CN114099684B

CN114099684B - Application of miR-32-5p in preparation of medicine for improving sensitivity of tumor cells to dihydroartemisinin

Info

Publication number: CN114099684B
Application number: CN202210082767.8A
Authority: CN
Inventors: 李玉洁; 陈利娜; 刘拓; 郑钟原; 郑颖; 杨晓涵; 杨源民; 张雨; 邓硕秋; 瞿水清
Original assignee: Institute of Materia Medica of CAMS
Current assignee: Institute of Materia Medica of CAMS
Priority date: 2022-01-25
Filing date: 2022-01-25
Publication date: 2022-04-19
Anticipated expiration: 2042-01-25
Also published as: CN114099684A

Abstract

The invention discloses application of miR-32-5p in preparation of a medicine for improving the sensitivity of tumor cells to dihydroartemisinin, and experimental research shows that miR-32-5p can improve the sensitivity of neuroblastoma cells to dihydroartemisinin, so that the treatment effect is enhanced, and based on the functions of miR-32-5p, potential substances capable of improving the sensitivity of dihydroartemisinin can be screened.

Description

Application of miR-32-5p in preparation of medicine for improving sensitivity of tumor cells to dihydroartemisinin

Technical Field

The invention belongs to the technical field of biological medicines, and particularly relates to application of miR-32-5p in preparation of a medicine for improving sensitivity of tumor cells to dihydroartemisinin.

Background

Neuroblastoma (NB) is the most common extracranial solid malignancy in infancy, developed from precursor cells of peripheral sympathetic nervous tissue, with over 50% of Neuroblastoma occurring in infants less than 2 years of age, accounting for 15% of cancer mortality in children (Park, j. r., Eggert, a. & Caron, h. Neuroblastoma: Biology, Prognosis, and treatment. Hematology/Oncology Clinics of North america 200824, 65-86.; Irwin MS, Park JR. Neuroblastoma: paradigm for Prognosis purposes. Pediatric Clinics of North america 2015 Feb; 62-. At present, various treatment means aiming at neuroblastoma are adopted, and treatment means such as operation, chemotherapy, radiotherapy, immunotherapy and the like are generally adopted at home and abroad, but because early diagnosis of neuroblastoma is difficult, the treatment effect of neuroblastoma is not ideal, chemotherapy is used as an important treatment mode of neuroblastoma, and drug resistance is an important reason for failure of chemotherapy all the time.

Dihydroartemisinin (DHA) is obtained by reducing artemisinin with sodium tetrahydroborate, and is also an active metabolite of artemisinin drugs in organisms. Because of its good absorption, rapid metabolism and excretion, safety and low toxicity, it has become a hot point of research in many medical fields. Dihydroartemisinin has a direct cytotoxic effect on tumor cells and can induce apoptosis in tumor cells (KUWANO. K. invasion of epithelial cell apoptosis in apoptosis diseases [ J ]. Intern Med, 2008, 47 (5): 345-. The tumor cells have more free iron ions compared with the cytoplasm of normal cells, which is also a key factor that dihydroartemisinin can selectively kill the tumor cells, the dihydroartemisinin contains a peroxide bridge structure inside, when ferrous ions are encountered, the bridge structure is broken to generate a large number of free radicals taking carbon as a center, the level of active oxygen free radicals is also greatly increased, the continuous increase of the content of the two free radicals can cause irreparable damage to DNA, so that double strands of the DNA are broken, and the tumor cells are killed, the dihydroartemisinin induces the tumor cells to undergo apoptosis and participates in Endoplasmic reticulum stress (endothelial cell stress), mitochondrial apoptosis and death receptor (death receptor) pathways, each pathway is not independent and plays a role in the apoptosis of the tumor cells together, but the effect of the dihydroartemisinin when used alone is poor.

In view of the above, experimental research shows that miR-32-5p can improve the sensitivity of neuroblastoma cells to dihydroartemisinin, so that the treatment effect is enhanced, and based on the functions of miR-32-5p, potential substances capable of improving the sensitivity of dihydroartemisinin can be screened. At present, no document reports the application of miR-32-5p in serving as a dihydroartemisinin medicament sensitizer.

Disclosure of Invention

Aiming at the defects in the prior art, the invention aims to provide application of miR-32-5p in preparation of a medicine for improving the sensitivity of tumor cells to dihydroartemisinin, wherein the miR-32-5p can obviously improve the sensitivity of neuroblastoma cells to dihydroartemisinin, in addition, the miR-32-5p improves the sensitivity of dihydroartemisinin in vivo through targeting VPS4B, the combined application of miR-32-5p and dihydroartemisinin has a synergistic inhibition effect on migration and invasion of neuroblastoma cells, and further in vivo experimental studies prove that the combination of miR-32-5p and dihydroartemisinin has a combined effect of inhibiting neuroblastoma metastasis.

The above object of the present invention is achieved by the following technical solutions:

the first aspect of the invention provides application of miR-32-5p and/or a target gene thereof in preparation of a medicament for improving the sensitivity of tumor cells to dihydroartemisinin;

preferably, the target gene is VPS 4B;

preferably, the nucleotide sequence of the miR-32-5p is shown in SEQ ID NO 1;

preferably, the miR-32-5p is highly expressed or overexpressed;

preferably, the target gene is under-expressed or not expressed.

Further, the SEQ ID NO:1 is UAUUGCACAUUACUAAGUUGCA (SEQ ID NO: 1).

Further, the tumor cells include neuroblastoma cells, melanoma cells, kidney cancer cells, lung cancer cells, pancreatic cancer cells, prostate cancer cells, cervical cancer cells, breast cancer cells, ovarian cancer cells, liver cancer cells, glioma cells, stomach cancer cells, bladder cancer cells, colon cancer cells;

preferably, the tumor cell is a neuroblastoma cell.

Further, the miR-32-5p comprises miR-32-5p and/or an agent for promoting miR-32-5p expression.

Further, the agent for promoting miR-32-5p expression comprises (but is not limited to): and a reagent, a binding molecule, a small molecular compound and the like for promoting miR-32-5p expression are designed aiming at miR-32-5p or an upstream or downstream gene of miR-32-5 p.

Further, the target gene includes an agent that inhibits expression of VPS 4B.

Further, the agent that inhibits expression of VPS4B is selected from the group consisting of: an interfering molecule targeting VPS4B or its transcript and capable of inhibiting VPS4B gene expression or gene transcription, comprising: shRNA (small hairpin RNA), small interfering RNA (sirna), dsRNA, microrna, antisense nucleic acid, or a construct capable of expressing or forming said shRNA, small interfering RNA, dsRNA, microrna, antisense nucleic acid.

