CN114085823B - Xylanase genexylA1And applications thereof - Google Patents

Abstract

The invention discloses a xylanase genexylA1And uses thereof, the xylanase genexylA1The nucleotide sequence of (2) is shown as SEQ ID NO: 1. The xylanase gene provided by the inventionxylA1Can code xylanase which has stable property under the pH6.0-9.0, can still keep more than 88 percent of residual enzyme activity after incubating 16h under the pH9.0, and can still keep more than 50 percent of residual enzyme activity after incubating 16h under the pH 10.0; the property is stable at 30-60 ℃, and the residual enzyme activity can still be kept at 90% after the treatment for 45min at 60 ℃. That is, the xylanase gene of the inventionxylA1The encoded xylanase has better heat resistance and alkali resistance, can be suitable for high-temperature, medium-high alkali environments in the production processes of papermaking, animal feed processing and the like, is beneficial to improving the utilization rate of the enzyme and is beneficial to improving the production process.

Description

Xylanase genexylA1And applications thereof

Technical Field

The invention relates to the technical field of genetic engineering, in particular to a xylanase genexylA1And applications thereof.

Background

The xylanase can degrade xylan into xylooligosaccharide and xylose, and has wide application prospect in feed, paper making, food, energy industry and environmental science.

In the paper making and feed processing processes, the processing environment required by part of working procedures is usually high-temperature and alkaline environment, but the xylanase on the market is poor in stability to temperature and pH at present and cannot adapt to the processing environment, so that the enzyme utilization rate is low, the processing technology is restricted, and the improvement difficulty is high.

Disclosure of Invention

The main purpose of the invention is to provideXylanase genexylA1And uses thereof, the xylanase genexylA1Can code xylanase with higher stability to alkali and high-temperature environment.

To achieve the above object, the present invention provides a xylanase genexylA1The xylanase genexylA1The nucleotide sequence of (2) is shown as SEQ ID NO: 1.

In addition, the invention also provides a thermokalite xylanase which is prepared from the xylanase genexylA1The coding result shows that the thermokalite xylanase has a nucleotide sequence shown as SEQ ID NO:2, and a polypeptide having the amino acid sequence shown in 2.

In addition, the present invention also provides a recombinant plasmid comprising the xylanase gene as described abovexylA1。

Furthermore, the present invention also provides a recombinant strain comprising a xylanase gene as defined abovexylA1。

Furthermore, the invention also provides an application of the thermokalite xylanase in papermaking.

Furthermore, the invention also proposes the use of a thermokalite xylanase as described above in animal feed processing.

The xylanase gene provided by the inventionxylA1Can code xylanase which has stable property under the pH6.0-9.0, can still keep more than 88 percent of residual enzyme activity after being incubated for 16 hours under the pH9.0, and can still keep more than 50 percent of residual enzyme activity after being incubated for 16 hours under the pH 10.0; the property is stable at 30-60 ℃, and the residual enzyme activity can still be kept at 90% after the treatment for 45min at 60 ℃. That is, the xylanase gene of the inventionxylA1The encoded xylanase has better heat resistance and alkali resistance, can be suitable for high-temperature, medium-high alkali environments in the production processes of papermaking, animal feed processing and the like, is beneficial to improving the utilization rate of the enzyme and is beneficial to improving the production process.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings that are required in the embodiments or the description of the prior art will be briefly described, and it is obvious that the drawings in the following description are only some embodiments of the present invention, and other related drawings can be obtained according to the drawings without inventive effort for a person skilled in the art.

FIG. 1 is a diagram showing SDS-PAGE test result of xylanase constructed in example 4;

FIG. 2 is a graph showing the results of enzyme activity assays of the xylanases constructed in example 4 at different pH values;

FIG. 3 is a graph showing the results of stability tests of the xylanase constructed in example 4 at different pH values;

FIG. 4 is a graph showing the results of enzyme activity assays of the xylanase constructed in example 4 at different temperatures;

FIG. 5 is a graph showing the results of stability tests of the xylanase constructed in example 4 at various temperatures.

The achievement of the objects, functional features and advantages of the present invention will be further described with reference to the accompanying drawings, in conjunction with the embodiments.

Detailed Description

In order to make the objects, technical solutions and advantages of the embodiments of the present invention more clear, the technical solutions of the embodiments of the present invention will be clearly and completely described below. It will be apparent that the described embodiments are only some, but not all, embodiments of the invention.

The specific conditions were not specified in the examples, and the examples were conducted under the conventional conditions or the conditions recommended by the manufacturer. The reagents or apparatus used were conventional products commercially available without the manufacturer's attention. In the embodiments related to gene synthesis, recombinant plasmid and recombinant strain preparation, recombinant protein obtained by fermentation culture of recombinant strain, and the like, specific experimental modes and experimental raw materials are not described, and the methods are carried out according to the conventional methods of genetic engineering and microbial fermentation culture preparation of protein based on genetic engineering. In addition, the technical solutions of the embodiments may be combined with each other, but it is necessary to base that the technical solutions can be realized by those skilled in the art, and when the technical solutions are contradictory or cannot be realized, the combination of the technical solutions should be regarded as not exist and not within the protection scope of the present invention. All other embodiments, which can be made by those skilled in the art based on the embodiments of the invention without making any inventive effort, are intended to be within the scope of the invention.

