CN114085842A - Swine-derived monoclonal genetic engineering antibody of Seneca virus, and preparation method and application thereof - Google Patents

Abstract

The invention provides a Seneca virus swine-derived monoclonal genetic engineering antibody, a preparation method and application thereof, belonging to the technical field of monoclonal antibody preparation. The preparation method of the Seneca virus porcine-derived monoclonal genetic engineering antibody provided by the invention obtains an SVA specific porcine-derived monoclonal genetic engineering antibody by utilizing a single B cell antibody technology from peripheral blood of a pig infected with and immunized with SVA antigen, expresses and assembles the SVA antibody IgG gene sequence in eukaryotic cells, and then verifies and screens out the SVA high-affinity specific porcine-derived monoclonal genetic engineering antibody by utilizing ELISA, virus neutralization experiments and immunofluorescence experiments, thereby providing an important method for researching SVA host specific antigenic sites and providing a key technical material for the establishment of a novel vaccine design and diagnosis method of the virus.

Description

Swine-derived monoclonal genetic engineering antibody of Seneca virus, and preparation method and application thereof

Technical Field

The invention belongs to the technical field of monoclonal antibody preparation, and particularly relates to a Seneca virus swine-derived monoclonal genetic engineering antibody, and a preparation method and application thereof.

Background

Senecavirus A (SVA) is the only member of the genus Senecavirus of the picornaviridae family. The virus infection can cause blister, ulceration, lameness and even death of the rhinoscope and hoof crown of the pig (the fatality rate of newborn piglets is as high as (30-70%)^[1]Clinically, with other vesiculopathies such as foot and mouth diseaseViruses, porcine vesicular viruses, vesicular stomatitis viruses and porcine herpes viruses are difficult to distinguish, and have great potential threats to the production and economic benefits of the pig industry. At present, SVA epidemic situation is locally outbreaked in a plurality of countries such as the United states, Canada, Brazil, Thailand, China, Vietnam and the like, and the homology of epidemic strains among the countries is extremely high^[2,3]Some strains have been recombined and mutated^[4]. Therefore, many countries monitor the occurrence and development of the disease and develop preventive and therapeutic products.

At present, the etiology detection of SVA mainly depends on RT-PCR method or real-time fluorescent quantitative RT-PCR method, and serology still uses traditional indirect ELISA or competitive ELISA method, neutralization test and indirect immunofluorescence test. With the rapid development of the breeding industry, a simple and rapid etiology detection method is needed, and although various PCR methods play a great role in pathogeny detection, the PCR method needs special space and equipment, the result can be preliminarily determined after hours, and the determination of gene sequences is needed for confirmation, so that the rapid etiology diagnosis reagent becomes one of the great demands of the pig industry. The serological method is mainly used for monitoring the antibody level after pathogenic infection or vaccine immunization, but with the continuous emergence of SVA new strains, the sensitivity and specificity of an indirect ELISA method established by using the polyclonal antibody of SVA are relatively poor, the false positive is more, mouse-derived monoclonal antibodies also have strains which cannot be identified, and possibly, the difference exists between antigen epitopes identified by SVA mouse-derived antibodies and the antibodies of the animal-derived antibodies, so that the established ELSIA method is easy to miss-detect the infection serum of the variant strains.

Reference to the literature

[1]F.A.Vannucci1,D.C.L.Linhares2,D.E.S.N.Barcellos3,H.C.Lam1,J.Collins1 and D.Marthaler1，Identification and Complete Genome of Seneca Valley Virus in Vesicular Fluid and Sera of Pigs Affected with Idiopathic Vesicular Disease,Brazil[J].Transboundary and Emerging Diseases,2015,62:589–593.

[2]Hao Wang,Chenxia Niu,Zuorong Nong,Dongqun Quan,Ying Chen,Ouyang Kang,Weijian Huang,Zuzhang Wei.Emergence and phylogenetic analysis of a novel Seneca Valley virus strain in the Guangxi Province of China[J].Research in veterinary science,2020,130:207-211.

[3]Z.Zhu,F.Yang,P.Chen,H.Liu,W.Cao,K.Zhang,X.Liu,H.Zheng.Emergence of novel Seneca Valley virus strains in China,2017[J].Transbound Emerg Dis.2017:1–6.

[4]Jianxin Liu,Yunfeng Zha,Huizi Li,Yanwei Sun,Fuguang Wang,Rong Lu,Zhangyong Ning.Novel Recombinant Seneca Valley Virus Isolated from Slaughtered Pigs in Guangdong Province[J].Virologica Sinica,2019,34:722–724.

Disclosure of Invention

In view of this, the present invention aims to provide an seneca virus swine-derived monoclonal genetic engineering antibody, a preparation method and an application thereof, wherein the antibody has specificity with high affinity to SVA.

The invention provides a preparation method of a Seneca virus swine-derived monoclonal genetic engineering antibody, which comprises the following steps:

1) infecting a pig with the Seneca virus strain, immunizing the pig with an inactivated vaccine prepared from the Seneca virus strain after 21 days, collecting peripheral blood of the pig 21-30 days after immunization, and separating PBMCs;

2) subjecting said PBMCs to flow cytometric sorting to sort out IgG⁺-SVA⁺A cell;

3) with the IgG mentioned⁺-SVA⁺Reverse transcription is carried out by taking the genome of the cell as a template to obtain single-cell cDNA;

4) performing nested PCR amplification by using the single-cell cDNA as a template to obtain a gene of a porcine IgG heavy chain variable region and a gene of a porcine IgG light chain variable region;

5) constructing an IgG heavy chain expression vector and an IgG light chain expression vector from the gene of the pig IgG heavy chain variable region and the gene of the pig IgG light chain variable region respectively;

6) and co-transfecting eukaryotic cells with the IgG heavy chain expression vector and the IgG light chain expression vector for recombinant expression, and separating recombinant protein to obtain the Seneca virus swine-derived monoclonal genetic engineering antibody.

Preferably, the Seneca virus strain in the step 1) is SVA/HN/11/2017 Lankan Kagaku, and the preservation number is CGMCC NO. 19966;

the toxicity value of the SVA/HN/11/2017 Lankangshan is 1 × 10⁹TCID₅₀/mL；

The immunization dose of SVA/HN/11/2017 blue animal research is 2 mL/head.

Preferably, before subjecting said PBMCs to flow cytometric sorting in step 2), flow cytometric staining of said PBMCs is included;

the flow cytometric staining method comprises the steps of mixing and incubating PBMCs with SVA virus particle antigens marked by biotin and Anti-porcine IgG-FITC fluorescent antibodies, washing, then carrying out heavy suspension, adding Anti-biotin-APC secondary antibody for ice bath, repeatedly washing, and then carrying out heavy suspension, thus obtaining the stained PBMCs.

Preferably, the nested PCR amplification primer set of the porcine IgG heavy chain variable region in the step 4) comprises an inner primer pair and an outer primer pair; the nucleotide sequences of the outer primer pair are shown as SEQ ID No.3 and SEQ ID No. 4; the nucleotide sequences of the inner primer pair are shown as SEQ ID No.5 and SEQ ID No. 6;

the nested PCR amplification primer group of the light chain variable region comprises a lambda light chain nested PCR amplification primer group and a kappa light chain nested PCR amplification primer group; the lambda light chain nested PCR amplification primer group comprises a lambda V3 outer primer with a nucleotide sequence shown as SEQ ID No.7, a lambda V2-6 outer upstream primer with a nucleotide sequence shown as SEQ ID No.8, a lambda V8 outer upstream primer with a nucleotide sequence shown as SEQ ID No.9, a lambda outer downstream primer with a nucleotide sequence shown as SEQ ID No.10, a lambda V3 inner upstream primer with a nucleotide sequence shown as SEQ ID No.11, a lambda V2-6 inner upstream primer with a nucleotide sequence shown as SEQ ID No.12, a lambda V8 inner upstream primer with a nucleotide sequence shown as SEQ ID No.13 and a lambda inner downstream primer with a nucleotide sequence shown as SEQ ID No. 14;

the kappa light chain nested PCR amplification primer group comprises a kappa light chain inner primer pair and a kappa light chain outer primer pair; the nucleotide sequence of the kappa light chain outer primer pair is shown as SEQ ID No.15 and SEQ ID No. 16; the nucleotide sequence of the kappa light chain inner primer pair is shown as SEQ ID No.17 and SEQ ID No. 18.