Further, the improvement of the sensitivity of the tumor cells to the dihydroartemisinin also comprises the inhibition of the resistance of the tumor cells to the dihydroartemisinin.

Further, the miR-32-5p improves the sensitivity of tumor cells to dihydroartemisinin by targeting VPS 4B.

The second aspect of the invention provides application of miR-32-5p and/or a target gene thereof in preparing a medicament for preventing and/or treating neuroblastoma;

preferably, the target gene is VPS 4B;

preferably, the nucleotide sequence of the miR-32-5p is shown in SEQ ID NO 1;

preferably, the miR-32-5p is highly expressed or overexpressed;

preferably, the target gene is under-expressed or not expressed;

preferably, the preventing and/or treating neuroblastoma comprises inhibiting metastasis of neuroblastoma;

more preferably, the inhibition of neuroblastoma metastasis is inhibition of neuroblastoma migration and invasion.

The third aspect of the invention provides a pharmaceutical composition for improving the sensitivity of tumor cells to dihydroartemisinin.

Further, the pharmaceutical composition comprises an effective amount of an agent for promoting miR-32-5p expression and/or an agent for inhibiting expression of a target gene VPS4B thereof;

preferably, the pharmaceutical composition further comprises a pharmaceutically acceptable carrier and/or adjuvant;

preferably, the tumor cells comprise neuroblastoma cells, melanoma cells, kidney cancer cells, lung cancer cells, pancreatic cancer cells, prostate cancer cells, cervical cancer cells, breast cancer cells, ovarian cancer cells, liver cancer cells, glioma cells, stomach cancer cells, bladder cancer cells, colon cancer cells;

more preferably, the tumor cell is a neuroblastoma cell.

Further, the pharmaceutically acceptable carriers and/or excipients are described in detail in Remington's Pharmaceutical Sciences.

Further, the pharmaceutical composition is administered to a subject in need thereof to increase its sensitivity to dihydroartemisinin.

Further, the modes of administration include (but are not limited to): oral, intraperitoneal injection, subcutaneous injection, intramuscular injection, transdermal injection, rectal administration, vaginal administration, sublingual administration, intravenous injection, buccal administration, inhalation.

Further, dosage forms of the pharmaceutical composition that do not pass through the gastrointestinal tract (the pharmaceutical ingredients do not pass through the gastrointestinal tract) in the administration mode include (but are not limited to): solutions for direct injection, dry powder products that can be dissolved or suspended in a carrier compatible with the pharmaceutical ingredients, suspensions for direct injection, emulsions, controlled release dosage forms that do not pass through the gastrointestinal tract.

Further, the dosage forms of the pharmaceutical compositions for rectal and vaginal administration in the administration mode include (but are not limited to): a suppository. The agent for promoting miR-32-5p expression, disclosed by the invention, can be mixed with a suitable carrier and/or auxiliary material without irritation to prepare a suppository, such as cocoa butter, polyethylene glycol or suppository wax.

Further, the dosage forms of the pharmaceutical compositions administered orally or sublingually in the administration mode include (but are not limited to): tablets, troches, capsules, powders, granules, elixirs, suspensions, syrups, wafers, chewing gums, or other dosage forms prepared in accordance with current practice in the industry.

Further, the pharmaceutical composition is prepared by a conventional preparation method well known in the art.

Further, the pharmaceutical compositions may be administered prior to actual use by standard practice in the pharmaceutical industry, such as cell culture and animal testing, to determine the effective dose, toxicity and therapeutic efficacy of the pharmaceutically active ingredient, e.g., to determine LD50 (half lethal dose) and ED50 (half effective dose). The specific dosage should be determined according to the dosage form and route of administration employed. The ratio between toxic and therapeutic doses is called the therapeutic index and can be expressed using the ratio LD50/ED 50. Effective doses can be estimated initially by means of cell culture assays. In addition, the circulating concentration of the pharmaceutical active ingredient in plasma can be determined in animal models, including cell culture assays or animal models to determine the IC50 (i.e., the half inhibitory dose of the pharmaceutical ingredient of the invention). The concentration level of the active ingredient in the plasma can be measured, for example, by high performance liquid chromatography. The efficacy of any particular dose can be monitored by appropriate biological assays. The physician can determine or adjust the actual dosage to be employed, depending on the actual observed effect.

Further, the agent for promoting miR-32-5p expression improves the sensitivity of tumor cells to dihydroartemisinin by targeting VPS 4B.

In a fourth aspect of the present invention, there is provided a pharmaceutical composition for preventing and/or treating neuroblastoma.

In a fifth aspect, the invention provides an anti-tumor combination.

Further, the combined medicine comprises an effective amount of an agent for promoting miR-32-5p expression and/or an agent for inhibiting expression of target gene VPS4B thereof, and dihydroartemisinin;

preferably, the combination further comprises a pharmaceutically acceptable carrier and/or adjuvant;

preferably, the combination also comprises other anti-tumor drugs;

more preferably, the other anti-tumor drugs include molecular targeted drugs, chemotherapeutic drugs, immunotherapeutic drugs;

most preferably, the molecularly targeted drug comprises an anaplastic lymphoma kinase inhibitor, a tropomyosin receptor kinase inhibitor;

most preferably, the chemotherapeutic drug comprises a platinum-based antineoplastic drug, a taxane-based antineoplastic drug;

most preferably, the immunotherapeutic agent comprises a monoclonal antibody targeting PD-1/PD-L1, a monoclonal antibody targeting ganglioside GD2, a monoclonal antibody targeting B7-H3;

most preferably, the anaplastic lymphoma kinase inhibitor comprises crizotinib, elotinib, ceritinib, brigatinib, loratinib, emtricitinib, and the tropomyosin receptor kinase inhibitor comprises emtricitinib, larotinib, carboplatin, meretinib;

most preferably, the platinum antineoplastic agents comprise cisplatin, carboplatin or cycloplatin, and the taxane antineoplastic agents comprise paclitaxel, docetaxel or cabazitaxel;

most preferably, the monoclonal antibodies targeting PD-1/PD-L1 include Keytruda, Opdivo, Libtayo, Tecntriq, Bavencio, Imfinzi, the monoclonal antibodies targeting ganglioside GD2 include Danyelza, Qarziba, naxitamab, dinutuximab beta, and the monoclonal antibodies targeting B7-H3 include Omburtamab, Enoblituzumab, mirzotamab cletotoclatax.

Further, the combination is administered to a subject in need thereof.