The invention provides a xylanase genexylA1The xylanase genexylA1The nucleotide sequence of (2) is shown as SEQ ID NO:1, a xylanase gene having the nucleotide sequencexylA1The xylanase has better heat stability and alkali stability.

Specifically, the xylanase gene provided by the inventionxylA1Is prepared from the microzyme of mothMicrobacterium imperiale) YD-01 (purchased from China Center for Type Culture Collection (CCTCC), the preservation number of which is CCTCC NO: m2017762) and amplified by specific primers using the DNA thereof as a template, the full length 3972 bp may encode 1323 amino acids.

Wherein, the primer sequence is:

P1，AGAATTCCCGACCGTCATCAGCTCCGT；

P2，GAAGCTTGGCGCGCTGACCCCGTCG。

based on the xylanase genexylA1Can encode a thermostable alkaline xylanase having a nucleotide sequence as set forth in SEQ ID NO:2, and a polypeptide having the amino acid sequence shown in 2.

The method for obtaining the thermokalite xylanase comprises the following steps: using restriction endonucleases, the resulting xylanase gene was usedxylA1Inserting the recombinant plasmid into an expression vector to obtain a recombinant plasmid; then transforming the recombinant plasmid into a host cell to obtain a recombinant strain; culturing the recombinant strain to obtain the thermokalite xylanase from the culture.

It should be noted that, the above-mentioned techniques for constructing recombinant plasmids and recombinant strains, and culturing recombinant strains can refer to conventional methods in the art, and specific operations are not described herein.

Is authenticated byIt was determined that the thermostable alkali xylanases described above belong to the xylanase of family Glycoside Hydrolase Family and have a low homology to other reported xylanases (highest similarity being derived fromAcetivibrio thermocellusThe identity of the xylanase of (2) is only 31%), that is, the thermostable xylanase is a new member of the xylanase family and belongs to an endonuclease.

The enzymatic properties of the thermostable alkaline xylanase are as follows:

(1) The optimum pH of the thermokalite xylanase is 7.0; after 16h is incubated at 25 ℃ and pH6.0-8.0, a substrate is added for enzymatic reaction for 30min at the optimal temperature of 70 ℃, more than 90% of residual enzyme activity can still be kept, and after 16h is incubated at 25 ℃ and pH9.0, the substrate is added for enzymatic reaction for 30min at the optimal temperature of 70 ℃, and the enzyme activity can still be kept more than 88% of original enzyme activity; after 16h incubation at pH10.0, the residual enzyme activity can be maintained by more than 50%, which indicates that the enzyme has alkali-resistant property.

(2) The optimum temperature of the thermostable alkali xylanase is 70 ℃; stable at 30-60 ℃ and the enzyme activity can keep more than 90% of the original activity after 30min treatment; the enzyme activity is stable and can maintain more than 75% of the residual enzyme activity after being treated for 24 hours at the temperature of less than 50 ℃, and can maintain more than 90% of the residual enzyme activity after being treated for 45 minutes at 60 ℃.

(3) Biochemical characteristics: co of 1mM ²⁺ 、Ba ²⁺ 、Fe ²⁺ 、Fe ³⁺ The metal ions of 2mM and 5mM have an accelerating effect on the enzyme activity of the thermokalite xylanase and an inhibiting effect on the enzyme activity of the thermokalite xylanase; mg of 1mM, 2mM and 5mM ²⁺ 、Ag ⁺ 、Cu ²⁺ 、Ca ²⁺ 、Mn ²⁺ 、Pb ²⁺ Has inhibiting effect on enzyme activity of the thermostable alkali xylanase.

In conclusion, the xylanase gene provided by the inventionxylA1Can code xylanase with optimal pH of 7.0, stable property under the pH of 6.0-9.0, and can still maintain more than 88% of residual enzyme activity after 16h incubation under the pH of 9.0Force; the optimal temperature is 70 ℃, the property is stable within the range of 30-60 ℃, and the residual enzyme activity can still be kept at 90% after the treatment is carried out for 45min at 60 ℃. Xylanase genes of the inventionxylA1The encoded xylanase is an endonuclease, has thermophilic property, has better heat resistance and alkali resistance, can adapt to high-temperature, medium-high alkali environments in the production processes of papermaking, animal feed processing and the like, is beneficial to improving the enzyme utilization rate, so that the restriction on the enzyme application environment requirement is smaller when the production process is improved, and the difficulty of process improvement is reduced.

The following technical solutions of the present invention will be described in further detail with reference to specific examples and drawings, and it should be understood that the following examples are only for explaining the present invention and are not intended to limit the present invention.

