CN114075285A

CN114075285A - Anti-human CD38 humanized monoclonal antibody and application thereof

Info

Publication number: CN114075285A
Application number: CN202010841602.5A
Authority: CN
Inventors: 万云超; 胡琛霏; 杨冬美; 崔文俊
Original assignee: Reyoung Suzhou Biology Science & Technology Co ltd
Current assignee: Reyoung Suzhou Biology Science & Technology Co ltd
Priority date: 2020-08-20
Filing date: 2020-08-20
Publication date: 2022-02-22
Anticipated expiration: 2040-08-20
Also published as: CN114075285B

Abstract

The invention provides a monoclonal antibody combined with a CD38 antigen and application thereof. The humanized monoclonal antibody provided by the invention can specifically recognize a CD38 antigen, has good affinity, and simultaneously has antibody-dependent cell-mediated cytotoxicity (ADCC) activity and complement-dependent cytotoxicity (CDC) activity, thereby killing CD38+ cells. The application also provides the application of the monoclonal antibody or the variant in preventing and/or treating tumors.

Description

Anti-human CD38 humanized monoclonal antibody and application thereof

Technical Field

The invention belongs to the field of biological medicines, and particularly relates to a humanized monoclonal antibody combined with human CD38 protein and application thereof.

Background

Multiple Myeloma (MM) is a malignant hematological tumor with abnormal proliferation of plasma cells, which affects the production of white blood cells, red blood cells, and stem cells in the bone marrow, resulting in anemia; damage to bone, damage to bone and soft tissue; causing repeated infection, renal insufficiency and other symptoms. The incidence rate of the tumor increases year by year, and the incidence rate of the global multiple myeloma accounts for 1.8 percent of all tumors and 10 to 15 percent of blood tumors in 2019 and is arranged at the 2 nd position of the blood tumors. With the continuous deepening of the cognition of people on multiple myeloma and the increasing of research and development, new medicines, diagnoses and treatment means are more and more abundant, in particular to the clinical application of medicines such as immunomodulators (such as thalidomide and lenalidomide), proteasome inhibitors (such as bortezomib and carfilzomib), autologous hematopoietic stem cell transplantation (ASCT), monoclonal antibodies (such as Daratumumab) and the like, the total survival (OS) of MM patients is remarkably improved in the last twenty years, and the compliance is also remarkably improved; however, due to the presence of myeloma stem cells and microscopic residual foci in patients, multiple myeloma is not yet completely cured and almost all patients eventually relapse. However, current treatment regimens for relapsed/refractory myeloma (RRMM) are limited, and patients have poor survival outcome; therefore, the treatment of RRMM has become a focus of attention for researchers at home and abroad.

The prior art shows that the immunophenotype of plasma cells includes: CD138+, CD38+, CD19+, CD 56-. Typically, CD38 is expressed by hematopoietic cells and solid tissues, with the majority of medullary thymocytes being CD38+, resting and circulating T and B cells being CD38-, and activated cells being CD38 +. The CD38 protein is one of the antigens expressed on malignant plasma cells and is expressed in various hematological malignancies cells, including but not limited to multiple myeloma cells, B cell chronic lymphocytic leukemia cells, B cell acute lymphocytic leukemia cells.

CD38 is a single-chain transmembrane glycoprotein of 45kDa comprising a short amino-terminal intracellular domain, a transmembrane domain and a long carboxy-terminal extracellular domain, and has enzymatic activity, receptor and adhesion functions in addition to being a phenotypic marker of cell differentiation. CD38, an extracellular enzyme, catalyzes the conversion of nicotinamide adenine dinucleotide (NAD +) to adenosine diphosphate ribose (ADPR) and Nicotinic Acid Adenine Dinucleotide Phosphate (NAADP), a process involved in the mobilization of intracellular calcium ions. As a receptor, CD38 plays a role in the immune process, mediating cytokine production, T lymphocyte proliferation and protection of mature B lymphocytes and dendritic cells from apoptosis. CD38 is also involved in cell-to-cell adhesion, which causes different patterns of cell migration into tissues with different levels of CD38 expression. In addition, the adhesion function of CD38 is closely linked to the receptor function, CD31 is a natural ligand of CD38, and human T lymphocytes adhere to endothelial cells through CD38-CD31 interactions. CD38 is expressed mainly in T cells, dendritic cells, Natural Killer (NK) cells, and hematopoietic stem cells, and also expressed in pancreatic cells, corneal cells of the eye, and the like. Most importantly, the high expression of CD38 in myeloma cells makes CD38 an attractive target for MM therapy.

anti-CD 38 antibodies have been reported in the literature, for example, Lande R, et al, Cell Immunol.220(1), 30-8(2002), Ausiello CM, et al, Tissue antibodies.56 (6), 539-47(2000), and Cotner T, et al, lnt J Immunopharmacol.3(3), 255-68 (1981). Patent CN110144008A discloses an antibody capable of binding to the CD38 protein, having good affinity, and capable of killing CD38 by antibody-dependent cell-mediated cytotoxicity ADCC, complement-dependent cytotoxicity CDC and/or apoptosis⁺A cell. Patent WO2020/052546a1 also discloses a series of murine, chimeric or humanized antibodies comprising the CDR regions of the anti-CD 38 antibody, as well as pharmaceutical compositions comprising the anti-CD 38 antibody or antigen binding fragments thereof and their use as medicaments.