The dosage of the ingredients described in the present invention is determined or adjusted by the physician according to the actual observed effect. In terms of treatment duration and frequency, it is often necessary for a professional clinician to monitor the patient to determine whether the relevant treatment is effective, whether the dosage needs to be increased or decreased, whether the frequency of administration needs to be increased or decreased, whether the treatment needs to be interrupted or resumed, or other modifications to the treatment regimen. The dosage plan/regimen may be modified weekly or daily depending on a variety of clinical factors, such as the degree of patient sensitivity to the components of the invention.

In a sixth aspect of the invention, there is provided a method for increasing the sensitivity of tumor cells to dihydroartemisinin in vitro in a non-diagnostic or non-therapeutic destination.

Further, the method comprises delivering the pharmaceutical composition according to the third aspect of the invention to tumor cells.

The seventh aspect of the invention provides a method for screening potential substances for improving the sensitivity of tumor cells to dihydroartemisinin.

Further, the method comprises the steps of:

(1) contacting a substance to be detected with a system for expressing miR-32-5p and/or a target gene VPS4B thereof;

(2) detecting the influence of a substance to be detected on the miR-32-5p and/or the target gene VPS4B thereof;

(3) if the substance to be detected can improve the expression and activity of miR-32-5p and/or inhibit the expression and activity of target gene VPS4B, the substance to be detected is a potential substance for improving the sensitivity of tumor cells to dihydroartemisinin.

Further, the step (1) comprises: in a test group, adding a substance to be tested into a system for expressing miR-32-5p and/or a target gene VPS4B thereof, and in a control group, adding the substance to be tested into a system for expressing miR-32-5p and/or a target gene VPS4B thereof without adding the substance to be tested;

and/or step (2) comprises: detecting the expression or activity of the miR-32-5p and/or the target gene VPS4B in the system of the test group, and comparing the expression or activity with the expression or activity of the miR-32-5p and/or the target gene VPS4B in the system of the control group;

if the expression and the activity of the miR-32-5p in the test group are higher than those of the control group statistically and/or the expression and the activity of the target gene VPS4B are lower than those of the control group statistically, the test substance is a potential substance for improving the sensitivity of the tumor cells to the dihydroartemisinin;

preferably, the tumor cell is a neuroblastoma cell.

Further, the substances to be tested include (but are not limited to): a reagent, a binding molecule, a small molecular compound and the like which are designed for promoting miR-32-5p expression aiming at miR-32-5p or an upstream or downstream gene of miR-32-5 p; an interfering molecule targeting VPS4B or its transcript and capable of inhibiting VPS4B gene expression or gene transcription, comprising: shRNA (small hairpin RNA), small interfering RNA (siRNA), dsRNA, microRNA, antisense nucleic acid, or a construct capable of expressing or forming the shRNA, small interfering RNA, dsRNA, microRNA, antisense nucleic acid, or the like.

Further, the system includes (but is not limited to): cell system, subcellular system, cell culture system, subcellular culture system, solution system, tissue system, organ system, and animal system.

Further, if the expression and activity of miR-32-5p in the test group is statistically higher than that in the control group, preferably significantly higher than, e.g., more than 20% higher than that in the control group, preferably more than 50% higher than that in the control group, and more preferably more than 80% higher than that in the control group, and/or the expression and activity of the target gene VPS4B thereof is statistically lower than that in the control group, preferably significantly lower than, e.g., more than 20% lower than that in the control group, preferably more than 50% lower than that in the control group, and more preferably more than 80% lower than that in the control group, it is indicated that the test substance is a potential substance for increasing the sensitivity of tumor cells to dihydroartemisinin.

Further, the method comprises the following steps: further validation tests were performed on the potential substances screened, including (but not limited to): cell experiments and animal experiments to further select and determine the composition effective in improving the sensitivity of tumor cells to dihydroartemisinin from potential substances.

A sixth aspect of the invention provides a use of any one of the following aspects, the use comprising:

(1) the use of miR-32-5p and/or a target gene thereof for preparing the pharmaceutical composition according to the third aspect of the invention;

(2) the use of miR-32-5p and/or a target gene thereof for preparing the combination drug according to the fourth aspect of the invention;

(3) the application of miR-32-5p and/or target genes thereof in screening potential substances for improving the sensitivity of tumor cells to dihydroartemisinin;

preferably, the tumor cell is a neuroblastoma cell;

(4) the miR-32-5p and/or a target gene thereof and dihydroartemisinin are combined for preparing antitumor drugs;

(5) the miR-32-5p and/or a target gene thereof and dihydroartemisinin are applied to inhibiting tumor metastasis;

preferably, the tumor is neuroblastoma.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Further, some terms are explained as follows.

The term "active ingredient" as used herein refers to any substance or mixture of substances used in a medicament or pharmaceutical composition that has pharmacological activity or other direct effect in the diagnosis, treatment, symptom relief, management, or prevention of disease or that affects the function or structure of the body. In embodiments of the invention, the active ingredients include (but are not limited to): an agent for promoting miR-32-5p expression and/or an agent for inhibiting target gene VPS4B thereof, dihydroartemisinin, the agent for promoting miR-32-5p expression and/or the agent for inhibiting target gene VPS4B thereof comprises (but is not limited to): a reagent, a binding molecule, a small molecular compound and the like which are designed for promoting miR-32-5p expression aiming at miR-32-5p or an upstream or downstream gene of miR-32-5 p; an interfering molecule targeting VPS4B or its transcript and capable of inhibiting VPS4B gene expression or gene transcription, comprising: shRNA (small hairpin RNA), small interfering RNA (siRNA), dsRNA, microRNA, antisense nucleic acid, or a construct capable of expressing or forming the shRNA, small interfering RNA, dsRNA, microRNA, antisense nucleic acid, or the like.

The term "treatment", as used herein, generally relates to the treatment of a human or animal (e.g., as applied by a veterinarian) wherein some desired therapeutic effect may be achieved, e.g., inhibiting the development of a condition (including slowing the rate of development, stopping the development), ameliorating the condition, and curing the condition. Treatment as a prophylactic measure (e.g., prophylaxis) is also included. The use of a patient who has not yet developed a condition but who is at risk of developing the condition is also encompassed by the term "treatment".

The term "effective amount" as used herein, refers to an amount that has a therapeutic effect or is required to produce a therapeutic effect in a subject being treated. For example, a therapeutically or pharmaceutically effective amount of a drug refers to the amount of drug required to produce the desired therapeutic effect, which can be reflected in the results of clinical trials, model animal studies, and/or in vitro studies. The pharmaceutically effective amount will depend on several factors including, but not limited to, the characteristics of the subject (e.g., height, weight, sex, age, and medical history), and the severity of the disease.