EXAMPLE 1 acquisition of xylanase genesxylA1

The preservation number is CCTCC NO: microbacterium moths of M2017762Microbacterium imperiale) YD-01. Extracting the genome DNA of the strain YD-01, extracting 5 mL genome DNA, taking the extracted YD-01 genome as a template, designing a primer pair, and amplifying a xylanase gene by PCRxylA1。

The primer sequences were as follows:

P1，AGAATTCCCGACCGTCATCAGCTCCGT；

P2，GAAGCTTGGCGCGCTGACCCCGTCG。

wherein, the reaction conditions of PCR amplification are as follows: pre-denaturation at 98 ℃ for 5min, deformation at 95 ℃ for 30 s, annealing at 65 ℃ for 40s, extension at 72 ℃ for 2 min for 40s, circulation times for 30 times, 10 min at 72 ℃ and heat preservation at 18 ℃ for 10 min.

Sequencing the gene sequence, wherein the nucleotide sequence is shown as SEQ ID NO: 1. Xylanase gene recovered by tailingxylA1Cloning onto pGEM-T Easy vector, sequencing by Shanghai, and analysis by BLAST alignment, the results showedxylA1The enzyme coded by the gene has only 31 percent of amino acid residue consistency with the reported xylanase, which indicates that the enzyme codes for a new xylanase.

EXAMPLE 2 preparation of recombinant plasmid

(1) By restriction enzymesEcoRI, and RI systemHindIII the xylanase gene obtained in example 1xylA1Excised from pGEM-TEasy vector, and the excised rubber was recoveredxylA1A DNA fragment;

(2) Will bexylA1The DNA fragment was ligated to pET-28a vector (a commercial vector for recombinant expression of foreign gene in E.coli, commercially available from Novagen, which carries kanamycin resistance gene) by T4 DNA ligase (available from Takara);

(3) Passing the ligation product through CaCl ₂ The method was transformed into competent cells of E.coli DH 5. Alpha. A conventional clone strain from biological laboratories, purchased from Invitrogen, and stored in university of light industry, wuhan laboratory). The transformed cells were spread on LB agar plates containing 50. Mu.g/ml kanamycin (purchased from Sigma Co.), cultured to give single colonies, the single colonies were picked up, the plasmids were extracted after the culture, and then the plasmid was usedEcoRI, and RI systemHindIII, identifying the double enzyme digestion plasmid, and obtaining the recombinant plasmid pET-28a with correct enzyme digestion resultxylA1。

EXAMPLE 3 preparation of recombinant Strain

The recombinant plasmid pET-28a obtained in example 2 was usedxylA1Transformation into E.coliE.coli RosettaIn (DE 3), a recombinant plasmid pET-28 a-containing cell line was obtainedxylA1Recombinant E.coli of (E.coli)E. coli Rosetta (DE 3), i.e.recombinant strainsE. coli Rosetta (DE3) (pET-28a-xylA1)。

EXAMPLE 4 preparation of thermostable alkali xylanase

After the recombinant strain prepared in example 3 was cultured to an OD of 0.6, 0.1 to 1mM of IPTG (isopropyl thiogalactoside inducer) was added, and the strain was induced on a shaker at 160 rpm at 16℃for 16 to 20 hours. And (3) centrifugally collecting thalli, crushing cells by ultrasonic waves, collecting crude enzyme liquid (the crude enzyme liquid contains recombinant proteins formed by fermenting recombinant strains), and purifying the crude enzyme liquid by using a Ni column to obtain the thermokalite xylanase.

1. Protein expression analysis of thermokalite xylanases

The crude enzyme solution obtained by disrupting cells in example 4And purified thermostable alkali xylanase (i.e. a collecting tube sample obtained by gradient elution of crude enzyme solution through a chromatographic column) are respectively subjected to SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis) test, and a control group of empty vector obtained by converting pET28a into Escherichia coli DE3 is also arranged. The results are shown in FIG. 1 (FIG. 1: lane M is Marker, lane 1 is MarkerE.coli Rosetta(pET 28 a) product after empty vector induction, lane 2 is recombinant bacteriumE. coli Rosetta (DE3) (pET-28a-xylA1) The crude enzyme solution after cell disruption, lane 3 is a sample collected after gradient elution of the crude enzyme solution by a chromatographic column, and 150kDa corresponds to a band of the target protein).

As can be seen from FIG. 1, the purified thermokalite xylanase is efficiently expressed in E.coli and efficiently purified by affinity chromatography.

2. Enzyme activity assay for thermokalite xylanases

The concentration of purified xylanase obtained in example 4 was determined by the BSA method at 595nm of an ultraviolet spectrophotometer: OD values of BSA working solutions with different concentrations at 595nm are measured, and the standard protein content is taken as an abscissa and OD is taken as an OD _595nm And drawing a standard curve for the ordinate, and according to the drawn protein concentration standard curve. And (3) measuring the enzyme activity of the purified thermokalite xylanase by a DNS method, and calculating to obtain the specific activity of the enzyme as 15.691 +/-0.017U/mg.

3. pH temperature analysis of the optimal reaction of thermostable alkaline xylanases

10 mL the purified xylanase enzyme solution obtained in example 4 was diluted 10-fold in phosphate-citrate buffer (disodium hydrogen phosphate-citrate) (pH=4.0, 5.0, 6.0, 7.0) and glycine-sodium hydroxide buffer (glycine-sodium hydroxide) (pH=8.0, 9.0, 10.0), respectively, and 100 mL of 5mg/mL of xylan solution was added thereto, and after enzymatic reaction in a thermostatic water bath at 37℃for 30 minutes, the effect of pH on xylanase enzyme activity was measured by the DNS method. The results are shown in FIG. 2, in which the abscissa indicates pH and the ordinate indicates relative enzyme activity (optimum pH activity 100%). As can be seen from the figure, thermokalite xylanase has the highest activity at ph=7.0, its optimum pH is 7.0, and is capable of maintaining relative enzyme activity of 80% or more between pH6.0 and 9.0.

