide (Mactide).

Samples of BAMP21 immunopeptide (Mactide) were examined by Tricine-SDS-PAGE and analyzed for BAMP21 immunopeptide (Mactide) purity.

The results are shown in fig. 3, fig. 3 showing that the monomer is purified to greater than 98% and the molecular weight size is consistent with the theoretical molecular weight of BAMP 21; in addition, the purity of the BAMP21 immunopeptide (Mactide) monomer was greater than 98% by HPLC.

Example 6

BAMP21 immunopeptide (Mactide) monomer biological activity detection-MIC experiment

(1) Inoculating indicator bacterium Escherichia coli in TSB culture medium, culturing at 33 deg.C and 220rpm for 24 hr, adjusting OD600 to about 0.8-0.9 as bacterial suspension, and diluting with MH broth culture medium by 500 times;

(2) taking a sample to absorb 50 mu l of the sample, and diluting 11 stages by 2 times step by using sterile ultrapure water as diluent;

(3) and (3) sucking 50 mu l of sample or kanamycin sulfate standard into a 96-well plate, sucking 50 mu l of bacteria to be detected into the 96-well plate, wherein the 12 th well is a growth control containing no sample to be detected. Dilutions were placed in parallel with negative controls of MH broth, two per group. Incubation is carried out for 17h at 35 ℃, and results are observed and recorded and are shown in table 1.

From example 7, it can be seen that the BAMP21 immunopeptide (Mactide) monomer provided by the embodiment of the present invention has a good bacteriostatic effect on fungi such as gram-negative bacteria, gram-positive bacteria and candida albicans.

Sequence listing

<110> Bt-Biotechnology Limited

<120> immunopeptide and process for producing the same

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 21

<212> PRT

<213> Escherichia coli (Escherichia coli)

<400> 1

Met Arg Lys Arg Lys Arg Lys Arg Lys Lys Tyr Lys Pro Ile Ile Val

1 5 10 15

Pro Ile Ile Arg Lys

20

<210> 2

<211> 21

<212> PRT

<213> Escherichia coli (Escherichia coli)

<400> 2

Met Arg Lys Glu Lys Arg Lys Arg Lys Lys Tyr Glu Pro Ile Ile Val

1 5 10 15

Pro Ile Ile Arg Lys

20

<210> 3

<211> 20

<212> PRT

<213> Escherichia coli (Escherichia coli)

<400> 3

Arg Lys Glu Lys Arg Lys Arg Lys Lys Tyr Glu Pro Ile Ile Val Pro

1 5 10 15

Ile Ile Arg Lys

20

<210> 4

<211> 20

<212> PRT

<213> Escherichia coli (Escherichia coli)

<400> 4

Gly Lys Glu Lys Arg Lys Arg Lys Lys Tyr Glu Pro Ile Ile Val Pro

1 5 10 15

Ile Ile Arg Lys

20

<210> 5

<211> 22

<212> PRT

<213> Escherichia coli (Escherichia coli)

<400> 5

Met Gly Arg Lys Glu Lys Arg Lys Arg Lys Lys Tyr Glu Pro Ile Ile

1 5 10 15

Val Pro Ile Ile Arg Lys

20

<210> 6

<211> 81

<212> DNA

<213> Escherichia coli (Escherichia coli)

<400> 6

Claims

1. An immunopeptide having an amino acid sequence selected from any one of SEQ ID No.1 to 5.

2. An isolated nucleic acid molecule encoding the immunopeptide of claim 1;

preferably, the nucleotide sequence is shown in SEQ ID NO. 6.

3. A vector comprising the nucleic acid molecule of claim 2;

the skeleton of the vector is pET-28 a; the nucleic acid molecule is located between the NcoI and XhoI cleavage sites of the vector.

4. A recombinant cell comprising the vector of claim 3.

5. The recombinant cell of claim 4, wherein the recombinant cell is E.coli BL21(DE 3).

6. A method of preparing the immunopeptide of claim 1, comprising: culturing the recombinant cell of claim 5.

7. The method of claim 6, wherein the method comprises: when the OD600 of the culture solution for culturing the recombinant cells reaches 0.5-1.5, adding an inducer for induction culture; the temperature of the induction culture is 28-32 ℃, and the time of the induction culture is 6-8 h; the inducer is IPTG; the concentration of the inducer in the culture medium is controlled to be 0.1-1 mM.

8. The method of claim 7, wherein when the recombinant cell is E.coli, the method comprises: after the culture is finished, collecting the thalli, centrifuging, resuspending, ultrasonically crushing, re-centrifuging, collecting supernatant,

preferably, the chromatography medium used for cation chromatography is SP-Sepharose Fast Flow medium;

preferably, the elution solution comprises a Tris-HCl solution of NaCl;

preferably, the eluent is prepared by HPLC, and an elution peak with high purity is collected;

preferably, the method further comprises: and dialyzing, desalting and replacing the HPLC preparation sample by adopting a dialysis membrane with the molecular weight cutoff of 1KD to obtain the immunopeptide.