Compared with the prior art, the invention has the following beneficial effects:

the miR-32-5p is applied to the medicine for improving the sensitivity of tumor cells to dihydroartemisinin for the first time, the miR-32-5p can obviously improve the sensitivity of neuroblastoma cells to dihydroartemisinin, in addition, the miR-32-5p improves the sensitivity of dihydroartemisinin in vivo through targeting VPS4B, and the combined application of miR-32-5p and dihydroartemisinin has the effect of synergistic inhibition on migration and invasion of neuroblastoma cells.

Drawings

Embodiments of the invention are described in detail below with reference to the attached drawing figures, wherein:

FIG. 1 is a graph showing the results of miR-32-5p expression in neuroblastoma tissues and cells, wherein, A is a graph: GSE128004, panel B: GSE121513, C diagram: four neuroblastoma cell lines and a human embryonic kidney 293T cell line;

FIG. 2 is a graph showing the results of qRT-PCR detection of expression levels of miR-32-5p in SK-N-SH and IMR-32 cells transfected with miR-32-5p mimics and miR-32-5p inhibitor, respectively, wherein, A is a graph: SK-N-SH, Panel B: IMR-32;

FIG. 3 is a graph showing the results of a cell scratch test for detecting the effect of miR-32-5p on migration and invasion of neuroblastoma cells, wherein, A is a graph: miR-32-5p mimics, B picture: miR-32-5p inhibitor, panel C: SK-N-SH, Panel D: IMR-32;

FIG. 4 is a graph showing the results of analyzing the effect of miR-32-5p on migration and invasion of neuroblastoma cells by the Transwell experiment, wherein, A is a graph: miR-32-5p mimics, B picture: SK-N-SH, Panel C: miR-32-5p inhibitor, figure D: IMR-32, Panel E: miR-32-5p mimics, F diagram: SK-N-SH, G diagram: miR-32-5p inhibitor, H picture: IMR-32;

FIG. 5 is a diagram showing the results of Western blot detection of various protein expression profiles, in which, Panel A: miR-32-5p mimics, B picture: miR-32-5p inhibitor;

FIG. 6 shows the expression level of VPS4B at the mRNA and protein level in cells, wherein A is: statistical graph of expression level of VPS4B at mRNA level, Panel B: statistical plot of expression of VPS4B at protein level, panel C: graph of expression of VPS4B at protein level;

FIG. 7 is a graph of the results of the effect of miR-32-5p on expression levels of VPS4B, wherein, Panel A: results of the effect of miR-32-5p mimics on the expression level of VPS4B mRNA, panel B: results of the effect of miR-32-5p mimics on the expression level of VPS4B protein, panel C: results of the effect of miR-32-5p inhibitor on the expression level of VPS4B mRNA, Panel D: a result graph of the influence of miR-32-5p inhibitor on the expression level of VPS4B protein;

FIG. 8 is a graph showing the results of dual-luciferase reporter gene assay, in which A is a graph: schematic representation of binding sites on the 3 '-UTR of wild-type VPS4B mRNA and miR-32-5p, and mutation sites on the 3' -UTR of mutant VPS4B mRNA, panel B: a statistical plot of relative luciferase activity;

FIG. 9 is a graph showing the results of qRT-PCR and Western blot for detecting the overexpression efficiency of VPS4B in SK-N-SH cells, wherein A is a graph: qRT-PCR, Panel B: western blot;

FIG. 10 is a graph showing the results of a cell scratch test and a Transwell test for examining the effect of VPS4B and miR-32-5p on neuroblastoma cells, wherein A is a graph: mi-NC, B diagram: mimic, panel C: scratch area statistical chart, panel D: migration results graph, E graph: migration cell number histogram, panel F: invasion results graph, G graph: statistics of number of invading cells;

FIG. 11 is a diagram showing the results of Western blot detection of various protein expression profiles, in which, Panel A: VPS4B, panel B: an EMT protein;

FIG. 12 is a graph showing the effect of miR-32-5p and DHA on neuroblastoma cell migration, in which, Panel A: mimic, panel B: inhibitor, panel C: mimic scratch area statistical graph, graph D: an invibitor scratch area statistical graph;

FIG. 13 is a graph showing the results of the effect of miR-32-5p and DHA on neuroblastoma cell migration and invasion, wherein, Panel A: migration results graph, B graph: migration cell number histogram, panel C: invasion results graph, graph D: statistics of number of invading cells, panel E: migration results graph, graph F: migration cell number histogram, graph G: invasion results graph, graph H: statistics of number of invading cells;

FIG. 14 is a diagram showing the results of Western blot detection of various protein expression profiles, in which, Panel A: mimic, panel B: an inhibitor;

FIG. 15 is a diagram showing the results of Western blot detection of various protein expression profiles, in which, Panel A: mimic, panel B: inhibitor, panel C: VPS4B, diagram D: an EMT protein;

FIG. 16 is a graph of the results of the effect of VPS4B on the synergistic therapeutic effect of miR-32-5p and DHA, wherein, Panel A: DHA-vector, Panel B: DHA-oeVPS4B, Panel C: a statistical graph of scratch areas;

FIG. 17 is a graph of the results of the effect of VPS4B on the synergistic therapeutic effect of miR-32-5p and DHA, wherein, Panel A: migration results graph, B graph: migration cell number histogram, panel C: invasion results graph, graph D: statistics of number of invading cells;

FIG. 18 is a graph showing the results of DHA and miR-32-5p in the inhibition of neuroblastoma metastasis in a nude mouse xenograft model, in which, Panel A: transfer node number statistical chart, graph B: graph of results of HE staining, panel C: statistical plot of relative expression levels of VPS4B, panel D: miR-32-5p relative expression level statistical chart, E chart: immunofluorescence assay results plot, panel F: VPS4B, G diagram: an EMT protein.

Detailed Description

The present invention is further illustrated below with reference to specific examples, which are intended to be illustrative only and are not to be construed as limiting the invention. As will be understood by those of ordinary skill in the art: various changes, modifications, substitutions and alterations can be made to the embodiments without departing from the principles and spirit of the invention, the scope of which is defined by the claims and their equivalents. The following examples are examples of experimental methods not indicating specific conditions, and the detection is usually carried out according to conventional conditions or according to the conditions recommended by the manufacturers.