Preferably, when constructing the IgG heavy chain expression vector in step 5), a signal peptide having an amino acid sequence shown as SEQ ID No.19 is inserted into the 5' end of the gene of the porcine IgG heavy chain variable region;

when an IgG light chain expression vector is constructed, a signal peptide with an amino acid sequence shown as SEQ ID No.20 is inserted into the 5' end of the gene of the pig IgG lambda light chain variable region; the signal peptide with the amino acid sequence shown as SEQ ID No.21 is inserted into the 5' end of the gene of the porcine IgG kappa light chain variable region.

Preferably, the ratio of the copy number of the IgG heavy chain expression vector to the light chain expression vector at the time of transfection in step 6) is 1: 2.

Preferably, when the eukaryotic cell in the step 6) is a CHO-S cell, the gene of the porcine IgG heavy chain variable region and the gene of the porcine IgG light chain variable region are optimized according to the bias codon of the CHO cell expression system;

the nucleotide sequence of the gene of the optimized porcine IgG heavy chain variable region is shown as SEQ ID No. 25; the nucleotide sequence of the gene of the optimized pig IgG light chain variable region is shown as SEQ ID No. 26.

The Seneca virus swine-derived monoclonal genetic engineering antibody prepared by the preparation method provided by the invention has the amino acid sequence of the heavy chain variable region shown as SEQ ID No.1 and the amino acid sequence of the light chain variable region shown as SEQ ID No. 2.

Preferably, the swine monoclonal genetic engineering antibody is a neutralizing antibody of Seneca virus;

the neutralizing titer of the pig-derived monoclonal genetic engineering antibody is 1.47 mug/mL.

The invention provides an application of the Seneca virus swine-derived monoclonal genetic engineering antibody prepared by the preparation method or the Seneca virus swine-derived monoclonal genetic engineering antibody in preparation of a kit for detecting Seneca virus.

The preparation method of the Seneca virus swine-derived monoclonal genetic engineering antibody provided by the invention obtains an SVA specific swine-derived monoclonal genetic engineering antibody by using a single B cell antibody technology from peripheral blood of a swine infected with and immunized with SVA antigen, and expresses and assembles the SVA specific swine-derived monoclonal genetic engineering antibody in a eukaryotic cell, and then the SVA high-affinity specific swine-derived monoclonal genetic engineering antibody is screened out by using ELISA, virus neutralization experiments and immunofluorescence experiments. The antibody obtained by the technology has the advantages of good gene diversity, high efficiency, full host (pig) source, good specificity and the like. In addition, the technology is simpler and more convenient, antigen-specific single B cells are directly sorted by a flow cytometer, and a monoclonal genetic engineering antibody is obtained by in vitro expression, so that the complex processes of cell fusion and multi-round screening of the traditional mouse hybridoma technology are avoided. The screening method is the best method for obtaining different antigen spectrum specific antibodies of SVA infected natural hosts, is an indispensable technical means for effectively preventing and treating the SVA, and has important scientific significance.

The Seneca virus swine-derived monoclonal genetic engineering antibody prepared by the preparation method provided by the invention has the amino acid sequence of the heavy chain variable region shown as SEQ ID No.1 and the amino acid sequence of the light chain variable region shown as SEQ ID No. 2. Experiments prove that the porcine single-chain genetically engineered antibody M03 prepared by the invention has the capability of neutralizing SVA strain HN/11/2017 blue animal research, namely the porcine single-chain genetically engineered antibody is determined as a neutralizing antibody of SVA, and the neutralizing titer is 1.47 mu g/mL. Through antibody activity identification and IFA detection results, the monoclonal gene engineering antibody M03 can be specifically combined with BHK-21 cells infected by SVA/HN/11/2017 blue animal research strains, and the result shows that the swine-derived monoclonal gene engineering antibody capable of specifically reacting with SVA is successfully obtained. The antibody is further proved to be capable of specifically recognizing SVA antigen by an ELISA method.

Meanwhile, the antibody provided by the invention is subjected to a western blot test, virus particles which are ground and purified by using SVASVA/HN/11/2017 blue animals are used as antigens to carry out SDA-PAGE electrophoresis and then membrane transfer, and WB results show that no reaction band is generated with 9 strains of swine-derived monoclonal gene engineering antibody, and a clear and visible reaction band is generated by using SVA positive serum. The experimental results confirm that the expressed 9 strains of genetically engineered antibodies are presumed to be induced by conformational epitopes.

Drawings

FIG. 1 is a flow chart of the preparation of the swine monoclonal genetic engineering antibody provided by the invention;

FIG. 2 is a transmission electron microscope observation (30000 magnification) before and after the SVA antigen particles are labeled, wherein FIG. 2A is an electron microscope image of the SVA antigen particles before being labeled; FIG. 2B is an electron micrograph of the labeled SVA antigen particles;

FIG. 3 is the results of flow sorting SVA-specific porcine single B cells; wherein, FIG. 3A shows the P1 population with good status when the dyed PBMCs are loaded on the machine; FIG. 3B is a shot of a P1 cell population, delineating diagonal single cells, and excluding adherent cells; FIG. 3C is a circled IgG⁺SVA⁺B cells; FIG. 3D is an FMO control without addition of fluorescent antigen; FIG. 3E is a proportion of each cell population in a normally stained sample (about 100 ten thousand cells recorded); FIG. 3F shows a proportion of cells (approximately 100 ten thousand cells recorded) for each cell population in an FMO control sample;

FIG. 4 is a diagram showing the result of PCR amplification of a pig IgG antibody variable region gene, and FIG. 4A is a diagram showing the result of electrophoresis of a PCR product of a pig IgG heavy chain variable region; FIG. 4B shows the result of electrophoresis of the PCR product of the porcine kappa light chain variable region; FIG. 4C is a diagram showing the result of electrophoresis of a porcine lambda light chain variable region PCR product;

FIG. 5 is an SDS-PAGE electrophoresis chart of the SVA porcine monoclonal antibody;

FIG. 6 shows the IFA experimental results, wherein the left panel shows the experimental results of BHK-21 cells infected with single-chain genetically engineered antibody M03 and SVA/HN/11/2017 blue animal strain; the right panel shows the control (NC) of non-vaccinated normal BHK-21 cells, in which the scales are 400. mu.M.

Biological material preservation information

Semenavirus (Senecavirus A) SVA/HN/11/2017 blue animal research, preserved in China general microbiological culture Collection center, with a preservation time of 2020, 07/13. The address is No.3 of Xilu No.1 of Beijing, Chaoyang, and the microorganism research institute of Chinese academy of sciences, and the biological preservation number is CGMCC NO. 19966.

Detailed Description

The invention provides a preparation method of a Seneca virus swine-derived monoclonal genetic engineering antibody, which comprises the following steps:

1) infecting a pig with the Seneca virus strain, immunizing the pig with an inactivated vaccine prepared from the Seneca virus strain after 21 days, collecting peripheral blood of the pig 21-30 days after immunization, and separating PBMCs;

2) subjecting said PBMCs to flow cytometric sorting to sort out IgG⁺-SVA⁺A cell;

3) with the IgG mentioned⁺-SVA⁺Reverse transcription is carried out by taking the genome of the cell as a template to obtain single-cell cDNA;

4) performing nested PCR amplification by using the single-cell cDNA as a template to obtain a gene of a porcine IgG heavy chain variable region and a gene of a porcine IgG light chain variable region;

5) constructing an IgG heavy chain expression vector and an IgG light chain expression vector from the gene of the pig IgG heavy chain variable region and the gene of the pig IgG light chain variable region respectively;

6) and co-transfecting eukaryotic cells with the IgG heavy chain expression vector and the IgG light chain expression vector for recombinant expression, and separating recombinant protein to obtain the Seneca virus swine-derived monoclonal genetic engineering antibody.

The preparation process of the SVA-specific pig-derived monoclonal gene engineering antibody provided by the invention is shown in figure 1, and the specific operation is as follows.

The invention uses Seneca virus strain to infect pig, after 21d, uses the inactivated vaccine prepared by the Seneca virus strain to immunize pig, collects pig peripheral blood 21-30 days after immunization, and separates Peripheral Blood Mononuclear Cells (PBMCs).

In the invention, the Seneca virus strain is preferably SVA/HN/11/2017 Lankan Kagaku, and the preservation number is CGMCC NO. 19966; the toxicity value of the SVA/HN/11/2017 orchid animal research is preferably 1 x 10⁹TCID₅₀Per mL; the immunization dose of SVA/HN/11/2017 blue animal research is preferably 2 mL/head. The SVA/HN/11/2017 strain of the Lankant research has been patented. The method of infection and immunization is preferably via retroauricular muscle injection.