4. Analysis of pH stability of thermostable alkaline xylanases

10 mL the purified xylanase enzyme solution obtained in example 4 was diluted 10-fold in phosphate-citrate buffer (disodium hydrogen phosphate-citrate) (pH=4.0, 5.0, 6.0, 7.0) and glycine-sodium hydroxide buffer (glycine-sodium hydroxide) (pH=8.0, 9.0, 10.0), incubated in a constant temperature water bath at 25℃for 16 hours, and after adding a substrate, the enzymatic reaction was carried out at an optimum temperature of 70℃for 30 minutes, and then the pH stability of the xylanase was determined by the DNS method. The results are shown in FIG. 3, in which the abscissa indicates pH and the ordinate indicates residual enzyme activity (%).

As can be seen from fig. 3, the thermokalite xylanase prepared in this example is incubated in phosphate-citrate buffer (ph=6.0, 7.0) at 25 ℃ for 16h, then a substrate is added for enzymatic reaction for 30min at an optimum temperature of 70 ℃, and the enzyme activities are respectively 90% and 91% of the original activities; after 16h is incubated in glycine-sodium hydroxide buffer (pH=8.0 and 9.0), a substrate is added for enzymatic reaction for 30min at the optimal temperature of 70 ℃, and the enzyme activities are respectively 93% and 88% of the original activities; after 16h incubation in glycine-sodium hydroxide buffer (ph=10.0), the substrate is added for enzymatic reaction for 30min at the optimum temperature of 70 ℃, and the enzyme activities are respectively more than 50% of the original activities. Thus, thermostable alkaline xylanases are in the pH range of 6.0 to 9.0, are relatively stable in their enzymatic activity, and are somewhat tolerant to high alkaline environments at pH 10.0.

5. Analysis of the optimal reaction temperature for thermostable alkaline xylanases

The enzyme activities were measured by the DNS method at 30℃at 35℃at 40℃at 50℃at 60℃at 65℃at 70℃at 75℃at 80℃respectively, by dispersing the thermostable alkali xylanase in a buffer system having a pH of 7.0. The results are shown in FIG. 4, in which the abscissa indicates temperature and the ordinate indicates relative enzyme activity (enzyme activity 100% at optimum temperature).

As can be seen from FIG. 4, the alkali-resistant xylanase prepared in the embodiment can maintain the relative enzyme activity of more than 80% at 50-75 ℃, and the optimal temperature is 70 ℃.

6. Temperature stability analysis of thermostable alkaline xylanases

After dilution of thermostable alkaline xylanases with phosphate-citrate buffer (ph=7.0) at 10-fold, the temperature stability of the xylanase was determined after incubation at different temperatures (30 ℃, 35 ℃, 40 ℃, 50 ℃, 60 ℃,65 ℃, 70 ℃) for 30min, 45min, 1 h, 2 h, 3 h, 4h, 24h, respectively, with untreated enzymes as blank. The results are shown in FIG. 5.

As can be seen from FIG. 5, the alkali-resistant xylanase prepared in the embodiment is stable within the range of 30-60 ℃, and the enzyme activity can be maintained to be more than 90% of the original activity after 30min of treatment; the enzyme activity can keep 90% of the original activity after being treated at 60 ℃ for 45 min; the enzyme activity can keep 64% of the original activity after 30min of treatment at 65 ℃; the enzyme activity is stable and the residual enzyme activity is maintained above 75% when the treatment is carried out for 24 hours at the temperature of less than 50 ℃.

7. Action of metal ions and some chemical reagents on thermokalite xylanase and salt tolerance analysis of thermokalite xylanase

A standard reaction system was prepared according to the method in the above-mentioned enzyme activity analysis, and 10 kinds of metal salt solutions (FeCl) having final concentrations of 1mM, 2mM and 5mM were added to the standard reaction system, respectively ₂ Solution, feCl ₃ Solution, baCl ₂ Solution, mnCl ₂ Solution, caCl ₂ Solution, cuCl ₂ Solution, coCl ₂ Solution, mgCl ₂ Solution, pbCl ₂ Solution, agNO ₃ Solution), the enzyme activity was measured by the DNS method using a standard reaction system containing no reagent solution as a control group, and the relative enzyme activities in the other pH reaction zones were calculated with the highest enzyme activity value measured set to 100%.

Analysis of results: 1mM Metal ion Co ²⁺ 、Ba ²⁺ 、Fe ²⁺ 、Fe ³⁺ The metal ions of 2mM and 5mM have an effect of promoting the enzyme activity of the thermokalite xylanase and an effect of inhibiting the enzyme activity of the thermokalite xylanase; 1mM, 2mM and 5mM of metal ions Mg ²⁺ 、Ag ⁺ 、Cu ²⁺ 、Ca ²⁺ 、Mn ²⁺ 、Pb ²⁺ Has inhibiting effect on enzyme activity of the thermostable alkali xylanase.