Example 1 screening for genes differentially expressed in neuroblastoma patients

1. Experimental methods

(1) This example identifies differentially expressed genes from the GEO database, with a selected data set including GSE128004 and GSE121513, the GSE128004 data set being exosome data of neuroblastoma patients, including 15 patients and 3 normal controls, and the GSE121513 data set containing 8 embryonic stem cell lines, 7 normal fetal adrenal blast samples, 7 normal fetal adrenal cortex samples, and 95 neuroblastoma samples. Screening differentially expressed genes in tissue samples using the R language package (Deseq2 package) with adjusted P <0.01 and | log2FC | >2 as thresholds;

(2) to investigate the effect of miR-32-5p on neuroblastoma cell migration, this example first analyzed the expression level of miR-32-5p in one of the four human neuroblastoma cell lines (IMR-32, SH-SY5Y, SK-N-SH and SK-N-BE), human embryonic kidney 293T cell line, in which RNA isolation and qRT-PCR analysis were as follows: total RNA was extracted from cells using TRIzol reagent (Invitrogen, Carlsbad, California, USA), complementary dna (cdna) was synthesized from each 2 μ g RNA sample using reverse transcription kit (Fermentas, MA, USA), qRT-PCR was performed on ABI 7300 instrument using SYBR premix PCR kit (Thermo), and amplification procedure was: 95 ℃ 10 min, (95 ℃ 15 s, 60 ℃ 45 s, 72 ℃ 30 s) x 40 cycles, comparison of threshold Cycle (CT) values for defining the expression level of miRNA, and use of 2^-ΔΔCtThe method calculates relative change, normalizes the target gene to U6 expression, and uses the forward primer of miR-32-5 p: CGCGCGTATTGCACATTACTAA (SEQ ID NO:4), reverse primer: AGGTGCAGGGTCCGAGGTATT (SEQ ID NO: 5); forward primer of U6: CTCGCTTCGGCAGCACA (SEQ ID NO:6), reverse primer AACGCTTTCACGAATTTGCGT (SEQ ID NO: 7).

2. Results of the experiment

The results show that the expression level of miR-32-5P in the sample of the neuroblastoma patient is significantly lower than that in the normal sample (see FIGS. 1A and 1B, P <0.05 and P <0.01), and the expression level of miR-32-5P in the neuroblastoma tumor cells (IMR-32, SH-SY5Y, SK-N-SH and SK-N-BE) is significantly down-regulated compared with 293T cells (see FIG. 1C).

Example 2 Effect of miR-32-5p on neuroblastoma cell migration and invasion

1. Experimental Material

Human neuroblastoma cells (IMR-32, SH-SY5Y, SK-N-SH and SK-N-BE) were purchased from American dictionaryType culture Collection (ATCC, Manassas, Va., USA), 5% CO at 37 ℃ in DMEM medium (Life Sciences, Shanghai, China) containing 10% fetal bovine serum (BI, Kibbutz, Israel), penicillin G (100U/mL, Beyotime, China), streptomycin (100G/mL, Hyclone, China)₂Incubation under the conditions of (1).

2. Experimental methods

In this example, miR-32-5p mimics and miR-32-5p inhibitor are transfected into neuroblastoma cells SK-N-SH and IMR-32 respectively, the transfection efficiency is tested, and the influence of miR-32-5p on migration and invasion of neuroblastoma cells is studied, wherein miR-32-5p mimics, negative control (mi-NC), miR-32-5p inhibitor and negative control (in-NC) are purchased from Shanghai Jian pharmaceutical Co., Ltd (China, Shanghai), and the cells are inoculated into 6-well plates 24 h before transfection. When the cells were grown to about 70-80% confluence, neuroblastoma cells SK-N-SH were transfected with miR-32-5p mimics (100 pmol) and mimics NC (100 pmol), respectively, and neuroblastoma cells IMR-32 were transfected with miR-32-5p inhibitor (100 pmol) and inhibitor NC (100 pmol) using Lipofectamine 2000 reagent (Invitrogen, Sammerlaitie technologies, Inc.) according to the manufacturer's instructions.

(1) Cell scratch test

Will be 1 × 10⁵Cells at 500. mu.L/well were transferred into 12-well plates and cultured as a fully confluent monolayer. Adherent cells were scraped off with a tip of a 10 μ L sterile pipette, washed, and cultured in DMEM medium containing 2% FBS. Observations and photographs were taken after 0, 12 and 24 h, respectively. Scratch width was calculated using ImageJ software (http:// rsbweb. nih. gov/ij /).

(2) Transwell experiment

To further demonstrate the effect of miR-32-5p on neuroblastoma cell migration and invasion, further assays were performed using Transwell assays, which analyzed cell migration and invasion capacity using Transwell chambers (COSTAR, MA, usa) and Matrigel gel (Corning, Kennebunk, usa). Will 700

The medium containing 10% fetal bovine serum was placed in the lower chamber of a Transwell cell and 3X 10 cells were placed⁴The cells were suspended in 300

The culture medium containing 1% fetal bovine serum was inoculated into the upper chamber of a Transwell chamber. Cells that have migrated or invaded to the lower side of the membrane were washed with PBS, fixed with 4% paraformaldehyde solution for 20 minutes, stained with 0.1% crystal violet for 15 min, and finally, the number of cells was observed under a microscope and image-captured.

(3) Western blot experiment

The cells were subjected to western blotting, and the treated cells were washed with Phosphate Buffered Saline (PBS) and collected. Total proteins were separated with RIPA lysis buffer containing protein inhibitors (Roche) and protein samples were subjected to quantitative analysis using BCA kit (Thermo fisher) and their absorbance at 562 nm was measured by spectrophotometer. Protein loading buffer was added to denature the protein samples, and equal amounts of whole cell lysates (20 μ g) were separated on SDS-polyacrylamide gel and transferred to polyvinylidene fluoride (PVDF) membranes. Membranes were blocked with 5% BSA for half an hour at room temperature and mixed with primary antibody: VPS4B, EGFR, Snail, MMP2, MMP9, E-cadherin and GAPDH. After overnight incubation at 4 ℃, the membranes were washed 3 times in 1 × Tris-buffered saline Tween-20 (TBST) to remove unbound primary antibody. The membrane was then incubated with a secondary goat anti-rabbit IgG H & l (hrp) for 2 hours at room temperature, washed 3 times with TBST buffer, protein band images were collected using the Tanon5200 full-automatic chemiluminescence imaging analysis system, and the density of each protein band was measured by Image J software with GAPDH as an internal control.