Although CAR-T and ADC products for multiple myeloma have shown some good results in terms of efficacy in recent years, their drawbacks have not been overlooked. Off-target effects such as CAR-T products, over-activation of T cells, induction of cytokine release syndrome, and neurotoxicity; the production process of ADC products is complex, the stability of molecules in vivo is poor, and the off-target toxicity of small molecules is high; the BCMA target was not as mature as the CD38 target. In combination with the clinical therapeutic efficacy of darunavir and the clinical study data of sarcomas and MOR202, monoclonal antibodies to the CD38 target remain a very good choice for the treatment of multiple myeloma and relapsed/refractory myeloma.

Therefore, the continuous research and development of monoclonal antibodies with high selectivity, high affinity and high drug property aiming at the CD38 target still remains a problem to be solved urgently.

Disclosure of Invention

The invention provides a humanized monoclonal antibody combined with CD38 protein and application thereof. The humanized monoclonal antibody combined with the CD38 protein provided by the invention has higher affinity, and can kill tumor cells and inhibit tumor growth through the antibody-dependent cell-mediated cytotoxicity ADCC and complement-dependent cytotoxicity CDC functions, thereby achieving the purposes of tumor prevention and treatment.

In one aspect, the invention provides a series of monoclonal antibodies that bind to CD38 protein.

Specifically, the monoclonal antibody which binds to the CD38 protein comprises:

(1) a heavy chain complementarity determining region comprising any one or more of heavy chain HCDR1, HCDR2 and HCDR3 having sequences shown in SEQ ID NO 1, SEQ ID NO 2 and SEQ ID NO 3, respectively, or a HCDR variant having 3, 2 or 1 amino acid differences from heavy chain HCDR1, HCDR2 or HCDR3 shown in SEQ ID NO 1, SEQ ID NO 2 or SEQ ID NO 3, respectively;

and/or (2) a light chain complementarity determining region comprising any one or more of light chain LCDR1, LCDR2 and LCDR3 having sequences shown in SEQ ID NO. 4, SEQ ID NO. 5 and SEQ ID NO. 6, respectively, or a LCDR variant having 3, 2 or 1 amino acid differences from light chain LCDR1, LCDR2 or LCDR3 shown in SEQ ID NO. 4, SEQ ID NO. 5 or SEQ ID NO. 6, respectively.

Further specifically, the monoclonal antibody binding to the CD38 protein comprises:

(1) a heavy chain variable region variant comprising a heavy chain variable region as set forth in SEQ ID NO 7 or SEQ ID NO 8, or having 3, 2 or 1 amino acid differences from the heavy chain variable regions set forth in SEQ ID NO 7 and SEQ ID NO 8;

and/or (2) a light chain variable region variant comprising a light chain variable region as set forth in SEQ ID NO 9 or SEQ ID NO 10 or having 3, 2 or 1 amino acid differences from the light chain variable regions set forth in SEQ ID NO 9 and SEQ ID NO 10.

(1) a heavy chain with the sequence shown in SEQ ID NO. 11, SEQ ID NO. 12, SEQ ID NO. 13 or SEQ ID NO. 14;

and/or (2) a light chain with a sequence shown as SEQ ID NO. 15 or SEQ ID NO. 16.

(1) a heavy chain with a sequence shown as SEQ ID NO. 11 and a light chain with a sequence shown as SEQ ID NO. 15;

or (2) a heavy chain with a sequence shown as SEQ ID NO. 12 and a light chain with a sequence shown as SEQ ID NO. 15;

or (3) a heavy chain with a sequence shown as SEQ ID NO. 13 and a light chain with a sequence shown as SEQ ID NO. 16;

or (4) a heavy chain with the sequence shown as SEQ ID NO. 14 and a light chain with the sequence shown as SEQ ID NO. 16.

In another aspect, the invention provides a series of nucleic acid molecules encoding the monoclonal antibodies that bind to the CD38 protein.

In particular, the nucleic acid molecule comprises one or more codon-optimized nucleic acid molecules.

In another aspect, the invention provides a series of vectors comprising one or more nucleic acid molecules as described herein.

Specifically, the vector includes but is not limited to plasmid, virus, phage.

In another aspect, the invention provides a series of host cells comprising or producing the monoclonal antibody that binds to CD38 protein.

In another aspect, the invention provides a method of making the monoclonal antibody or variant thereof, the method comprising culturing a host cell described herein under conditions such that the monoclonal antibody or variant thereof is expressed.