The foregoing is merely a preferred embodiment of the present invention and is not intended to limit the scope of the present invention, but various modifications and variations will be apparent to those skilled in the art. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention should be included in the scope of the present invention.

Sequence listing

<110> university of light industry in Wuhan

<120> xylanase gene xylA1 and application thereof

<130> 20211118

<141> 2021-11-24

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 3972

<212> DNA

<213> micro-bacillus moth (Microbacterium imperiale)

<400> 1

ccgaccgtca tcagctccgt cgacttcgaa gacggaacga ccggtacctg gacccgcagc 60

ggtgggaccg acgacaccct gaccgtgatc gacctcgacg gtgagaaggt gctcgaggtc 120

gccgaccgcg acgccgacta cgtcggcatc cagagcccga ccggcatcta caaagccggc 180

acgacctacg acttctccct gcgggtgcgc ctggcacccg gcacgccgga caccagcgcc 240

cgcgtggtca tgaagccggc ctacacctgg atcggcaaca ccagcgtgac ggcgacgggg 300

tggaccacga tctccgggtc gttcacagcc ccggacggcg acgtctcggg gttgcaggcg 360

tacatcggca cctccgacat cgcggaaacg cccgcgttca cctactacgt cgacgacatc 420

gtcgtgacca ccgctgccgc gtccggtggc ggagaagtcc ccgacgtggc accgggcggt 480

gctgttgatc ccaccgcgac ccccgcttcg gcggcccagg gcaccggcaa cgtcgccgct 540

ctcaccttcg acgacggccc gaacgccggc acgacgcccg cgctgctgga cttcctcgcc 600

gagaacgaca tccgcgcggt gttctgcgtc atcggccaga acatcaccgc tcccggtggc 660

gccgacctgc tccggcgcat cgtcgccgag ggacacgtgc tgtgcaacca ctcgacgacc 720

tacgacgaca tgggttcgct gacgcaggac caggccgcga cccgcatggc ggagaacctc 780

accatcatcc gctccgcact gggtgacgcg gactaccccg tgccgttctt ccgcgctccg 840

aacggttcgt ggggcaacac ccccgcggct gcggtctcgc tcgggatgca gcccctcgcg 900

gtggtcaaca ccatcgacga ctggcagacc caggacgtcg tgacgctcac ggcgaatctc 960

cgctccgcga tcacggcggg acaggtggtg ctggtgcacg acggtggcgg cgaccgcagc 1020

ggttcgctcg ccgcggtgga gacggtcgtg accgagcgcc tcgccgaggg gtggacgttc 1080

acccttccgg tcggagtcgc cgacgatggg accggcgggg cgccgcagcc cggcgatgtc 1140

ctcatcgaca cggacttcga ttcgggagat ctcgacgggt ggtcggcccg cgccggatcg 1200

gacacctccg acccgcaggt gaccatcgtc gacggcggcg cggatgacac accgtccgcc 1260

gcacaggttg gtgagcgcac gcacgagggc gacggcattc agcgcagcat cgtcggcatc 1320

ctcgaacccg gcgcgaccta cgccttgagc gctgccgtgc gtttcgcgcc cggggccgcg 1380

acgggtcagg ggctcacgct ctcggcacgc accgtctccg gcggtacgca gaacttcgcc 1440

aacctcctcc agatcgagaa cgcgaccgcc agcgggtgga ccaccgtgcg cggcgagttc 1500

accgtgccga cctacgattc ggccgcggag atctacatcg aggcgcgcta caacagcggc 1560

aacacctcga cgttcctggt ggatcaggtg cggatctcgg ttcccgagga cgcgcaggtc 1620

gacaccagcc tcaccccggt gaaggacacg gtcgacttcc cgctcggggt ggccatcgac 1680

tcgcgcgaga cgaccggtgc ggccgcgcag ttgctgctgc accactacaa ccagatcacc 1740

cccgagaacc acatgaaggt cgaggcctgg tacaccgggc cgggacagtt cgcgcggaac 1800