3. Results of the experiment

The result shows that the expression of miR-32-5P in the neuroblastoma cell transfected with miR-32-5P mimics is obviously increased (P)<0.01), the expression of miR-32-5P in the neuroblastoma cells transfected with miR-32-5P inhibitor is obviously reduced (P)<0.01) (see fig. 2A and 2B); scratch area and width of SK-N-SH after 12 h of miR-32-5p mimics transfection (91.57)

0.92) was significantly larger than the control group (85.33)

0.58), indicating that the up-regulation of miR-32-5p can inhibit the migration capability of SK-N-SH cells (see FIG. 3); the overexpression of miR-32-5p remarkably reduces the number of cells which migrate and invade, while silencing miR-32-5p can reverse the effect (see figure 4), and further proves that the up-regulation of miR-32-5p can inhibit the migration and invasion of tumor cells; e-cadherin, Snail, EGFR, MMP2 and MMP9 are biomarkers of epithelial cell-mesenchymal transition (EMT) and play an important role in cancer metastasis, and miR-32-5p mimics are detected to induce the expression of E-cadherin and inhibit the expression of Snail, EGFR, MMP2 and MMP9, and are opposite to the effect of miR-32-5p inhibitor (see figure 5); the results all show that miR-32-5p inhibits migration and invasion of neuroblastoma cells.

Example 3 VPS4B is a direct target for miR-32-5p

1. Experimental methods

In order to research the action mechanism of miR-32-5p in neuroblastoma cells, the TargetScan (www.targetscan.org /) and mirDB (http:// miRDB. org /) are adopted in the embodiment to predict the action target of miR-32-5p, and the VPS4B target is identified as the ontology term of neuroblastoma cancer metastasis genes for the first time;

firstly, detecting the expression condition of VPS4B on mRNA and protein levels in neuroblastoma cells by adopting qRT-PCR and Western blot experiments, and in order to further confirm the regulation and control effect of miR-32-5p on VPS4B after transcription, evaluating the inhibition effect of miR-32-5p on VPS4B in neuroblastoma cells, and respectively detecting the expression level and protein expression level of VPS4B mRNA by using qRT-PCR and Western blot;

neuroblastoma cells of VPS4B wild type (Luc-VPS4B-WT) and VPS4B mutant (Luc-VPS4B-MUT) were further tested using a dual-luciferase reporter assay. Prediction of sequences complementary to miR-32-5p on the 3 '-UTR of VPS4B by NCBI, reporter by Dual luciferase 3' -UTRThe detection of VPS4B is a direct action target of miR-32-5 p. To construct a luciferase plasmid, the 3 ' -UTR sequence fragment was inserted into pGL3 vector (Promega, Madison, Wis., USA) to construct VPS4B 3 ' -UTR WT plasmid and VPS4B 3 ' -UTR mutant. The WT sequence of VPS4B was 5'-ACTGATACCTTTCACTGTGCAATC-3' (SEQ ID NO:2) and the sequence of the VPS4B 3 ' -UTR mutant was 5'-CTGATACCTTTCACTACATGCACTC-3' (SEQ ID NO: 3). SK-N-SH cells (5X 10)⁵/well) were seeded in 6-well plates, cultured for 24 h, and luciferase reporter vectors VPS4B 3 '-UTR WT, VPS4B 3' -UTR Mut, luciferase control vector miRNA-32-5p mimic were co-transfected into the above cells using Lipofectamine 2000, 5 pmol miRNAs (100 pmol). After 48 h of transfection, cells were harvested and lysed, and the activities of firefly luciferase and renilla luciferase were measured according to the manufacturer's instructions (Promega), luciferase reporter gene was detected from the cell lysate, and the relative firefly luciferase activity was normalized to the renilla luciferase activity, and fold change of the reporter gene was calculated as follows: RLU firefly luciferase/RLU Renilla luciferase 100%.

2. Results of the experiment

The results showed that expression of VPS4B was up-regulated in neuroblastoma cells compared to 293T cells (see fig. 6); VPS4B mRNA and protein levels were down-regulated (P <0.05) in miR-32-5P mimics transfected SK-N-SH cells, while mRNA and protein levels of VPS4B were up-regulated (P <0.05) in miR-32-5P-inhibited IMR-32 cells (see FIG. 7), indicating a negative regulatory correlation between VPS4B and miR-32-5P in neuroblastoma cells; the results of the dual-luciferase reporter gene assay show that when miR-32-5p and VPS4B wild-type 3 '-UTR luciferase reporter gene are co-transfected, luciferase signals are inhibited, and mutant UTR is not inhibited (see FIGS. 8A and 8B), which indicates that miR-32-5p regulates expression of VPS4B by directly combining with 3' -UTR, and all the results prove that VPS4B is a direct action target of miR-32-5 p.

Example 4 VPS4B is required for the regulatory role of miR-32-5p in neuroblastoma cell metastasis

1. Experimental methods

(1) To further assess whether VPS4B contributes to the biological effect of miR-32-5p, the VPS4B expression vector was constructed by transfecting a VPS4B expression vector into SK-N-SH cells, and the full-length cDNA encoding VPS4B was amplified by PCR, with the following primer sequences: the forward primer was CCCAAGCTTATGTCATCCACTTCGCCCAAC (SEQ ID NO:8), the reverse primer was CGGAATTCTTAGCCTTCTTGACCAAAATCTTC (SEQ ID NO:9), VPS4B was ligated into the appropriate site of vector pcDNA3.1, recombinant vector pcDNA3.1-VPS4B was propagated in E.coli DH5 α and verified by DNA sequence analysis to contain the VPS4B cDNA sequence, identified pcDNA3.1-VPS4B was transfected into SK-N-SH cells using Lipofectamine 2000 transfection reagent (Invitrogen, Thermo Fisher Scientific, Inc.) following the manufacturer's instructions; the cell scratch test and the Transwell test were carried out in the same manner as in example 2.

(2) Western blot experiment

In this example, the expression levels of the epithelial cell-mesenchymal transition (EMT) biomarkers E-cadherin, Snail, EGFR, MMP2, and MMP9 in the cells were detected, and the specific experimental method was the same as that of Western blot in example 2.

2. Results of the experiment

The results showed that the expression level of VPS4B was significantly increased in SK-N-SH cells transfected with VPS4B expression vector (see fig. 9A and 9B), and that over-expression of VPS4B promoted migration and invasion of SK-N-SH cells (see fig. 10) compared to oeVPS4B-NC and vector-NC groups, indicating that VPS4B is a transfer regulator in SK-N-SH cells; the co-transfection of the oeVPS4B plasmid and miR-32-5P mimic can reduce the effect of over-expression of miR-32-5P on cancer cell metastasis (migration and invasion) to a certain extent (P <0.05) (see FIG. 10), which indicates that miR-32-5P targets VPS4B and affects the metastasis of NB cancer cells; the results of Western blot analysis showed that co-transfection with oeVPS4B plasmid restored the miR-32-5P imic-induced down-regulation of VPS4B, EGFR, Snail, MMP2 and MMP9 proteins and up-regulation of E-cadherin (P <0.05) in SK-N-SH cells (see FIGS. 11A and 11B).