In the present invention, the method for isolating PBMCs is preferably performed using a lymphocyte separation medium (density of 1.077 g/mL). The source of the lymphocyte separation solution is not particularly limited in the present invention, and the lymphocyte separation solution may be purchased by a commercial route well known in the art.

After obtaining PBMCs, the invention carries out flow cytometric sorting on the PBMCs to sort out IgG⁺-SVA⁺A cell.

In the present invention, prior to flow cytometric sorting of the PBMCs, it is preferred to include flow-thinning of the PBMCsCell staining; the flow cytometric staining method comprises the steps of mixing and incubating PBMCs with SVA virus particle antigens marked by biotin and Anti-porcine IgG-FITC fluorescent antibodies, washing, then carrying out heavy suspension, adding Anti-biotin-APC secondary antibody for ice bath, repeatedly washing, and then carrying out heavy suspension, thus obtaining the stained PBMCs. The type of apparatus used in the flow cytometric separation is not particularly limited in the present invention, and a flow cytometer well known in the art may be used. In the present embodiment, the flow cytometric sorting is preferably performed by using a BD FACSAria iiu flow sorter to sort individual B-cells specifically recognized by SVA, with the instrument setting parameters: the nozzle size was 100 μm; the sorting mode is a single cell mode; the sorting speed was 10000 cells/s; amplitude of 20 psi; the oscillation frequency is 30 kHz; after the above parameter settings were adjusted, the Sweat button was closed, and the calculation of the liquid delay time was performed using Accudrop (Cat: 642412) delay microspheres; adjusting the position of a 96-hole PCR plate in the sorting cabin until the sorted cells accurately fall into the midpoint of the plate hole; after the above settings are all completed, putting the 96-well PCR plate containing 10 microliter of lysate into a sorting cabin, and starting to sample; defining lymphocytes and monocytes by "gating", excluding adherent cells according to FSC-A and FSA-H arrangement, defining diagonal single cells, further defining IgG + cell population, gating for sorting IgG⁺-SVA⁺A cell.

Obtaining IgG⁺-SVA⁺After the cells, the IgG is used for the invention⁺-SVA⁺The genome of the cell is used as a template for reverse transcription to obtain single cell cDNA.

In the present invention, IgG is used⁺-SVA⁺The cells were mixed with 4. mu.L of SuperScript VILO mix solution and 6. mu.L of DNase/RNase-free water and placed in a PCR machine for reverse transcription. The reaction conditions of the reverse transcription are as follows: 5min at 25 ℃; at 42 ℃ for 120 min; 85 ℃ for 5 min.

After obtaining the single-cell cDNA, the single-cell cDNA is used as a template to carry out nested PCR amplification to obtain the gene of the pig IgG heavy chain variable region and the gene of the pig IgG light chain variable region.

In the present invention, the nested PCR amplification primer set for porcine IgG heavy chain variable region preferably comprises an inner primer pair and an outer primer pair; the nucleotide sequence of the outer primer pair is preferably shown as SEQ ID No.3 and SEQ ID No. 4; the nucleotide sequence of the inner primer pair is preferably shown as SEQ ID No.5 and SEQ ID No. 6;

the nested PCR amplification primer set of the light chain variable region preferably comprises a lambda light chain nested PCR amplification primer set and a kappa light chain nested PCR amplification primer set; the lambda light chain nested PCR amplification primer group preferably comprises a lambda V3 outer primer with a nucleotide sequence shown as SEQ ID No.7, a lambda V2-6 outer upstream primer with a nucleotide sequence shown as SEQ ID No.8, a lambda V8 outer upstream primer with a nucleotide sequence shown as SEQ ID No.9, a lambda outer downstream primer with a nucleotide sequence shown as SEQ ID No.10, a lambda V3 inner upstream primer with a nucleotide sequence shown as SEQ ID No.11, a lambda V2-6 inner upstream primer with a nucleotide sequence shown as SEQ ID No.12, a lambda V8 inner upstream primer with a nucleotide sequence shown as SEQ ID No.13 and a lambda inner downstream primer with a nucleotide sequence shown as SEQ ID No. 14;

the kappa light chain nested PCR amplification primer group preferably comprises a kappa light chain inner primer pair and a kappa light chain outer primer pair; the nucleotide sequence of the kappa light chain outer primer pair is shown as SEQ ID No.15 and SEQ ID No. 16; the nucleotide sequence of the kappa light chain inner primer pair is shown as SEQ ID No.17 and SEQ ID No. 18.

In the present invention, the reaction procedure of the first round reaction (outer primer amplification process) of the nested PCR reaction: pre-denaturation at 94 ℃ for 1 min; then denaturation at 98 ℃ for 10sec, annealing at 58 ℃ for 30sec, and extension at 72 ℃ for 1min for 30 cycles; finally, the extension is carried out for 10min at 72 ℃. Reaction procedure for the second round of reaction (inner primer amplification procedure): pre-denaturation at 94 ℃ for 1 min; then denaturation at 98 ℃ for 10sec, annealing at 58 ℃ for 30sec, and extension at 72 ℃ for 1min for 35 cycles; finally, the extension is carried out for 10min at 72 ℃.

After the nested PCR amplification product is obtained, preferably performing electrophoresis detection, sequencing the successfully amplified target band, and comparing sequencing results for construction of a subsequent expression vector.

After obtaining the gene of the pig IgG heavy chain variable region and the gene of the light chain variable region, the invention respectively constructs an IgG heavy chain expression vector and an IgG light chain expression vector from the gene of the pig IgG heavy chain variable region and the gene of the light chain variable region.

In the invention, when constructing the IgG heavy chain expression vector, preferably, a signal peptide with an amino acid sequence shown as SEQ ID No.19 is inserted into the 5' end of the gene of the pig IgG heavy chain variable region, and the nucleotide sequence of the signal peptide is shown as SEQ ID No. 22; when constructing an IgG light chain expression vector, preferably inserting a signal peptide with an amino acid sequence shown as SEQ ID No.20 into the 5' end of the gene of the porcine IgG lambda light chain variable region; the nucleotide sequence of the signal peptide is shown as SEQ ID No. 23; preferably, a signal peptide with an amino acid sequence shown as SEQ ID No.21 is inserted into the 5' end of the gene of the porcine IgG kappa light chain variable region; the nucleotide sequence of the signal peptide is shown as SEQ ID No. 24. The heavy chain constant region ends of the IgG antibodies all contain a 6 × His tag. Both sequence synthesis and recombinant expression vector construction were entrusted to Kingzhi Biotechnology, Inc.

After an IgG heavy chain expression vector and an IgG light chain expression vector are obtained, the IgG heavy chain expression vector and the IgG light chain expression vector are co-transfected into eukaryotic cells for recombinant expression, and recombinant protein is separated to obtain the Seneca virus swine-derived monoclonal genetic engineering antibody.

In the present invention, the ratio of the number of copies of the IgG heavy chain expression vector to the number of copies of the light chain expression vector at the time of transfection is preferably 1: 2. The eukaryotic cell is preferably a CHO-S cell, and before an expression vector is constructed, the gene of the porcine IgG heavy chain variable region and the gene of the porcine IgG light chain variable region are preferably optimized according to the bias codon of a CHO cell expression system; the nucleotide sequence of the gene of the optimized porcine IgG heavy chain variable region is shown as SEQ ID No. 25; the nucleotide sequence of the gene of the optimized pig IgG light chain variable region is shown as SEQ ID No. 26.

In the present invention, the obtained recombinant expression protein was purified, the collected cell culture supernatant was filtered through a 0.22 μ M filter, and then antibody purification was performed on an AKAT protein purifier using a HiTrap talen column, and the antibody was eluted using PBS containing 250mM imidazole, and then placed in a dialysis bag and dialyzed in PBS solution 3 times for 3 hours each. The dialyzed antibody was concentrated with PEG 6000.

After obtaining the purified antibody, the invention also preferably identifies the activity of the antibody, including indirect immunofluorescence assay, indirect ELISA assay for antibodies, virus neutralization assay, and western blot assay.