Specifically, the host cell includes but is not limited to a microorganism, a plant or an animal cell, and the vector of the present invention can be introduced into the host cell by a method known to those skilled in the art, such as electroporation, lipofectine transfection, lipofectamine transfection, and the like.

In another aspect, the present invention provides a pharmaceutical composition comprising the monoclonal antibody or variant thereof of the present invention, the nucleic acid molecule, the vector and/or the cell, and optionally a pharmaceutically acceptable adjuvant.

Specifically, the pharmaceutically acceptable adjuvants include, but are not limited to: diluents, excipients, fillers, wetting agents, disintegrants, flavoring agents and binders.

In another aspect, the present invention provides the use of said monoclonal antibody or variant thereof, said nucleic acid molecule, said vector and/or said cell for the manufacture of a medicament, kit and/or device for the prevention and/or treatment of a CD38 positive disease or disorder.

Specifically, the CD38 positive disease or disorder comprises an immune disease or a hematologic tumor.

More specifically, the immune diseases comprise diseases such as rheumatoid arthritis, systemic lupus erythematosus, immune-mediated thrombocytopenia, hemolytic anemia, ankylosing spondylitis, multiple sclerosis, psoriasis, Crohn's disease, glomerulonephritis, asthma and the like.

Further specifically, the hematological tumors include leukemia, B cell lymphoma, T cell lymphoma, NK cell lymphoma, plasma cell malignancy, and myeloma.

Preferably, the hematological neoplasm is multiple myeloma.

In another aspect, the present invention provides a method for preventing and/or treating a tumor, said method comprising administering to a subject in need thereof the monoclonal antibody or variant thereof, the nucleic acid molecule, the vector, the host cell and/or the pharmaceutical composition, kit and/or device of the present invention.

Compared with the prior art, the invention has the advantages that:

(1) the invention provides a series of monoclonal antibodies which are combined with CD38 antigen, and the monoclonal antibodies are humanized monoclonal antibodies.

(2) The monoclonal antibody provided by the invention is a high-expression sequence, has high expression quantity and less impurities, is easy to purify and collect, reduces the purification and collection cost, and is beneficial to large-scale production and application.

(3) The monoclonal antibody provided by the invention has good thermal stability and solution stability, and is convenient to store.

(4) The monoclonal antibody provided by the invention can specifically recognize the human CD38 antigen and has high affinity.

(5) The monoclonal antibody provided by the invention has better capacity of binding CD38 antigen, and has effective antibody-dependent cell-mediated cytotoxicity (ADCC) activity and complement-dependent cytotoxicity (CDC) activity.

(6) The monoclonal antibody provided by the invention has better anti-tumor activity in the antibody.

Drawings

FIG. 1 is a 4-12% SDS-PAGE gradient gel electrophoresis chart of monoclonal antibodies RB0021-S1, RB0021-S2, RB0021-S3 and RB 0021-S4.

FIG. 2 is a SEC-HPLC chromatogram of monoclonal antibody RB 0021-S1.

FIG. 3 is a SEC-HPLC chromatogram of monoclonal antibody RB 0021-S2.

FIG. 4 is a SEC-HPLC chromatogram of monoclonal antibody RB 0021-S3.

FIG. 5 is a SEC-HPLC chromatogram of monoclonal antibody RB 0021-S4.

FIG. 6 is a graph showing the results of detection of the binding ability of monoclonal antibodies RB0021-S1, RB0021-S2, RB0021-S3 and RB0021-S4 to cell surface antigen.

FIG. 7 is a graph showing the results of ADCC activity assay using monoclonal antibodies RB0021-S1, RB0021-S2, RB0021-S3, and RB 0021-S4.

FIG. 8 is a graph showing the results of CDC activity assays for monoclonal antibodies RB0021-S1, RB0021-S2, RB0021-S3, and RB 0021-S4.

FIG. 9 is a statistical chart of the results of the mean tumor volume of the mice tested for activity in monoclonal antibodies.

FIG. 10 is a statistical chart of the results of the average tumor weight of the mice tested for activity in monoclonal antibodies.

FIG. 11 is a schematic diagram of tumors in mice tested for activity in monoclonal antibodies.

Detailed Description

The present invention will be further illustrated in detail with reference to the following specific examples, which are not intended to limit the present invention but are merely illustrative thereof. The experimental methods used in the following examples are not specifically described, and the materials, reagents and the like used in the following examples are generally commercially available under the usual conditions without specific descriptions.

Term(s) for

In order that the invention may be more readily understood, certain technical and scientific terms are specifically defined below. Unless otherwise specifically defined herein, all other technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs.

The three letter codes and the one letter codes for amino acids used in the present invention are as described in j. diol. chem,243, p3558 (1968).