Example 5 miR-32-5p increases the sensitivity of neuroblastoma cells to dihydroartemisinin

1. Experimental methods

In this example, whether the sensitivity of the neuroblastoma cells to DHA can be increased by miR-32-5p is studied, the neuroblastoma cells are transfected by miR-32-5p mics (experimental group), NC mics (negative control group), miR-32-5p inhibitor (experimental group), and NC inhibitor (negative control group), and then are treated with DHA of different concentrations for 12 h and 24 h, respectively, to perform a cell scratch experiment, a Transwell experiment, and a Western blot experiment. The specific experimental procedure was the same as in example 2.

2. Results of the experiment

The results of the cell scratch experiment show that compared with the NC control group, the DHA-treated group has larger scratch widths and scratch areas at 12 h and 24 h (see FIG. 12), which indicates that DHA can significantly inhibit the migration capacity of tumor cells; compared with a Vehicle control group, the expression of miR-32-5p is up-regulated to promote the inhibition effect of DHA on the migration of tumor cells at 12 h and 24 h (see figure 12), which shows that miR-32-5p mim can enhance the inhibition effect of DHA on tumor cells, and miR-32-5p inhibitor can relieve the inhibition effect of DHA on tumor cells, so that miR-32-5p promotes the inhibition effect of DHA on tumor cells;

results of Transwell experiments show that compared with an NC control group, DHA significantly reduces the cell migration and invasion capacity, the co-treatment of miR-32-5p mim and DHA synergistically inhibits the cell migration and invasion capacity, the inhibition of miR-32-5p expression can significantly increase the tumor cell migration and invasion, and the miR-32-5p inhibitor can relieve the inhibition effect of DHA on the tumor cell (see FIG. 13), which shows that DHA and miR-32-5p have the synergistic inhibition effect in the tumor cell migration and invasion, and proves that miR-32-5p promotes the inhibition effect of DHA on the tumor cell;

the result of Western blot experiment shows that DHA significantly reduces the expression of EGFR, MMP2, MMP9 and Snail and increases the expression of E-cadherin, when DHA and miR-32-5p mimics are jointly applied, the effect is significantly increased, and the miR-32-5p inhibitor relieves the expression change of the EMT protein induced by DHA treatment (see fig. 14A and 14B), and further proves that miR-32-5p promotes the inhibition effect of DHA in migration and invasion of neuroblastoma cells.

Example 6 VPS4B is involved in the synergistic therapeutic action of miR-32-5p and dihydroartemisinin on neuroblastoma cell metastasis

1. Experimental methods

In this example, the influence of VPS4B on the biological effects of miR-32-5p and DHA is further studied, firstly, the expression condition of VPS4B in neuroblastoma cell SK-N-SH is detected, and whether the over-expression of VPS4B can relieve the inhibition effect of miR-32-5p mimics and DHA on SK-N-SH cell transfer is analyzed, and the specific experimental method is the same as that in example 2.

2. Results of the experiment

The results show that miR-32-5p imic and DHA significantly down-regulates the expression of VPS4B, while miR-32-5p inhibitor and DHA significantly up-regulates the expression of VPS4B (see FIG. 15A and FIG. 15B); overexpression of VPS4B in cells co-treated with miR-32-5p imic and DHA was able to alleviate the expression levels of VPS4B and EMT proteins (see FIGS. 15C and 15D); the results of the scratch test showed that the scratch area of the DHA-oeVPS4B-mimic group was significantly larger than that of the DHA-oeVPS4B-NC group (see FIG. 16); the results of Transwell experiments show that the inhibition effect of DHA and miR-32-5p imic on the migration and invasion of cells can be reversed by over-expressing VPS4B (see FIG. 17); the results show that the over-expression of VPS4B obviously weakens the inhibition effect of miR-32-5p and DHA on cell transfer, and further prove that VPS4B is a target point for miR-32-5p and DHA to play an inhibition effect on NB cell transfer.

Example 7 Dihydroartemisinin and miR-32-5p inhibit neuroblastoma metastasis in nude mouse xenograft model

1. Experimental Material

BALB/c female nude mice of 4-6 weeks old were purchased from Beijing Wittingle laboratory animal technology Co., Ltd and were bred under standard conditions of room temperature and standard humidity.

2. Experimental methods

This example further confirms the above conclusions in a mouse model, that a neuroblastoma nude mouse xenograft model was established by injecting IMR-32 cells into the tail vein of nude mice, which were treated with DHA, miR-32-5p, DHA + miR-32-5p, respectively, after which mice were sacrificed and lung and tumor tissues were collected and analyzed for HE and immunofluorescence staining, analyzing the effects of DHA and miR-32-5p in tumor metastasis in vivo.

(1) Construction of neuroblastoma nude mouse xenograft model

All animal manipulations were performed according to the guidelines for laboratory animal Care and use approved by the Committee for laboratory animal Care and use of the Chinese academy of traditional Chinese medicine (IACUC). 4-6 weeks old BALB/c female nude mice were injected intravenously with IMR-32 cells (100. mu.L, 2X 10)⁶) To generate neuroblastoma metastases, after 1 week of injection, tumor-bearing nude mice were randomly divided into a control group (saline, n =5), a DHA-treated group (DHA 100 mg/kg, n =5), and a combination-treated group (DHA 100 mg/kg + inhibitor, n =5), and the size of the tumor was measured every other day with a standard caliper according to the formula V = (W) = (²Xl)/2 tumor volume was calculated and mice were injected intraperitoneally with DHA and miR-32-5p inhibitor daily for 3 weeks. After 3 weeks of injection, all mice were euthanized after anesthesia with chloral hydrate, the number of lung nodules were counted and photographed, and the diameter and size of the tumor were measured every 3-4 days to monitor the tumor formation.