The Seneca virus swine-derived monoclonal genetic engineering antibody prepared by the preparation method provided by the invention has the amino acid sequence of the heavy chain variable region shown as SEQ ID No.1 and the amino acid sequence of the light chain variable region shown as SEQ ID No. 2. The results of neutralization tests show that the porcine monoclonal genetically engineered antibody is preferably a neutralizing antibody of Seneca virus; the neutralizing titer of the pig-derived monoclonal genetic engineering antibody is 1.47 mug/mL.

Based on the fact that the Seneca virus swine-derived monoclonal genetic engineering antibody has high characteristics of neutralizing Seneca virus, the invention provides the Seneca virus swine-derived monoclonal genetic engineering antibody prepared by the preparation method or the application of the Seneca virus swine-derived monoclonal genetic engineering antibody in the preparation of a kit for detecting Seneca virus.

The detection method of the kit is not particularly limited, and the detection method of the detection kit known in the art can be adopted, such as colloidal gold detection, ELISA detection, immunofluorescence, western blot detection and the like. The method for preparing the kit is not particularly limited, and the method for preparing the kit known in the art may be used. The kit is applied to the detection of the Seneca virus.

The swine-derived monoclonal engineered antibody of Seneca virus, a method for producing the same, and applications thereof according to the present invention will be described in detail with reference to the following examples, which should not be construed as limiting the scope of the present invention.

Example 1

1. Viral particle labeling scheme

1.1 Biotin labelling of SVA virion antigens

2mg of SVA virus (SVA/HN/11/2017 blue animal ground) particles to be labeled were taken in 1mL of BuphTm phosphate buffer and the number of millimoles dissolved was calculated. The ratio of protein mass/protein molecular weight was calculated according to formula I below:

protein mass (mg)/protein Molecular Weight (MW) ═ millimole number of proteins formula I.

Biotin was equilibrated to room temperature, 2mg of Sulfo-NHS-Biotin was added to 100. mu.L of ultrapure water, and Biotin was added in sufficient concentration, typically over 12 molecules for 10mg/mL protein and over 20 molecules for 2mg/mL protein solution. After standing on ice for 2 hours, the column was washed with 30mL of PBS (pH 7.4), loaded, and the same amount of buffer as the amount to be collected was added, and 1mL was collected in a separate tube, supplemented with an equal volume of sterilized 100% glycerol, and stored at-70 ℃ or below.

1.2 Electron microscopy staining

To confirm whether the biotin-labeled SVA antigen particles destroy the integrity of the antigen particles, negative staining and transmission electron microscopy were performed on the labeled virion antigens. Gently adding 4 μ L of labeled virion antigen onto a copper mesh, fixing at room temperature for 2min, and then carefully laterally blotting the sample with filter paper; then stained with 1% tungsten phosphate for about 1min, followed by careful lateral blotting of the stain with filter paper, and transmission electron microscopy was performed after several minutes at room temperature.

The electron micrograph is shown in FIG. 2. The purified SVA (SVA/HN/11/2017 blue animal research) antigen particles are negatively dyed after being marked by biotin, and particles with the diameters of 20-30 nm and regular hexagons are observed by a transmission electron microscope and have no obvious difference with the particles before being marked. The result of morphological observation shows that the dye-labeled antigen does not damage the antigen particles and can ensure the integrity of the antigen particles, so the dye-labeled antigen is suitable for being used as a decoy antigen to sort single B cells.

2 multicolor flow dyeing

2.1 isolation of porcine PBMCs

First using SVA cell toxin (SVA/HN/11/2017 Langmuian, toxin price is 1 × 10⁹TCID₅₀mL) pigs were infected by retroauricular muscle injection, 4 mL/head, 2mL each time, and after 21 days immunization was performed in the same manner using inactivated vaccine prepared from the same strain, peripheral blood was collected from pigs between 21 days and 30 days after immunization, and PBMCs were isolated using lymphocyte isolate (density 1.077g/mL) as follows:

(1) balancing the PBS solution (pH value of 7.4) and the lymphocyte separation solution at room temperature, and taking 6mL of the lymphocyte separation solution into a 15mL centrifuge tube;

(2) diluting porcine EDTA anticoagulation blood with PBS solution according to a ratio of 1:1, slowly adding 8mL of diluted whole blood into the upper layer of the lymphocyte separation solution, and centrifuging for 30min at 1200 Xg;

(3) the opal layer containing PBMCs was pipetted into a medium containing 1/2 volumes of cell sort (containing 1% BSA, 2mM EDTANA)₂PBS solution) in a 15mL centrifuge tube, and centrifuging for 5min at 600 Xg;

(4) discarding the upper layer liquid, adding 1-2 mL of erythrocyte lysate, performing room temperature lysis for 1-2 min, adding 5mL of cell sorting solution, and centrifuging at 250 Xg for 10 min;

(5) discarding the upper layer liquid, washing the cells twice with cell sorting solution, centrifuging at 400 Xg for 5min, discarding the upper layer liquid, adding the cell sorting solution to blow out the cells into single cells, and finally obtaining the PBMCs.

2.2 flow cytostaining

(1) Get 10⁷The enriched PBMCs were resuspended in 200. mu.L of cell sorting solution and incubated on ice for 25min with 0.5. mu.g of biotinylated SVA virion antigen and 2. mu.g of murine anti-porcine IgG-FITC fluorescent antibody (MyBioSource, USA). Isotype control and minus control were set for the same cells. Meanwhile, a single male pipe is arranged for adjusting and compensating.

(2) Cells were washed twice with cell sorting solution, 400 Xg, centrifuged at 4 ℃ for 5 min.

(3) The cells were resuspended in 200. mu.L of cell sorting medium, and 2. mu.L of Anti-biotin-APC secondary antibody was added and ice-cooled for 20 min.

(4) Cells were washed twice with cell sorting solution, 400 Xg, centrifuged at 4 ℃ for 5 min.

(5) The cells were resuspended in 500. mu.L of cell sorting solution, protected from light on ice, and prepared for machine sorting.

2.3 sorting anti-SVA-specific Single B cells

Single B cells specifically recognized by SVA were sorted using a BD FACSAria iiu flow sorter. The instrument sets up the parameter: the nozzle size was 100 μm; the sorting mode is a single cell mode; the sorting speed was 10000 cells/s; amplitude of 20 psi; the oscillation frequency was 30 kHz. After the above parameter settings were adjusted, the Sweat button was closed, and the calculation of the liquid delay time was performed using Accudrop (cat # 642412) delay microspheres. The position of the 96-well PCR plate in the sorting chamber is adjusted until the sorted cells accurately fall into the midpoint of the plate well. After the above-mentioned arrangement is completed, the above-mentioned operation,the 96-well PCR plate containing 10. mu.L of lysate was placed in the sorting chamber and loading was started. The lymphocytes and monocytes are delineated by "gating", adherent cells are excluded according to the FSC-A and FSA-H arrangement, diagonal single cells are delineated, and IgG is further delineated therefrom⁺Cell population gated sorting of IgG⁺-SVA⁺The cells are SVA-specific single B cells.

The results of flow analysis are shown in FIG. 3, where SVA-specific B cell populations (FIG. 3C) are clearly visible and are present in IgG⁺About 84/1000000 (FIG. 3E) in total PBMCs. SVA single positive B cells (FIG. 3D, P3 population) were approximately 3/1000000 (FIG. 3F) compared to control (FMO) samples (SVA antigen without added fluorescent label), by staining the P4 population in the sample tube normally (FIG. 3C, IgG)⁺SVA⁺B cells) and successfully sorting to obtain the SVA-specific pig single B cells by using a single cell sorting mode.

2.4 amplification of Single B cell-derived IgG antibody variable region genes

2.4.1 preparation of Single-cell cDNA molecules

After sorting, adding 1 mu L of stop solution into each hole, incubating for 2min at room temperature, and stopping reaction; then adding 4 mu of LSuperScript VILO mix solution and 6 mu of DNase/RNase-free water into each hole, gently mixing uniformly, centrifuging at 1500rpm and 2-8 ℃ for 5 min; the 96-well PCR plate is then placed in a PCR instrument for reverse transcription. The reaction conditions are as follows: 5min at 25 ℃; at 42 ℃ for 120 min; 85 ℃ for 5 min. The cDNA obtained was stored at-20 ℃ for subsequent nested PCR amplification.

2.4.2 amplification of IgG antibody variable region genes

The pig single B cell IgG heavy chain variable region (VH) gene and the lambda light chain variable region (VL) and kappa light chain variable region (VL) genes were PCR amplified using primers designed and synthesized in Table 1 using a nested PCR method, i.e., two rounds of PCR amplification.