The "antibody" of the present invention refers to an immunoglobulin, which is a tetrapeptide chain structure formed by linking two identical heavy chains and two identical light chains via interchain disulfide bonds. The constant regions of immunoglobulin heavy chains differ in their amino acid composition and arrangement, and thus, their antigenicity. Accordingly, immunoglobulins can be classified into five classes, or isotypes called immunoglobulins, i.e., IgM, IgD, IgG, IgA, IgE, and their corresponding heavy chains are μ, δ, γ, α, and ε chains, respectively. The same class of igs can be divided into different subclasses according to differences in amino acid composition of the hinge region and the number and position of disulfide bonds in the heavy chain, for example, iggs can be classified into IgG1, IgG2, IgG3 and IgG 4. Light chains are classified as either kappa or lambda chains by differences in the constant regions. Each of the five classes of Ig may have either a kappa chain or a lambda chain.

The sequences of the antibody heavy and light chains, near the N-terminus, are widely varied by about 110 amino acids, the variable region (Fv region); the remaining amino acid sequence near the C-terminus is relatively stable and is a constant region. The variable regions include 3 hypervariable regions (HVRs) and 4 Framework Regions (FRs) which are relatively sequence conserved. The 3 hypervariable regions determine the specificity of the antibody, also known as Complementarity Determining Regions (CDRs). Each light chain variable region (VL or LCVR) and heavy chain variable region (VH or HCVR) consists of 3 CDR regions and 4 FR regions, arranged sequentially from amino terminus to carboxy terminus in the order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR 4. The 3 CDR regions of the light chain are referred to as LCDR1, LCDR2 and LCDR3, and the 3 CDR regions of the heavy chain are referred to as HCDR1, HCDR2 and HCDR 3.

The term "complementarity determining region" (CDR) refers to one of the 6 hypervariable regions within the variable domain of an antibody which primarily contributes to antigen binding. Typically, there are three CDRs per heavy chain variable region (HCDR1, HCDR2, HCDR3) and three CDRs per light chain variable region (LCDR1, LCDR2, LCDR 3). The amino acid sequence boundaries of the CDRs are determined using the "Kabat numbering convention" (see Kabat et al (1991)).

The term "monoclonal antibody" refers to an antibody obtained from a population of substantially homogeneous antibodies, i.e., the individual antibodies comprising the population are identical and/or bind the same epitope, except for possible variant antibodies. Unlike polyclonal antibody preparations, which typically contain different antibodies directed against different determinants, each monoclonal antibody of a monoclonal antibody preparation is directed against a single determinant on the antigen. Thus. "monoclonal" refers to the property of an antibody obtained from a substantially homogeneous population of antibodies, and should not be construed as requiring production of the antibody by any particular method. The monoclonal antibodies of the present invention can be prepared by a variety of techniques known to those skilled in the art, including, but not limited to, hybridoma methods, recombinant DNA methods, phage display methods, transgenic methods, and the like.

The monoclonal antibody disclosed by the invention is a humanized monoclonal antibody.

The term "murine monoclonal antibody" is used herein to refer to a monoclonal antibody prepared against human CD38 according to the knowledge and skill in the art. Preparation is accomplished by injecting a subject with the CD38 antigen and then isolating hybridomas that express antibodies having the desired sequence or functional properties. In a preferred embodiment of the invention, the murine CD38 antibody or antigen binding fragment thereof may further comprise a light chain constant region of a murine kappa, lambda chain or variant thereof, or further comprise a heavy chain constant region of a murine IgG1, IgG2, IgG3 or variant thereof.

The term "humanized monoclonal antibody" refers to an antibody produced by grafting murine CDR sequences into the human antibody variable region framework, i.e., different types of human germline antibody framework sequences, which can overcome the heterologous response induced by the large number of murine protein components carried by the chimeric antibody. To avoid reduced immunogenicity and reduced activity, the human antibody variable region framework sequences may be minimally back-mutated (or back-mutated) to retain activity.

The monoclonal antibody of the present invention, which binds to CD38 protein, includes a combination of heavy and light chains as described in table 1 below.

TABLE 1 sequence characteristics of monoclonal antibodies that bind to the CD38 protein

The terms "specific binding", "selective binding" refer to the binding of an antibody to an epitope on a predetermined antigen. Typically, the antibody is administered at a rate of about less than 10^-8M, e.g. less than about 10^-9M、10^-10M、10^-11M or less affinity (KD) binding. Where "KD" refers to the dissociation equilibrium constant for a particular antibody-antigen interaction.

The term "ADCC" is antibody-dependent cell-mediated cytotoxicity (ADCC), generally meaning that a cell with killing activity recognizes the Fc fragment coated on a target antigen via its surface-expressed Fc receptor (FcR), whereby effector cells of the immune system actively lyse the target cell whose membrane surface antigen has been bound by a specific antibody.

The term "CDC" is Complement Dependent Cytotoxicity (CDC) and generally refers to the cytotoxicity involved in complement, i.e. the classical pathway of complement is activated by the formation of a complex by the binding of specific antibodies to corresponding antigens on the surface of cell membranes, and the formed membrane-attacking complex exerts a lytic effect on target cells.