gccgaggcga ccgccctgct caacttcgcg caggcggagg acatcgggct gtacgggcac 1860

gtgctggtct ggcactcgca gaccccggcg tggttcttcc aggacgattc ggggcgcgag 1920

ctgacgacgt cggatgccga caagcaactg ctgcgcgagc gcctgcggac gcacatcttc 1980

gatgtcgcgg catccatcgc ggacgactac ggaccctacg gctcggacac gaatccgctc 2040

atcgcgtggg acgtggtcaa cgaggtcatc tccgaccagg ccaccccgga cgggctgcgc 2100

acgagtcgct ggtaccaggt gctgggcgag gagttcatcc ggctggcgtt ccagtacgcc 2160

gacgacgcct tcaacgagga gtacgcggcc cccggcaccg accgtccggt caagctgttc 2220

atcaacgact acaacaccga gatcgacgcg aagggggcgc agtacgaagc cctcgtgaag 2280

cgtctgctgg atgcgaacgt gccgatcgac ggcgtggggc accagttcca cacctcgatc 2340

aacacgccga tcgccgcctt gcgcggagct ctcgagcggt tcgaaggact cggtctgatg 2400

caggcggtga cggagcttga cgtgacgatc aaccccgccg acgaccccaa ccgggtgcgt 2460

caggggtact tctaccgcga tgtgttcgcc ctgctgcgcg actaccacgc gtcggctccg 2520

gcggcggaga agatcttctc ggccacggtg tggggcctca cggacacgcg atcgtggcgc 2580

gcggagcagc agcccctgct gttcacgggc gggttgcagc cgaagccggc ctactacggc 2640

gcgatcgacg acgccgaagg gctgcccgcg ttgatcacga ccgcgaacgt gttcgaaggg 2700

gatgtggaag ccggtgccga gttcaccaag gctccggagt ggcgcaacct gcccttccac 2760

ccgctgaccg agaacgccgg ggggtggcag tcccggtgga acgccgatca cctcgccgtc 2820

atcgtgcggt cgtcggcgac gcccgaccgg gtggcgttca cgtacggaga ccaggagtac 2880

ttctacgctc cggacgctgc gggatcggtg ccgggggcgc agacggtcgt cgagggtgtc 2940

acctacaccc tggcccacct gccgcactcg gacgtgcagg cgggacaggg ggccgacttc 3000

gatgtgcggc tgctgaccgg cgaccaggtc gtcggtgcgt ggaactcccc cggcgccacc 3060

ggacggctct ccttcctcga gccgctgtcg ttcctgccgg tgcccgagct cgcggcgccg 3120

accgtggacg gtgaggtgga tgccgcctat gccgacgccg ccgtggcgac caccgctcgc 3180

acggtcgagg ggtcggccga cggggcgagc gccgaggtcc ggacgctgtg gcagggcaac 3240

acgctgtacg cgctgttcga ggtgaccgac cccgtgatcg atctgtcggg cagtgacccg 3300

tggcagcagg acagcgtcga gctgttcctc gacctcggga ataccaaggc ggggagctac 3360

ggcccgaacg acacgcagat ccgcatctcg gccgacaacg tgctgtcctt cggttcgggg 3420

aacaccgcgg tccaggaggc acgggtggcg gcgagtgcga cggcgcgcac cgccgacggg 3480

taccgcgtgg aagtcgcgat cgacctggtc ggtcagtcgg ggggacagag caacgtcccg 3540

ctcggcggcc tcgacacggt gcacggcatc gacttccagg tgaacgatgg tcgacccgag 3600

gggcggttct cggtcaagac ctgggcagac ccgaccggga ccggctacca gaccaccgca 3660

cggtggggcg tcgccgagtt ggtcgccgag gtgaccgacc cgggcaccga ccccggtacc 3720

gacccgggca ccggccccgg taccgacccg ggcaccggcc ccggtaccga gccgggcact 3780

acgccgggaa cgggccccgg cacaacgccg ctccccggaa cggcgaccgg tcccctgccg 3840

ccgtcgcgcg ggtcggcgga cgcgctcgcc agcaccggtg gaacggtgcc gctcggggct 3900

gtcgcgatcg gtgtcctgat ggtggtcggc ggggccatcg tggccatccg tcgacggggt 3960

cagcgcgcct ga 3972

<210> 2

<211> 1323

<212> PRT

<213> micro-bacillus moth (Microbacterium imperiale)