(2) HE staining and immunofluorescence staining of tissues

After euthanizing the mice, the wet weight of each tumor was examined, the transplanted tumor was excised and fixed with 4% paraformaldehyde, and then frozen in liquid nitrogen. And (3) performing hematoxylin and eosin (H & E)/immunohistochemical staining on the tumor tissue and the lung tissue, and collecting the tumor tissue for protein expression detection. After the tissue specimen is fixed, the tissue specimen is embedded by paraffin or is quickly frozen, and is stored in liquid nitrogen for later use. Fixed and embedded tissue sections were dewaxed with xylene, rehydrated, and subjected to antigen extraction on microwave-heated slides in citrate buffer (pH 6.0) and incubated with horseradish peroxidase-conjugated goat anti-mouse secondary antibody. Slides were stained with 3,3 ' -Diaminobenzidine (DAB) (Phoenix Biotechnologies), counterstained with Meyer's hematoxylin and dehydrated in ethanol according to the manufacturer's instructions, and the integrated optical density levels were estimated using Image Pro Plus software, expressed as mean ± standard deviation, for observation using a fluorescence microscope (magnification, × 200).

3. Results of the experiment

The result shows that compared with the NC group, the lung metastasis nodule number of the miR-32-5p mimic is remarkably reduced, and the effect of inhibiting cell metastasis of the DHA and miR-32-5p mimic co-treatment group is stronger than that of the miR-32-5p mimic group (see figure 18A); compared with single treatment of DHA and miR-32-5p, the inhibition effect of the DHA + miR-32-5p mimic combined treatment on tumors is enhanced, and the results of HE staining analysis show that the cancer cells of mice in the DHA + miR-32-5p group are obviously smaller than those in the DHA group and miR-32-5p group (see figure 18B); the expression level of VPS4B mRNA was inhibited in mouse tumor tissue of miR-32-5p imic (see FIG. 18C and FIG. 18D); the analysis results of the Western blot experiment show that the DHA group, the miR-32-5p group and the DHA + miR-32-5p group can reduce the VPS4B, EGFR, Snail, MMP2 and MMP9 in mice and can up-regulate E-cadherin, and compared with the DHA group and the miR-32-5p group, the DHA + miR-32-5p group has more remarkable protein regulation and control effects (see a figure 18F and a figure 18G); immunofluorescence detection analysis results of lung tissues show that the DHA group, the miR-32-5p group and the DHA + miR-32-5p group all reduce the VPS4B protein in a mouse body (see figure 18E), and the results show that the miR-32-5p improves the sensitivity of DHA in the body by targeting VPS 4B.

The above description of the embodiments is only intended to illustrate the method of the invention and its core idea. It should be noted that, for those skilled in the art, without departing from the principle of the present invention, several improvements and modifications can be made to the present invention, and these improvements and modifications will also fall into the protection scope of the claims of the present invention.

Sequence listing

<110> institute of traditional Chinese medicine of Chinese academy of traditional Chinese medicine

<141> 2022-01-05

<160> 9

<170> SIPOSequenceListing 1.0

<210> 1

<211> 22

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

uauugcacau uacuaaguug ca 22

<210> 2

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

actgatacct ttcactgtgc aatc 24

<210> 3

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

ctgatacctt tcactacatg cactc 25

<210> 4

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

cgcgcgtatt gcacattact aa 22

<210> 5

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

aggtgcaggg tccgaggtat t 21

<210> 6

<211> 17

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

ctcgcttcgg cagcaca 17

<210> 7

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

aacgctttca cgaatttgcg t 21

<210> 8

<211> 30

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

cccaagctta tgtcatccac ttcgcccaac 30

<210> 9

<211> 32

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

cggaattctt agccttcttg accaaaatct tc 32

Claims

Application of miR-32-5p and/or target gene VPS4B thereof in preparation of medicines for improving sensitivity of neuroblastoma to dihydroartemisinin.
2. The use of claim 1, wherein the nucleotide sequence of the miR-32-5p is represented by SEQ ID No. 1;

the miR-32-5p is highly expressed or overexpressed;

the target gene VPS4B was either under-expressed or not expressed.
Use of miR-32-5p and/or its target gene VPS4B in the manufacture of a medicament for the prevention and/or treatment of neuroblastoma.
4. The use of claim 3, wherein the nucleotide sequence of miR-32-5p is shown as SEQ ID NO 1;

the miR-32-5p is highly expressed or overexpressed;

the target gene is under-expressed or not expressed.
5. The drug combination for resisting neuroblastoma is characterized by comprising an effective amount of a reagent for promoting miR-32-5p expression and dihydroartemisinin;

the reagent for promoting miR-32-5p expression is miR-32-5p micic;

the miR-32-5p imic is purchased from Shanghai Ji' an pharmaceutical company, Ltd.
6. A method of increasing the sensitivity of neuroblastoma cells to dihydroartemisinin in vitro in a non-diagnostic or non-therapeutic destination, comprising delivering a pharmaceutical composition to the tumor cells;

the pharmaceutical composition comprises an effective amount of an agent for promoting miR-32-5p expression and/or an agent for inhibiting expression of a target gene VPS4B thereof.
7. A method for screening for potential agents that increase the sensitivity of neuroblastoma to dihydroartemisinin, said method comprising the steps of:

(1) contacting a substance to be detected with a system for expressing miR-32-5p and/or a target gene VPS4B thereof;

(2) detecting the influence of a substance to be detected on the miR-32-5p and/or the target gene VPS4B thereof;

(3) if the substance to be detected can improve the expression and activity of miR-32-5p and/or inhibit the expression and activity of target gene VPS4B, the substance to be detected is a potential substance for improving the sensitivity of neuroblastoma to dihydroartemisinin;

the step (1) comprises the following steps: in a test group, adding a substance to be tested into a system for expressing miR-32-5p and/or a target gene VPS4B thereof, and in a control group, adding the substance to be tested into a system for expressing miR-32-5p and/or a target gene VPS4B thereof without adding the substance to be tested;

the step (2) comprises the following steps: detecting the expression or activity of the miR-32-5p and/or the target gene VPS4B in the system of the test group, and comparing the expression or activity with the expression or activity of the miR-32-5p and/or the target gene VPS4B in the system of the control group;

if the expression and activity of miR-32-5p in the test group are higher than those in the control group statistically, and/or the expression and activity of the target gene VPS4B are lower than those in the control group statistically, the test substance is indicated to be a potential substance for improving the sensitivity of neuroblastoma to dihydroartemisinin.
Use of miR-32-5p mimic for the preparation of a combination according to claim 5, wherein the miR-32-5p mimic is available from shanghai geian pharmaceutical co.
Application of miR-32-5p and/or target gene VPS4B thereof in screening potential substances for improving sensitivity of neuroblastoma to dihydroartemisinin.
The application of the combination of the miR-32-5p and/or the target gene VPS4B thereof and dihydroartemisinin in preparing the anti-neuroblastoma medicament.
The application of the combination of the miR-32-5p and/or the target gene VPS4B thereof and dihydroartemisinin in preparing the medicine for inhibiting neuroblastoma metastasis.