TABLE 1 primers for amplification of the kappa and lambda light chain variable region genes of porcine IgG

Note: a degenerate base annotation in the primer sequence, S ═ C or G, Y ═ C or T, R ═ a or G, K ═ G or T.

(1) First round PCR amplification protocol

The first round of reaction system for amplifying the pig IgG heavy chain variable region (VH) gene, the lambda light chain variable region (VL) gene and the kappa light chain variable region (VL) gene was performed according to Table 2 except for the primers and the templates.

TABLE 2 first round PCR reaction System

The first round of PCR amplification procedure was: pre-denaturation at 94 ℃ for 1 min; then denaturation at 98 ℃ for 10sec, annealing at 58 ℃ for 30sec, and extension at 72 ℃ for 1min for 30 cycles; finally, the extension is carried out for 10min at 72 ℃.

(2) Second round PCR amplification protocol

The first round of amplification product was used as template, and corresponding internal upstream and downstream primers were added to amplify the porcine IgG heavy chain variable region (VH) gene and λ light chain variable region (VL) and κ light chain variable region (VL) genes, and the components of the second round of PCR reaction system were performed as shown in table 3.

TABLE 3 second round PCR reaction System Components

The second round of PCR amplification procedure was: firstly, pre-denaturation is carried out for 1min at 94 ℃; then denaturation at 98 ℃ for 10sec, annealing at 58 ℃ for 30sec, and extension at 72 ℃ for 1min for 35 cycles; finally, the extension is carried out for 10min at 72 ℃.

2.4.3 sequencing of PCR products

And 4 mu.L of PCR products of the second round of amplification are subjected to agarose gel electrophoresis, the amplification result is observed, the PCR products of the VH and VL genes which are successfully amplified are subjected to DNA sequencing, and then the sequencing result is analyzed by comparison by using Lasergene software.

The nested PCR amplification product is analyzed by agarose gel electrophoresis, and the result is shown in figure 4, and a clear visible band appears in the pig IgG heavy chain variable region between 450bp and 600bp (figure 4A); the porcine kappa light chain variable region appeared as a clear band around about 500bp (FIG. 4B); the porcine lambda light chain variable region appeared as a clear band around about 500bp (FIG. 4C). The sequencing result is searched and aligned by a BLAST database, and the sequence obtained by nested PCR amplification is verified to be the pig IgG antibody variable region gene sequence.

2.5 construction of expression vectors and endotoxin-free plasmid preparation

2.5.1 construction of expression vector of porcine monoclonal antibody

Introducing a signal peptide 'MEFRLNWVVLFALLQGVQG' sequence (SEQ ID No.19) and a nucleotide sequence ATGGAGTTTAGGCTGAATTGGGTGGTGCTGTTCGCTCTGCTGCAAGGCGTCCAAGGC (SEQ ID No.22) into the front end of the pig IgG antibody VH gene, optimizing the pig IgG antibody VH gene according to a bias codon of a CHO cell expression system, and inserting the pig IgG antibody VH gene into a CH-pcDNA3.4 vector containing an IgG heavy chain constant region through two enzyme cleavage sites of NotI and BbvCI; introducing a signal peptide 'MAWTVLLIGLLAVGSGVDS' sequence (SEQ ID No.20) into the front end of a lambda light chain VL gene, wherein the nucleotide sequence is as follows: ATGGCTTGGACTGTGCTGCTGATCGGACTGCTGGCTGTGGGAAGCGGAGTGGATAGC (SEQ ID No.23), optimizing the VL gene of the amplified porcine IgG antibody according to the bias codon of the CHO cell expression system, and inserting the VL gene into a lambda CL-pcDNA3.4 vector containing an IgG lambda light chain constant region through two enzyme cleavage sites of Not I and Ale I; the front end of a kappa light chain VL gene is introduced with a signal sequence of "MRAPMHLLGLLLLWVPGARS" (SEQ ID No.21), the nucleotide sequence of which is: ATGAGGGCCCCTATGCATCTGCTCGGACTGCTGCTGCTGTGGGTGCCCGGCGCTAGGTCC (SEQ ID No.24), which was inserted into the kappa CL-pcDNA3.4 vector containing the IgG kappa light chain constant region via the NheI and BbvCI two enzymatic cleavage sites. The heavy chain constant region ends of the IgG antibodies all contain a 6 × His tag. Both sequence synthesis and vector construction were entrusted to Kingwei Biotechnology, Inc. The specific method comprises the following steps:

1) construction of the CH-pcDNA3.4 vector:

with Reference to the nucleotide Sequence of CDS region of porcine IgG heavy chain precursor (NCBI Reference Sequence: NM-213828.1), Not I cleavage site (GCGGCCGC) and GCCACCC were introduced at 5' end to form Kozak Sequence with initiation codon ATG; introducing a 6 His tag sequence before the stop codon TGA; entering Age I cleavage site (acccggt) after the stop codon TGA; the sequence from the initiation codon ATG to the termination codon TGA was optimized according to the bias codon of the CHO cell expression system, excluding Not I and Age I cleavage sites and retaining BbvC I cleavage sites. The sequence from the Not I to the Age I cut site was cloned into the pcDNA3.4 vector, named CH-pcDNA3.4.

2) Construction of lambda CL-pcDNA3.4 vector

With Reference to the nucleotide Sequence of the CDS region of porcine immunoglobulin lambda-like polypeptide 5(NCBI Reference Sequence: NM-001243319.1), NotI cleavage site (GCGGCCGC) and GCCACC were introduced at its 5' end to form a Kozak Sequence with the initiation codon ATG; entering Age I cleavage site (acccggt) after the stop codon TGA; optimizing the sequence from the initiation codon ATG to the termination codon TGA according to the bias codon of the CHO cell expression system, excluding Not I and Age I enzyme cutting sites and reserving the enzyme cutting site of Ale I. The sequence from the Not I to the Age I cut site was cloned into pcDNA3.4 vector, named lambda CL-pcDNA3.4.

3) Construction of kappa CL-pcDNA3.4 vector

With reference to the amino acid sequence of pig-derived Ig kappa chain V-C region (PLC18) -pig (fragment) (PIR: PT0219), NheI cleavage site (GCTAGC) and GCCACCATG were introduced at its 5' end to form a Kozak sequence; entering an AgeI cleavage site (ACCGGT) after the stop codon TGA; optimizing the sequence from the initiation codon ATG to the termination codon TGA according to the bias codon of a CHO cell expression system, excluding NheI and AgeI enzyme cutting sites and reserving the enzyme cutting site of BbvCI. The sequence from the NheI to AgeI cleavage sites was cloned into pcDNA3.4 vector, designated as kappa CL-pcDNA3.4.

The M03 antibody is subsequently screened, and the optimized nucleotide sequence of the VH gene is as follows:

GCGGCCGCGCCACCATGGAGTTTAGGCTGAACTGGGTGGTGCTGTTCGCTCTGCTGCAAGGCGTCCAAGGCGAAGAGAAGCTGGTGGAAAGCGGAGGAGGACTGGTGCAGCCCGGCGGCTCTCTGAGGCTGAGCTGTGTGGGCAGCGGCTTCACTTTCGGCGATTACGCTGTGAGCTGGGTGAGACAAGCCCCCGGCAAGGGACTGGAATGGCTGGCCTACGTGGCTAGCAGCGCCGATAGCGATTTCTACGCCGATAGCGTGAAGGGAAGGTTCACAATCTCTAGGGACAACAGCCAGAACACAGCCTATCTGCAGATCAACAGCGTGAGGACTGAGGATACTGCCCATTGGTACTGCGCTAGGCACAGATGGAGCTGGGGCTCCAGCAACGAGGCTGACCCTATGAATCTGTGGGGACCCGGCGTGGAGGTCGTGGTGTCCTCAGC(SEQ ID No.25)；

the optimized kappa light chain nucleotide sequence is as follows:

GCTAGCGCCACCATGAGGGCCCCTATGCATCTGCTCGGACTGCTGCTGCTGTGGGTGCCCGGCGCTAGGTCCGCCACACAGCTGACTCAGTCCCCAGCCTCTCTGGCTGCCAGCATCGGCGATACAGTGAGCATCACATGCAGAGCCAGCCAGTCCGTGTCCAACAATCTGGCTTGGTACCAGCAGCAGCCCGGCAAGGCTCCAAAGCTGCTGATCTATAAGGCCAGCTCTCTGCAGTCCGGAGTGCCTTCTAGGTTCAAAGGCAGCGGCAGCGGCACTGACTTCACACTGACTATCAGCGGACTGCAAGCCGAGGATGTGGCTACTTACTACTGCCTCCAGAGCAAGCATCTGCCACTGGGATTTGGCGCCGGCACAAAGCTCGAGCTGAAAAGGGCCGATGCCAAGCCTAGCGTGTTCATCTTCCCACCATCCAAAGAGCAGCTGGCCACACCTACAGTCAGCGTGGTCTGTCTGATCAACAACTTCTTCCCAAGGGAAATCTCCGTGAAGTGGAAGGTGGATGGCGTGGTCCAGAGCAGCGGACACCCAGATAGCGTGACAGAGCAAGATTCCAAAGACAGCACATACAGCCTCAGC(SEQ ID No.26)。

2.5.2 extraction of endotoxin-free plasmids

Endotoxin-free plasmid preparation was performed according to the instructions of a commercial endotoxin-free large quality-improving plasmid kit. (because the construction of antibody heavy and light chain plasmid need to be transfected CHO cells, need high quality plasmid DNA, use of endotoxin-free plasmid extraction kit preparation of DNA, improve transfection efficiency.)