<400> 2

Pro Thr Val Ile Ser Ser Val Asp Phe Glu Asp Gly Thr Thr Gly Thr

1 5 10 15

Trp Thr Arg Ser Gly Gly Thr Asp Asp Thr Leu Thr Val Ile Asp Leu

20 25 30

Asp Gly Glu Lys Val Leu Glu Val Ala Asp Arg Asp Ala Asp Tyr Val

35 40 45

Gly Ile Gln Ser Pro Thr Gly Ile Tyr Lys Ala Gly Thr Thr Tyr Asp

50 55 60

Phe Ser Leu Arg Val Arg Leu Ala Pro Gly Thr Pro Asp Thr Ser Ala

65 70 75 80

Arg Val Val Met Lys Pro Ala Tyr Thr Trp Ile Gly Asn Thr Ser Val

85 90 95

Thr Ala Thr Gly Trp Thr Thr Ile Ser Gly Ser Phe Thr Ala Pro Asp

100 105 110

Gly Asp Val Ser Gly Leu Gln Ala Tyr Ile Gly Thr Ser Asp Ile Ala

115 120 125

Glu Thr Pro Ala Phe Thr Tyr Tyr Val Asp Asp Ile Val Val Thr Thr

130 135 140

Ala Ala Ala Ser Gly Gly Gly Glu Val Pro Asp Val Ala Pro Gly Gly

145 150 155 160

Ala Val Asp Pro Thr Ala Thr Pro Ala Ser Ala Ala Gln Gly Thr Gly

165 170 175

Asn Val Ala Ala Leu Thr Phe Asp Asp Gly Pro Asn Ala Gly Thr Thr

180 185 190

Pro Ala Leu Leu Asp Phe Leu Ala Glu Asn Asp Ile Arg Ala Val Phe

195 200 205

Cys Val Ile Gly Gln Asn Ile Thr Ala Pro Gly Gly Ala Asp Leu Leu

210 215 220

Arg Arg Ile Val Ala Glu Gly His Val Leu Cys Asn His Ser Thr Thr

225 230 235 240

Tyr Asp Asp Met Gly Ser Leu Thr Gln Asp Gln Ala Ala Thr Arg Met

245 250 255

Ala Glu Asn Leu Thr Ile Ile Arg Ser Ala Leu Gly Asp Ala Asp Tyr

260 265 270

Pro Val Pro Phe Phe Arg Ala Pro Asn Gly Ser Trp Gly Asn Thr Pro

275 280 285

Ala Ala Ala Val Ser Leu Gly Met Gln Pro Leu Ala Val Val Asn Thr

290 295 300

Ile Asp Asp Trp Gln Thr Gln Asp Val Val Thr Leu Thr Ala Asn Leu

305 310 315 320

Arg Ser Ala Ile Thr Ala Gly Gln Val Val Leu Val His Asp Gly Gly

325 330 335

Gly Asp Arg Ser Gly Ser Leu Ala Ala Val Glu Thr Val Val Thr Glu

340 345 350

Arg Leu Ala Glu Gly Trp Thr Phe Thr Leu Pro Val Gly Val Ala Asp

355 360 365

Asp Gly Thr Gly Gly Ala Pro Gln Pro Gly Asp Val Leu Ile Asp Thr

370 375 380

Asp Phe Asp Ser Gly Asp Leu Asp Gly Trp Ser Ala Arg Ala Gly Ser

385 390 395 400

Asp Thr Ser Asp Pro Gln Val Thr Ile Val Asp Gly Gly Ala Asp Asp

405 410 415

Thr Pro Ser Ala Ala Gln Val Gly Glu Arg Thr His Glu Gly Asp Gly

420 425 430

Ile Gln Arg Ser Ile Val Gly Ile Leu Glu Pro Gly Ala Thr Tyr Ala

435 440 445

Leu Ser Ala Ala Val Arg Phe Ala Pro Gly Ala Ala Thr Gly Gln Gly

450 455 460

Leu Thr Leu Ser Ala Arg Thr Val Ser Gly Gly Thr Gln Asn Phe Ala

465 470 475 480

Asn Leu Leu Gln Ile Glu Asn Ala Thr Ala Ser Gly Trp Thr Thr Val

485 490 495

Arg Gly Glu Phe Thr Val Pro Thr Tyr Asp Ser Ala Ala Glu Ile Tyr

500 505 510

Ile Glu Ala Arg Tyr Asn Ser Gly Asn Thr Ser Thr Phe Leu Val Asp

515 520 525

Gln Val Arg Ile Ser Val Pro Glu Asp Ala Gln Val Asp Thr Ser Leu

530 535 540

Thr Pro Val Lys Asp Thr Val Asp Phe Pro Leu Gly Val Ala Ile Asp

545 550 555 560

Ser Arg Glu Thr Thr Gly Ala Ala Ala Gln Leu Leu Leu His His Tyr

565 570 575

Asn Gln Ile Thr Pro Glu Asn His Met Lys Val Glu Ala Trp Tyr Thr

580 585 590

Gly Pro Gly Gln Phe Ala Arg Asn Ala Glu Ala Thr Ala Leu Leu Asn

595 600 605

Phe Ala Gln Ala Glu Asp Ile Gly Leu Tyr Gly His Val Leu Val Trp

610 615 620

His Ser Gln Thr Pro Ala Trp Phe Phe Gln Asp Asp Ser Gly Arg Glu

625 630 635 640

Leu Thr Thr Ser Asp Ala Asp Lys Gln Leu Leu Arg Glu Arg Leu Arg

645 650 655

Thr His Ile Phe Asp Val Ala Ala Ser Ile Ala Asp Asp Tyr Gly Pro

660 665 670

Tyr Gly Ser Asp Thr Asn Pro Leu Ile Ala Trp Asp Val Val Asn Glu

675 680 685

Val Ile Ser Asp Gln Ala Thr Pro Asp Gly Leu Arg Thr Ser Arg Trp

690 695 700

Tyr Gln Val Leu Gly Glu Glu Phe Ile Arg Leu Ala Phe Gln Tyr Ala

705 710 715 720

Asp Asp Ala Phe Asn Glu Glu Tyr Ala Ala Pro Gly Thr Asp Arg Pro

725 730 735