The term "Daudi cells" generally refers to cell lines derived from Burkitt's lymphoma. Despite the intracellular class I heavy chains present in Daudi cells, they are free of class I Human Leukocyte Antigen (HLA) molecule expression on their surface because of a defect in the gene encoding β 2-microglobulin (β 2m), resulting in a lack of translatable mRNA.

The term "Jurkat-Lucia NFAT-CD16 cells" was genetically engineered from a human T lymphocyte Jurkat cell line. Cell lines stably expressed the Lucia luciferase reporter gene under the control of a minimal promoter and 6 NFAT response elements, as well as the cell surface Fc receptor CD16a (Fc. gamma. RIIIA; V158 high affinity allografts). Jurkat cells naturally express NFAT functional signaling pathways.

The term "NCI-H929 cell" refers to a cell line established in malignant effusion of myeloma patients, which is a human myeloma cell that expresses CD38 antigen on its cell surface.

The term "NOD/SCID mouse", i.e. non-obese diabetic/severe combined immunodeficient mouse, is an immunodeficient mouse backcrossed on the basis of SCID (severe combined immunodeficient) mice with non-obese diabetic mouse (NOD/Lt) strains (TL, BL, NK cell deficiency). NOD/SCID mice have both innate immunodeficiency and a deficiency in T and B lymphocytes, various tumor cells can be implanted, and rejection and graft-versus-host disease (GVHD) are less likely to occur, so NOD/SCID mice are becoming useful tools for experimental studies in hematology.

EXAMPLE 1 monoclonal antibody preparation

The DNA nucleotide sequence of the RB0021-S1 heavy chain is as follows:

CAAGTGACACTGAAAGAGAGCGGCCCTACACTGGTGAAGCCCACCCAGACACTGACACTGACATGCACCACCAGCGGCTACACATTCACCTCCCACGGCATCAACTGGGTGAGACAGCCCCCCGGCAAGGCCCTCGAGTGGATCGGCTACATCTACATCGGCAACGGCTACACCGAGTACAACGAGAAGTTCAAGGGAAGAGCTACACTGACCAGCGACACCAGCAAGAATCAAGCCGTGCTGACCATGACCAACATGGACCCCGTGGATACCGCCACCTACTTCTGCGCTAGATCCCACTACGACAGCTCCAGCTGGTTTGCTTACTGGGGCCAAGGCACACTGGTGACCGTGAGCTCCGCCAGCACCAAGGGACCTAGCGTGTTTCCTCTGGCCCCTTCTAGCAAGAGCACAAGCGGAGGAACAGCCGCTCTGGGCTGTCTGGTGAAAGACTACTTTCCCGAGCCCGTGACCGTGTCTTGGAATTCAGGAGCCCTGACCAGCGGAGTGCACACATTTCCAGCCGTGCTGCAGAGCAGCGGACTGTATAGCCTGAGCAGCGTGGTGACCGTGCCTTCTTCTTCTCTGGGCACCCAGACCTACATCTGCAACGTGAACCACAAGCCCAGCAACACCAAGGTGGACAAGAAGGTGGAGCCCAAGTCTTGCGACAAGACCCACACTTGCCCCCCTTGTCCAGCTCCAGAACTCCTGGGAGGACCTAGCGTGTTCCTGTTCCCTCCCAAGCCTAAGGACACCCTGATGATCAGCCGGACCCCAGAAGTGACTTGCGTGGTGGTGGACGTGTCCCACGAAGACCCCGAGGTCAAGTTCAATTGGTACGTGGACGGAGTGGAGGTGCACAACGCTAAGACCAAGCCCAGGGAGGAGCAGTACAACAGCACCTACAGGGTGGTGTCCGTGCTGACAGTGCTGCACCAGGATTGGCTGAACGGCAAGGAGTACAAGTGCAAGGTGTCCAACAAGGCCCTGCCAGCCCCTATCGAGAAGACCATCAGCAAGGCCAAGGGCCAGCCTAGAGAGCCTCAGGTGTACACCCTGCCCCCTAGCAGAGACGAGCTGACCAAGAACCAGGTGTCCCTGACTTGCCTCGTGAAGGGCTTCTACCCCAGCGATATCGCCGTGGAGTGGGAATCTAACGGTCAGCCAGAGAACAACTACAAGACCACCCCCCCAGTGCTGGACAGCGACGGCAGCTTCTTCCTGTACAGCAAGCTGACCGTGGACAAAAGCCGCTGGCAGCAGGGCAACGTGTTCTCTTGCAGCGTGATGCACGAGGCCCTGCACAACCACTACACCCAGAAGAGCCTGAGCCTGAGCCCAGGAAAG

the DNA nucleotide sequence of the RB0021-S2 heavy chain is as follows:

CAAGTGACACTGAAAGAGAGCGGCCCTACACTGGTGAAGCCCACCCAGACACTGACACTGACATGCACCACCAGCGGCTACACATTCACCTCCCACGGCATCAACTGGGTGAGACAGCCCCCCGGCAAGGCCCTCGAGTGGATCGGCTACATCTACATCGGCAACGGCTACACCGAGTACAACGAGAAGTTCAAGGGAAGAGCTACACTGACCAGCGACACCAGCAAGAATCAAGCCGTGCTGACCATGACCAACATGGACCCCGTGGATACCGCCACCTACTTCTGCGCTAGATCCCACTACGACAGCTCCAGCTGGTTTGCTTACTGGGGCCAAGGCACACTGGTGACCGTGAGCTCCGCCAGCACCAAGGGACCTAGCGTGTTTCCTCTGGCCCCTTCTAGCAAGAGCACAAGCGGAGGAACAGCCGCTCTGGGCTGTCTGGTGAAAGACTACTTTCCCGAGCCCGTGACCGTGTCTTGGAATTCAGGAGCCCTGACCAGCGGAGTGCACACATTTCCAGCCGTGCTGCAGAGCAGCGGACTGTATAGCCTGAGCAGCGTGGTGACCGTGCCTTCTTCTTCTCTGGGCACCCAGACCTACATCTGCAACGTGAACCACAAGCCCAGCAACACCAAGGTGGACAAGAAGGTGGAGCCCAAGTCTTGCGACAAGACCCACACTTGCCCCCCTTGTCCAGCTCCAGAACTCCTGGGAGGACCTAGCGTGTTCCTGTTCCCTCCCAAGCCTAAGGACACCCTGATGATCAGCCGGACCCCAGAAGTGACTTGCGTGGTGGTGGACGTGTCCCACGAAGACCCCGAGGTCAAGTTCAATTGGTACGTGGACGGAGTGGAGGTGCACAACGCTAAGACCAAGCCCAGGGAGGAGCAGTACAACAGCACCTACAGGGTGGTGTCCGTGCTGACAGTGCTGCACCAGGATTGGCTGAACGGCAAGGAGTACAAGTGCAAGGTGTCCAACAAGGCCCTGCCAGCCCCTATCGAGAAGACCATCAGCAAGGCCAAGGGCCAGCCTAGAAAGCCTCAGGTGTACACCCTGCCCCCTAGCAGAGACGAGCTGACCAAGAACCAGGTGTCCCTGACTTGCCTCGTGAAGGGCTTCTACCCCAGCGATATCGCCGTGGAGTGGGAATCTAACGGTCAGCCAGAGAACAACTACAAGACCACCCCCCCAGTGCTGGACAGCGACGGCAGCTTCTTCCTGTACAGCAAGCTGACCGTGGACAAAAGCCGCTGGCAGCAGGGCAACGTGTTCTCTTGCAGCGTGATGCACGAGGCCCTGCACAACCACTACACCCAGAAGAGCCTGAGCCTGAGCCCAGGAAAG

the DNA nucleotide sequence of the RB0021-S3 heavy chain is as follows:

CAAGTGCAGCTGGTGCAGAGCGGCGCTGAGGTGAAGAAACCCGGCAGCAGCGTGAAGGTGAGCTGCAAGACCAGCGGCTACACCTTCACCAGCCACGGCATCAACTGGGTGAGACAAGCCCCCGGCCAAGGACTGGAGTGGATCGGCTACATCTACATCGGCAACGGCTACACCGAGTACAACGAGAAGTTCAAGGGAAGAGCCACACTGACCTCCGACACAAGCACCAGCACCGCCTACATGGAGCTGAGCTCTCTGAGGAGCGAGGACACCGCCGTGTATTTCTGCGCTAGAAGCCACTACGACAGCAGCAGCTGGTTCGCTTACTGGGGACAAGGCACACTGGTGACCGTGTCCAGCGCCAGCACCAAGGGACCTAGCGTGTTTCCTCTGGCCCCTTCTAGCAAGAGCACAAGCGGAGGAACAGCCGCTCTGGGCTGTCTGGTGAAAGACTACTTTCCCGAGCCCGTGACCGTGTCTTGGAATTCAGGAGCCCTGACCAGCGGAGTGCACACATTTCCAGCCGTGCTGCAGAGCAGCGGACTGTATAGCCTGAGCAGCGTGGTGACCGTGCCTTCTTCTTCTCTGGGCACCCAGACCTACATCTGCAACGTGAACCACAAGCCCAGCAACACCAAGGTGGACAAGAAGGTGGAGCCCAAGTCTTGCGACAAGACCCACACTTGCCCCCCTTGTCCAGCTCCAGAACTCCTGGGAGGACCTAGCGTGTTCCTGTTCCCTCCCAAGCCTAAGGACACCCTGATGATCAGCCGGACCCCAGAAGTGACTTGCGTGGTGGTGGACGTGTCCCACGAAGACCCCGAGGTCAAGTTCAATTGGTACGTGGACGGAGTGGAGGTGCACAACGCTAAGACCAAGCCCAGGGAGGAGCAGTACAACAGCACCTACAGGGTGGTGTCCGTGCTGACAGTGCTGCACCAGGATTGGCTGAACGGCAAGGAGTACAAGTGCAAGGTGTCCAACAAGGCCCTGCCAGCCCCTATCGAGAAGACCATCAGCAAGGCCAAGGGCCAGCCTAGAGAGCCTCAGGTGTACACCCTGCCCCCTAGCAGAGACGAGCTGACCAAGAACCAGGTGTCCCTGACTTGCCTCGTGAAGGGCTTCTACCCCAGCGATATCGCCGTGGAGTGGGAATCTAACGGTCAGCCAGAGAACAACTACAAGACCACCCCCCCAGTGCTGGACAGCGACGGCAGCTTCTTCCTGTACAGCAAGCTGACCGTGGACAAAAGCCGCTGGCAGCAGGGCAACGTGTTCTCTTGCAGCGTGATGCACGAGGCCCTGCACAACCACTACACCCAGAAGAGCCTGAGCCTGAGCCCAGGAAAG