2.6 expression and purification of antibodies

2.6.1 expression of antibodies

CHO-S cells were cultured in suspension at 37 ℃ in 8% CO₂The constant temperature shaking table of (1) was shaken at an amplitude of about 50mm in diameter and at a speed of 225 rpm.

(1) One day before transfection, CHO-S cell density was adjusted to 3X 10⁶～4×10⁶cells/mL, after further incubation for 18h, with preheated fresh ExpicHO^TMExpression Medium regulates cell density to 6X 10⁶cells/mL；

(2) Mixing heavy chain plasmid 15 μ g and corresponding light chain plasmid 30 μ g (heavy and light chain at a ratio of 1:2), placing into 2.0mL sterile centrifuge tube, adding 1000 μ L OptiPRO^TMSFM medium dilution plasmid; 80 μ L of transfection reagent Expifeacmine was taken^TMCHO Reagent was added to another new 2.0mL centrifuge tube and 920. mu.L OptiPRO was added^TMSFM medium dilution transfection reagent;

(3) then adding the diluted plasmid and the transfection reagent for one time, mixing, slightly reversing the plasmid and the transfection reagent from top to bottom for 4-5 times to form a mixture, and standing for 1-5 min at room temperature;

(4) the mixture was slowly added to the CHO-S cells prepared in step (1) (25mL of cells, density 6X 10)⁶cells/mL suspension flasks), slowly shaking the flasks while adding;

(5) placing CHO-S cells in a constant temperature shaking table at 37 ℃, performing suspension culture for 18h, and then supplementing 150 mu L of ExpicCHO^TMEnhancer and 6mL Expi CHO^TMFeed (Expifeacamine available from ThermoFisher Co., Ltd.)^TMCHO Transfection Kit, cat # A29129);

(6) after further culturing for 9 days, cell supernatants were collected and centrifuged at 10000 Xg at 4 ℃ for 30min, and the cell culture supernatants were collected to purify the antibody.

2.6.2 purification of antibodies

The harvested cell culture supernatant was filtered through a 0.22 μ M filter, and antibody purification was performed on an AKAT protein purifier using hitrap ion column, and the antibody was eluted using PBS containing 250mM imidazole, and then packed into a dialysis bag and dialyzed in PBS solution 3 times for 3 hours each. The dialyzed antibody was concentrated with PEG6000, and then subjected to SDS-PAGE analysis after concentration.

The results of SDS-PAGE analysis are shown in FIG. 5, the monoclonal genetically engineered antibody is successfully expressed after CHO-S cells are transfected, in reducing SDS-PAGE, disulfide bonds are broken and divided into two chains, namely a heavy chain and a light chain, wherein the size of the heavy chain is about 60kDa, and the size of the light chain is about 30kDa, which is consistent with the expected size. The method can successfully express and purify to obtain the swine-derived monoclonal genetic engineering antibody molecule.

Example 2

Indirect immunofluorescent assay (IFA)

SVA strain (SVA/HN/11/2017 Langmuir research) is inoculated on a monolayer BHK-21 cell which grows to 70% -80% full, and is placed at 37 ℃ and 5% CO under the control of normal cells₂And incubating for 6-8 h in the cell incubator. The method comprises the following steps: (1) fixing, sucking off supernatant, gently rinsing with Phosphate Buffer Solution (PBS) for 3 times, 5 min/time, and fixing with 4% paraformaldehyde solution at room temperature for 20 min;

(2) washing the mixture in the same way as the above, and permeating the mixture for 10min by using 2% Triton X-100;

(3) blocking is carried out as above, and blocking is carried out for 1h by using 5% BSA;

(4) incubating the primary antibody, washing, adding the purified antibody according to the concentration of 5 mu g/mL, and incubating for 1h at 37 ℃;

(5) washing the incubated secondary antibody, adding the goat anti-porcine IgG-FITC fluorescent secondary antibody with the working concentration, and incubating for 1h at 37 ℃;

(6) the microscopic examination was performed 5 times in the same manner as above, and the fluorescent signal was observed with a fluorescence microscope and recorded by photographing.

The results of IFA measurements are shown in FIG. 6. The monoclonal gene engineering antibody M03 can be specifically combined with BHK-21 cells infected by SVA/HN/11/2017 blue animal strain, obvious green fluorescence appears, and non-toxic control cells do not generate visible green fluorescence. The results show that the pig-derived monoclonal gene engineering antibody which can specifically react with SVA is successfully obtained.

Example 3

Indirect ELISA assay antibodies

The detection method comprises the following steps of detecting a purified genetic engineering antibody by using an indirect ELIAS antibody detection kit for the Seneca virus produced by the Lanzhou veterinary research institute diagnostic center of the Chinese academy of agricultural sciences, restoring the kit to room temperature, and then carrying out an experiment, wherein the specific operation is carried out according to a specification, and the method mainly comprises the following steps:

(1) recording the sample number on a sample adding table, diluting the sample to be detected by 30 times of sample diluent, and not diluting the negative and positive control serum;

(2) diluting the sample, adding the diluted sample to an SVA antigen coated plate, repeating 1 hole for 50 mu L/hole and positive and negative control serum respectively, and incubating for 30min at 37 ℃;

(3) discarding liquid of each hole on the antigen plate, washing the antigen plate by 1 multiplied by washing liquid, about 300 mu L/hole, washing for 5 times totally, and after the last washing liquid is discarded, patting the washing liquid remained in the hole on absorbent paper to be dry;

(4) adding 50 mu L of rabbit anti-pig IgG-HRP working solution into each hole, sealing the plate, and incubating for 30min at 37 ℃;

(5) after washing according to the method in the step (3), adding 50 mu L of substrate solution into each hole, and incubating for 12 +/-1 min at the temperature of 37 ℃;

(6) after adding 50. mu.L of stop solution to each well, OD was read with a microplate reader_450nmA value;

(7) and (3) calculating the result:

and (3) judging the effectiveness of the experiment: (negative control) NC-1/2 (NC1+ NC2), (positive control) PC-1/2 (PC1+ PC2), when PC-NC ≧ 0.90 and NC ≦ 0.20, indicating that the experiment was true.

And (3) judging the sample result: the presence or absence of SVA antibody in a sample is calculated by calculating the ratio of sample to positive control (S/P). (sample-NC)/(PC-NC) and when S/P is less than 0.4, it is negative and S/P is more than or equal to 0.4, it is positive.

The detection of the purified genetic engineering antibody is carried out by using the Seneca virus indirect ELIAS antibody detection kit developed by the diagnostic center of Lanzhou veterinary institute, and the result shows that the S/P of the M03 antibody is 0.649, and the S/P of the monoclonal genetic engineering antibody M03 is more than or equal to 0.4, which indicates that the obtained swine monoclonal genetic engineering antibody can generate specific reaction with the SVA antibody detection kit, so that the antibody can be further proved to be capable of specifically recognizing SVA antigen by an ELISA method.