Val Lys Leu Phe Ile Asn Asp Tyr Asn Thr Glu Ile Asp Ala Lys Gly

740 745 750

Ala Gln Tyr Glu Ala Leu Val Lys Arg Leu Leu Asp Ala Asn Val Pro

755 760 765

Ile Asp Gly Val Gly His Gln Phe His Thr Ser Ile Asn Thr Pro Ile

770 775 780

Ala Ala Leu Arg Gly Ala Leu Glu Arg Phe Glu Gly Leu Gly Leu Met

785 790 795 800

Gln Ala Val Thr Glu Leu Asp Val Thr Ile Asn Pro Ala Asp Asp Pro

805 810 815

Asn Arg Val Arg Gln Gly Tyr Phe Tyr Arg Asp Val Phe Ala Leu Leu

820 825 830

Arg Asp Tyr His Ala Ser Ala Pro Ala Ala Glu Lys Ile Phe Ser Ala

835 840 845

Thr Val Trp Gly Leu Thr Asp Thr Arg Ser Trp Arg Ala Glu Gln Gln

850 855 860

Pro Leu Leu Phe Thr Gly Gly Leu Gln Pro Lys Pro Ala Tyr Tyr Gly

865 870 875 880

Ala Ile Asp Asp Ala Glu Gly Leu Pro Ala Leu Ile Thr Thr Ala Asn

885 890 895

Val Phe Glu Gly Asp Val Glu Ala Gly Ala Glu Phe Thr Lys Ala Pro

900 905 910

Glu Trp Arg Asn Leu Pro Phe His Pro Leu Thr Glu Asn Ala Gly Gly

915 920 925

Trp Gln Ser Arg Trp Asn Ala Asp His Leu Ala Val Ile Val Arg Ser

930 935 940

Ser Ala Thr Pro Asp Arg Val Ala Phe Thr Tyr Gly Asp Gln Glu Tyr

945 950 955 960

Phe Tyr Ala Pro Asp Ala Ala Gly Ser Val Pro Gly Ala Gln Thr Val

965 970 975

Val Glu Gly Val Thr Tyr Thr Leu Ala His Leu Pro His Ser Asp Val

980 985 990

Gln Ala Gly Gln Gly Ala Asp Phe Asp Val Arg Leu Leu Thr Gly Asp

995 1000 1005

Gln Val Val Gly Ala Trp Asn Ser Pro Gly Ala Thr Gly Arg Leu Ser

1010 1015 1020

Phe Leu Glu Pro Leu Ser Phe Leu Pro Val Pro Glu Leu Ala Ala Pro

1025 1030 1035 1040

Thr Val Asp Gly Glu Val Asp Ala Ala Tyr Ala Asp Ala Ala Val Ala

1045 1050 1055

Thr Thr Ala Arg Thr Val Glu Gly Ser Ala Asp Gly Ala Ser Ala Glu

1060 1065 1070

Val Arg Thr Leu Trp Gln Gly Asn Thr Leu Tyr Ala Leu Phe Glu Val

1075 1080 1085

Thr Asp Pro Val Ile Asp Leu Ser Gly Ser Asp Pro Trp Gln Gln Asp

1090 1095 1100

Ser Val Glu Leu Phe Leu Asp Leu Gly Asn Thr Lys Ala Gly Ser Tyr

1105 1110 1115 1120

Gly Pro Asn Asp Thr Gln Ile Arg Ile Ser Ala Asp Asn Val Leu Ser

1125 1130 1135

Phe Gly Ser Gly Asn Thr Ala Val Gln Glu Ala Arg Val Ala Ala Ser

1140 1145 1150

Ala Thr Ala Arg Thr Ala Asp Gly Tyr Arg Val Glu Val Ala Ile Asp

1155 1160 1165

Leu Val Gly Gln Ser Gly Gly Gln Ser Asn Val Pro Leu Gly Gly Leu

1170 1175 1180

Asp Thr Val His Gly Ile Asp Phe Gln Val Asn Asp Gly Arg Pro Glu

1185 1190 1195 1200

Gly Arg Phe Ser Val Lys Thr Trp Ala Asp Pro Thr Gly Thr Gly Tyr

1205 1210 1215

Gln Thr Thr Ala Arg Trp Gly Val Ala Glu Leu Val Ala Glu Val Thr

1220 1225 1230

Asp Pro Gly Thr Asp Pro Gly Thr Asp Pro Gly Thr Gly Pro Gly Thr

1235 1240 1245

Asp Pro Gly Thr Gly Pro Gly Thr Glu Pro Gly Thr Thr Pro Gly Thr

1250 1255 1260

Gly Pro Gly Thr Thr Pro Leu Pro Gly Thr Ala Thr Gly Pro Leu Pro

1265 1270 1275 1280

Pro Ser Arg Gly Ser Ala Asp Ala Leu Ala Ser Thr Gly Gly Thr Val

1285 1290 1295

Pro Leu Gly Ala Val Ala Ile Gly Val Leu Met Val Val Gly Gly Ala

1300 1305 1310

Ile Val Ala Ile Arg Arg Arg Gly Gln Arg Ala

1315 1320

Claims (6)

1. The xylanase gene xylA1 is characterized in that the nucleotide sequence of the xylanase gene xylA1 is shown in SEQ ID NO: 1.

2. A thermostable alkaline xylanase encoded by xylanase gene xylA1 according to claim 1, characterized in that said thermostable alkaline xylanase has a sequence as set forth in SEQ ID NO:2, and a polypeptide having the amino acid sequence shown in 2.

3. A recombinant plasmid comprising the xylanase gene xylA1 of claim 1.

4. A recombinant strain comprising the xylanase gene xylA1 of claim 1.

5. Use of the thermokalite xylanase of claim 2 in papermaking.

6. Use of the thermokalite xylanase of claim 2 in animal feed processing.

Images