Example 4

Virus neutralization assay

The virus neutralization experiment is carried out on the screened swine single-chain gene engineering antibody by using SVA strain (SVA/HN/11/2017 blue animal research). The specific experimental steps are as follows:

(1) in a 96-well cell culture plate, 50. mu.L of the antibody to be detected at different concentrations are added to each well, and then 50. mu.L of the antibody containing 100 TCID is added to each well₅₀SVA strains, which are placed at 37 ℃ for 1h of interaction and are set to contain 0.1, 1, 10, 100 TCID₅₀The virus of (1) was repeated for each dilution in 1 well, 50. mu.L/well;

(2) 100 μ LBHK-21 cells (approximately 5X 10 cells) were added per well⁴Cells) and setting 4 normal cell control holes;

(3) placing 96-well cell culture plate at 37 deg.C and 5% CO₂Incubating in an incubator for 72h, and observing cytopathic effect (CPE);

(4) when the virus regression test, positive, negative and normal cell control are all satisfied, the lowest concentration (half effective inhibiting concentration, IC) of the swine single-chain antibody with 50% of cells not diseased is₅₀) Indicating the ability to neutralize the virus in μ g/mL. Make IC₅₀At 50. mu.g/mL, as a threshold for neutralization, will>50 μ g/mL was determined to be non-neutralizing activity; < 50. mu.g/mL was determined to have neutralizing activity.

Results of virus neutralization assay

In the invention, a trace virus neutralization test is carried out on BHK-21 cells to verify whether the porcine-derived monoclonal genetic engineering antibodies have the SVA neutralizing capacity. The result is taken to be IC₅₀To evaluate antibody neutralization, IC₅₀Refers to the half inhibitory concentration of the antibody to be detected, with the unit of μ g/mL, IC₅₀The lower the value of (A), the stronger the neutralizing ability of the antibody. IC using 50. mu.g/mL₅₀The value is used as the threshold value for neutralization when the antibody IC to be detected₅₀At > 50. mu.g/mL, the antibody was considered to have no neutralizing activity. The virus neutralization titer of the pig-derived monoclonal genetically engineered antibody M03 is 1.47 mug/mL, and the pig-derived single-chain genetically engineered antibody M03 has the ability of neutralizing SVA strain SVA/HN/11/2017 in the blue animal research, namely is determined as a neutralizing antibody of SVA.

Example 5

Western Blot (WB) assay

Taking an antigen containing about 1 mu g of SVA strain (SVA/HN/11/2017 blue animal research) to perform SDS-PAGE electrophoresis, then transferring separated protein bands to a Nitrocellulose (NC) membrane, rinsing the NC membrane for 3 times for 5 min/time by using TBST buffer solution, and then blocking for 2h by using TBST buffer solution containing 5% skimmed milk powder; the NC membrane was rinsed 3 times as above, the expressed antibody was diluted to working concentration (5. mu.g/mL) with TBST buffer containing 5% skim milk powder, and incubated overnight at 4 ℃; rinsing the NC membrane for 3 times, adding an HRP-labeled goat anti-pig enzyme-labeled secondary antibody (1: 5000) and incubating for 1h at room temperature; after rinsing the NC membrane 3 times as above, ECL chemiluminescent substrate was added and imaging was performed by light exposure on X-ray film in the dark.

After the virus particles purified by SVA/HN/11/2017 blue animal research strain are used as antigen to carry out SDA-PAGE electrophoresis and then membrane transfer, WB results show that no reaction band appears with the porcine monoclonal gene engineering antibody, and clear and visible reaction bands appear with SVA positive serum. The experimental results confirm that the expressed 9 strains of genetically engineered antibodies are presumed to be induced by conformational epitopes.

The invention establishes a method for quickly preparing the swine-derived monoclonal genetic engineering antibody of Seneca virus for the first time, and the screened swine-derived monoclonal genetic engineering antibody with SVA specificity has the capability of neutralizing the research strain of SVA HN/11/2017 orchid animals, and is determined to be an SVA neutralizing antibody, but the antibody is shown to be generated by conformation type epitope induction through WB test, and the antibody with linear epitope is not obtained. The invention provides a method for preparing the SVA pig-derived monoclonal gene engineering antibody by combining the results, the screening method provides an important method for researching the identification of SVA host specific antigenic sites, and provides a key technical material for the establishment of a novel vaccine design and diagnosis method of the virus.

The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.

Sequence listing

<110> Lanzhou veterinary research institute of Chinese academy of agricultural sciences

<120> porcine-derived monoclonal genetic engineering antibody of Seneca virus, preparation method and application thereof

<160> 26

<170> SIPOSequenceListing 1.0

<210> 1

<211> 144

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 1

Met Glu Phe Arg Leu Asn Trp Val Val Leu Phe Ala Leu Leu Gln Gly

1 5 10 15

Val Gln Gly Glu Glu Lys Leu Val Glu Ser Gly Gly Gly Leu Val Gln

20 25 30

Pro Gly Gly Ser Leu Arg Leu Ser Cys Val Gly Ser Gly Phe Thr Phe

35 40 45

Gly Asp Tyr Ala Val Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu

50 55 60

Glu Trp Leu Ala Tyr Val Ala Ser Ser Ala Asp Ser Asp Phe Tyr Ala

65 70 75 80

Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Gln Asn

85 90 95

Thr Ala Tyr Leu Gln Ile Asn Ser Val Arg Thr Glu Asp Thr Ala His

100 105 110

Trp Tyr Cys Ala Arg His Arg Trp Ser Trp Gly Ser Ser Asn Glu Ala

115 120 125

Asp Pro Met Asn Leu Trp Gly Pro Gly Val Glu Val Val Val Ser Ser

130 135 140

<210> 2

<211> 196

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 2

Met Arg Ala Pro Met His Leu Leu Gly Leu Leu Leu Leu Trp Val Pro

1 5 10 15

Gly Ala Arg Ser Ala Thr Gln Leu Thr Gln Ser Pro Ala Ser Leu Ala

20 25 30

Ala Ser Ile Gly Asp Thr Val Ser Ile Thr Cys Arg Ala Ser Gln Ser

35 40 45

Val Ser Asn Asn Leu Ala Trp Tyr Gln Gln Gln Pro Gly Lys Ala Pro

50 55 60

Lys Leu Leu Ile Tyr Lys Ala Ser Ser Leu Gln Ser Gly Val Pro Ser

65 70 75 80

Arg Phe Lys Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser

85 90 95

Gly Leu Gln Ala Glu Asp Val Ala Thr Tyr Tyr Cys Leu Gln Ser Lys

100 105 110

His Leu Pro Leu Gly Phe Gly Ala Gly Thr Lys Leu Glu Leu Lys Arg

115 120 125

Ala Asp Ala Lys Pro Ser Val Phe Ile Phe Pro Pro Ser Lys Glu Gln

130 135 140

Leu Ala Thr Pro Thr Val Ser Val Val Cys Leu Ile Asn Asn Phe Phe

145 150 155 160

Pro Arg Glu Ile Ser Val Lys Trp Lys Val Asp Gly Val Val Gln Ser

165 170 175

Ser Gly His Pro Asp Ser Val Thr Glu Gln Asp Ser Lys Asp Ser Thr

180 185 190

Tyr Ser Leu Ser

195

<210> 3

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

gtttcggctg aactgggtgg tc 22

<210> 4

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

ggtcactgrc tcggggaagt agc 23

<210> 5

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

ggtggagtst ggrggaggcc tg 22

<210> 6

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

cagggggcca gagggtagac c 21

<210> 7

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

atggcctgga yccctctcct gctc 24

<210> 8

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

atggcccggg cttggctcct tgtca 25

<210> 9

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

atggcctgga cggtgcttct gatc 24

<210> 10

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

cctccaggtc acsgtcacg 19

<210> 11

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

tcctgtgagc tgactcagcc 20

<210> 12

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

cagkctgysc tgactcagc 19

<210> 13

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

tctcagactg tgatccagga g 21

<210> 14

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

gtcacttatt agacacacca gggtg 25

<210> 15

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

atgagggccc ccrtgcagct cct 23

<210> 16

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

tgtccttgct gtcctgctct g 21

<210> 17

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

tcctcctgct ctgggtccca g 21

<210> 18

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 18

gatgaagacg gatggcttgg c 21

<210> 19

<211> 19

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 19

Met Glu Phe Arg Leu Asn Trp Val Val Leu Phe Ala Leu Leu Gln Gly

1 5 10 15

Val Gln Gly

<210> 20

<211> 19

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 20

Met Ala Trp Thr Val Leu Leu Ile Gly Leu Leu Ala Val Gly Ser Gly

1 5 10 15

Val Asp Ser

<210> 21

<211> 20

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 21

Met Arg Ala Pro Met His Leu Leu Gly Leu Leu Leu Leu Trp Val Pro

1 5 10 15

Gly Ala Arg Ser

20

<210> 22

<211> 57

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 22

atggagttta ggctgaattg ggtggtgctg ttcgctctgc tgcaaggcgt ccaaggc 57

<210> 23

<211> 57

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 23

atggcttgga ctgtgctgct gatcggactg ctggctgtgg gaagcggagt ggatagc 57

<210> 24

<211> 60

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 24

atgagggccc ctatgcatct gctcggactg ctgctgctgt gggtgcccgg cgctaggtcc 60

<210> 25

<211> 448

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 25

gcggccgcgc caccatggag tttaggctga actgggtggt gctgttcgct ctgctgcaag 60

gcgtccaagg cgaagagaag ctggtggaaa gcggaggagg actggtgcag cccggcggct 120

ctctgaggct gagctgtgtg ggcagcggct tcactttcgg cgattacgct gtgagctggg 180

tgagacaagc ccccggcaag ggactggaat ggctggccta cgtggctagc agcgccgata 240

gcgatttcta cgccgatagc gtgaagggaa ggttcacaat ctctagggac aacagccaga 300

acacagccta tctgcagatc aacagcgtga ggactgagga tactgcccat tggtactgcg 360

ctaggcacag atggagctgg ggctccagca acgaggctga ccctatgaat ctgtggggac 420

ccggcgtgga ggtcgtggtg tcctcagc 448

<210> 26

<211> 600

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 26

gctagcgcca ccatgagggc ccctatgcat ctgctcggac tgctgctgct gtgggtgccc 60

ggcgctaggt ccgccacaca gctgactcag tccccagcct ctctggctgc cagcatcggc 120

gatacagtga gcatcacatg cagagccagc cagtccgtgt ccaacaatct ggcttggtac 180

cagcagcagc ccggcaaggc tccaaagctg ctgatctata aggccagctc tctgcagtcc 240

ggagtgcctt ctaggttcaa aggcagcggc agcggcactg acttcacact gactatcagc 300

ggactgcaag ccgaggatgt ggctacttac tactgcctcc agagcaagca tctgccactg 360

ggatttggcg ccggcacaaa gctcgagctg aaaagggccg atgccaagcc tagcgtgttc 420

atcttcccac catccaaaga gcagctggcc acacctacag tcagcgtggt ctgtctgatc 480

aacaacttct tcccaaggga aatctccgtg aagtggaagg tggatggcgt ggtccagagc 540

agcggacacc cagatagcgt gacagagcaa gattccaaag acagcacata cagcctcagc 600

Claims (10)

1. A preparation method of a Seneca virus porcine-derived monoclonal genetic engineering antibody is characterized by comprising the following steps:

1) infecting a pig with the Seneca virus strain, immunizing the pig with an inactivated vaccine prepared from the Seneca virus strain after 21 days, collecting peripheral blood of the pig after immunization for 21-30 days, and separating PBMCs;

2) subjecting said PBMCs to flow cytometric sorting to sort out IgG⁺-SVA⁺A cell;

3) with the IgG mentioned⁺-SVA⁺Reverse transcription is carried out by taking the genome of the cell as a template to obtain single-cell cDNA;

4) performing nested PCR amplification by using the single-cell cDNA as a template to obtain a gene of a porcine IgG heavy chain variable region and a gene of a porcine IgG light chain variable region;

5) constructing an IgG heavy chain expression vector and an IgG light chain expression vector from the gene of the pig IgG heavy chain variable region and the gene of the pig IgG light chain variable region respectively;

6) and co-transfecting eukaryotic cells with the IgG heavy chain expression vector and the IgG light chain expression vector for recombinant expression, and separating recombinant protein to obtain the Seneca virus swine-derived monoclonal genetic engineering antibody.

2. The preparation method according to claim 1, wherein the Seneca virus strain in step 1) is SVA/HN/11/2017 Lankan Kagaku with a preservation number of CGMCC NO. 19966;

the toxicity value of the SVA/HN/11/2017 Lankangshan is 1 × 10⁹TCID₅₀/mL；

The immunization dose of SVA/HN/11/2017 blue animal research is 2 mL/head.

3. The method of claim 1, wherein prior to subjecting the PBMCs to flow cytometric sorting in step 2), the method comprises subjecting the PBMCs to flow cytometric staining;

the flow cytometric staining method comprises the steps of mixing and incubating PBMCs with SVA virus particle antigens marked by biotin and Anti-porcine IgG-FITC fluorescent antibodies, washing, then carrying out heavy suspension, adding Anti-biotin-APC secondary antibody for ice bath, repeatedly washing, and then carrying out heavy suspension, thus obtaining the stained PBMCs.

4. The method according to claim 1, wherein the nested PCR amplification primer set for the porcine IgG heavy chain variable region in step 4) comprises an inner primer pair and an outer primer pair; the nucleotide sequences of the outer primer pair are shown as SEQ ID No.3 and SEQ ID No. 4; the nucleotide sequences of the inner primer pair are shown as SEQ ID No.5 and SEQ ID No. 6;

the nested PCR amplification primer group of the light chain variable region comprises a lambda light chain nested PCR amplification primer group and a kappa light chain nested PCR amplification primer group; the lambda light chain nested PCR amplification primer group comprises a lambda V3 outer primer with a nucleotide sequence shown as SEQ ID No.7, a lambda V2-6 outer upstream primer with a nucleotide sequence shown as SEQ ID No.8, a lambda V8 outer upstream primer with a nucleotide sequence shown as SEQ ID No.9, a lambda outer downstream primer with a nucleotide sequence shown as SEQ ID No.10, a lambda V3 inner upstream primer with a nucleotide sequence shown as SEQ ID No.11, a lambda V2-6 inner upstream primer with a nucleotide sequence shown as SEQ ID No.12, a lambda V8 inner upstream primer with a nucleotide sequence shown as SEQ ID No.13 and a lambda inner downstream primer with a nucleotide sequence shown as SEQ ID No. 14;

the kappa light chain nested PCR amplification primer group comprises a kappa light chain inner primer pair and a kappa light chain outer primer pair; the nucleotide sequence of the kappa light chain outer primer pair is shown as SEQ ID No.15 and SEQ ID No. 16; the nucleotide sequence of the kappa light chain inner primer pair is shown as SEQ ID No.17 and SEQ ID No. 18.

5. The method according to claim 1, wherein, in the step 5) of constructing the IgG heavy chain expression vector, a signal peptide having an amino acid sequence represented by SEQ ID No.19 is inserted into the 5' end of the gene of the porcine IgG heavy chain variable region;

when an IgG light chain expression vector is constructed, a signal peptide with an amino acid sequence shown as SEQ ID No.20 is inserted into the 5' end of the gene of the pig IgG lambda light chain variable region; the signal peptide with the amino acid sequence shown as SEQ ID No.21 is inserted into the 5' end of the gene of the porcine IgG kappa light chain variable region.

6. The method according to claim 1, wherein the ratio of the number of copies of the IgG heavy chain expression vector to the number of copies of the light chain expression vector in step 6) at the time of transfection is 1: 2.

7. The method according to claim 1, wherein in the case that the eukaryotic cell in step 6) is a CHO-S cell, the genes for the porcine IgG heavy chain variable region and the genes for the porcine IgG light chain variable region are optimized according to the bias codon of the CHO cell expression system;

the nucleotide sequence of the gene of the optimized porcine IgG heavy chain variable region is shown as SEQ ID No. 25; the nucleotide sequence of the gene of the optimized pig IgG light chain variable region is shown as SEQ ID No. 26.

8. The Seneca virus swine-derived monoclonal engineered antibody prepared by the preparation method of any one of claims 1-7, wherein the amino acid sequence of the heavy chain variable region is shown as SEQ ID No.1, and the amino acid sequence of the light chain variable region is shown as SEQ ID No. 2.

9. The seneca virus swine-derived monoclonal engineered antibody of claim 8, wherein the swine-derived monoclonal engineered antibody is a neutralizing antibody of seneca virus;

the neutralizing titer of the pig-derived monoclonal genetic engineering antibody is 1.47 mug/mL.

10. Use of the senany porcine-derived monoclonal genetically engineered antibody of claim 1 to 7 or the senany porcine-derived monoclonal genetically engineered antibody of claim 8 or 9 in the preparation of a kit for detecting senany.

Images