the DNA nucleotide sequence of the RB0021-S4 heavy chain is as follows:

CAAGTGCAGCTGGTGCAGAGCGGCGCTGAGGTGAAGAAACCCGGCAGCAGCGTGAAGGTGAGCTGCAAGACCAGCGGCTACACCTTCACCAGCCACGGCATCAACTGGGTGAGACAAGCCCCCGGCCAAGGACTGGAGTGGATCGGCTACATCTACATCGGCAACGGCTACACCGAGTACAACGAGAAGTTCAAGGGAAGAGCCACACTGACCTCCGACACAAGCACCAGCACCGCCTACATGGAGCTGAGCTCTCTGAGGAGCGAGGACACCGCCGTGTATTTCTGCGCTAGAAGCCACTACGACAGCAGCAGCTGGTTCGCTTACTGGGGACAAGGCACACTGGTGACCGTGTCCAGCGCCAGCACCAAGGGACCTAGCGTGTTTCCTCTGGCCCCTTCTAGCAAGAGCACAAGCGGAGGAACAGCCGCTCTGGGCTGTCTGGTGAAAGACTACTTTCCCGAGCCCGTGACCGTGTCTTGGAATTCAGGAGCCCTGACCAGCGGAGTGCACACATTTCCAGCCGTGCTGCAGAGCAGCGGACTGTATAGCCTGAGCAGCGTGGTGACCGTGCCTTCTTCTTCTCTGGGCACCCAGACCTACATCTGCAACGTGAACCACAAGCCCAGCAACACCAAGGTGGACAAGAAGGTGGAGCCCAAGTCTTGCGACAAGACCCACACTTGCCCCCCTTGTCCAGCTCCAGAACTCCTGGGAGGACCTAGCGTGTTCCTGTTCCCTCCCAAGCCTAAGGACACCCTGATGATCAGCCGGACCCCAGAAGTGACTTGCGTGGTGGTGGACGTGTCCCACGAAGACCCCGAGGTCAAGTTCAATTGGTACGTGGACGGAGTGGAGGTGCACAACGCTAAGACCAAGCCCAGGGAGGAGCAGTACAACAGCACCTACAGGGTGGTGTCCGTGCTGACAGTGCTGCACCAGGATTGGCTGAACGGCAAGGAGTACAAGTGCAAGGTGTCCAACAAGGCCCTGCCAGCCCCTATCGAGAAGACCATCAGCAAGGCCAAGGGCCAGCCTAGAAAGCCTCAGGTGTACACCCTGCCCCCTAGCAGAGACGAGCTGACCAAGAACCAGGTGTCCCTGACTTGCCTCGTGAAGGGCTTCTACCCCAGCGATATCGCCGTGGAGTGGGAATCTAACGGTCAGCCAGAGAACAACTACAAGACCACCCCCCCAGTGCTGGACAGCGACGGCAGCTTCTTCCTGTACAGCAAGCTGACCGTGGACAAAAGCCGCTGGCAGCAGGGCAACGTGTTCTCTTGCAGCGTGATGCACGAGGCCCTGCACAACCACTACACCCAGAAGAGCCTGAGCCTGAGCCCAGGAAAG

the nucleotide sequences of RB0021-S1 and RB0021-S2 light chain DNA are as follows:

GATGTGGTGATGACCCAGAGCCCCGACTCTCTGGCCGTGTCTCTGGGAGAGAGAGCCACCATCAACTGCAGATCCAGCCAGAGCCCCGAGCACAGCAACGGCAACACCTATCTGCACTGGTATCAGCAGAAGCCCGGCCAGCCTCCCAAGCTGCTGATCTACAAGGTGTCCAATAGATTCAGCGGCGTGCCCGACAGATTCAGCGGATCCGGCAGCGGCACCGATTTCACACTGACCATCAGCTCTCTGCAAGCCGAAGACGTGGCCGTGTACTTCTGCAGCCAAGGCACACACTTCCCTTTCACCTTCGGCCAAGGCACCAAGGTGGAGATTAAGAGAACCGTGGCCGCTCCTAGCGTGTTCATCTTCCCTCCCAGCGACGAGCAGCTGAAAAGCGGAACAGCCAGCGTCGTCTGCCTGCTGAATAACTTCTACCCCCGGGAGGCCAAAGTCCAGTGGAAAGTGGACAACGCCCTGCAGAGCGGAAACTCTCAGGAGAGCGTGACCGAGCAGGACAGCAAGGACAGCACCTACAGCCTGAGCAGCACACTGACCCTGAGCAAGGCCGACTACGAGAAGCACAAGGTGTACGCTTGCGAGGTCACACACCAGGGACTGTCTAGCCCAGTGACCAAGAGCTTCAACCGCGGCGAGTGTTGA

the nucleotide sequences of RB0021-S3 and RB0021-S4 light chain DNA are as follows:

GACGTGCAGATGACCCAGTCCCCTAGCAGCGTGAGCGCTTCCGTGGGAGACAGAGTGACCATCACATGCAGAAGCAGCCAGAGCCCCGAGCATAGCAACGGCAACACCTATCTGCACTGGTATCAGCAGAAGCCCGGCAAGGCCCCCAAGCTGCTCATCTACAAGGTGTCCAATAGATTCAGCGGCGTGCCCTCCAGATTCAGCGGATCCGGCAGCGGCACCGATTTCACACTGACCATCAGCTCTCTGCAGCCCGAGGACTTCGCCACCTACTTTTGCTCCCAAGGCACCCACTTCCCCTTCACCTTCGGCCAAGGCACCAAGGTGGAGATCAAGAGAACCGTGGCCGCTCCTAGCGTGTTCATCTTCCCTCCCAGCGACGAGCAGCTGAAAAGCGGAACAGCCAGCGTCGTCTGCCTGCTGAATAACTTCTACCCCCGGGAGGCCAAAGTCCAGTGGAAAGTGGACAACGCCCTGCAGAGCGGAAACTCTCAGGAGAGCGTGACCGAGCAGGACAGCAAGGACAGCACCTACAGCCTGAGCAGCACACTGACCCTGAGCAAGGCCGACTACGAGAAGCACAAGGTGTACGCTTGCGAGGTCACACACCAGGGACTGTCTAGCCCAGTGACCAAGAGCTTCAACCGCGGCGAGTGTTGA

binding different antibody nucleiThe nucleotide sequences are respectively cloned into pcDNA3.1 expression vectors, plasmids are extracted by a control endotoxin plasmid large extraction kit, and 293F cells are cultured by OPM-293 CD05 medium to prepare transfection. Cell counts the day before transfection, density 2.59 x 10⁶mL, viability 98.1%, cells were diluted to 1.5 x 10 with fresh medium⁶mL, continue culturing. Cells were counted on day of transfection at a density of 3.01 x 10⁶mL, viability 98.8%, dilution of cells with fresh medium to 2.78 x 10⁶and/mL. The transfection volume of 1/10 was selected from OPM-293 CD05 medium (Orpmey, cat 81075-001), the heavy and light chain plasmids were added at 1:1 to a transfection volume of 1.5. mu.g/mL, then 3 times the amount of the plasmid PEI was added, and the mixture was incubated at room temperature for 15 min. The incubation mixture was added to the treated cells and mixed well while adding. Culturing in shaking table at 37 deg.C under 90rpm and 8% CO₂. OPM-CHO PFF05 feed (Opumey, cat # FB1279-001) was added on the first and fourth days after transfection, respectively, and supernatants were collected on day 6 after transfection.

EXAMPLE 2 purification and detection of monoclonal antibodies

1. Affinity chromatography

The filler Mabselect Sure was rinsed with 0.5M NaOH rinse system, 0.1M NaOH rinse for 1 hour each to control endotoxin, and the filler was equilibrated with 20mM PB, 150mM NaCl (pH 7.2). RB0021 PC (Daratumumab), RB0021-S1, RB0021-S2, RB0021-S3 and RB0021-S4 transient expression supernatants are filtered and then loaded, the flow rate is controlled to be 1mL/min, after loading is finished, the supernatants are washed with 20mM PB and 150mM NaCl until the UV280 peak level changes, then washed with 20mM PB and 1M NaCl (pH6.5) until the peak level changes, finally eluted with 20mM Cit-Na3Cit (pH3.5), and neutralized with 1M Tris (pH 9.0).

2. Cation chromatography

The packing SP-HP was rinsed with 0.5M NaOH, 0.1M NaOH, endotoxin was controlled for 2 hours each treatment, and the packing was equilibrated with 20mM PB (pH 6.0). Adjusting the pH value of RB0021 PC (Daratumumab), RB0021-S1, RB0021-S2, RB0021-S3 and RB0021-S4 samples obtained by affinity chromatography to 6.0, diluting and adjusting the conductance to be less than 3 mu S/cm, carrying out sample loading, controlling the flow rate to be 1mL/min, washing the samples with 20mM PB (pH6.0) buffer solution to reach a UV280 base line after the sample loading is finished, carrying out linear gradient elution (0-30% B and 20CV) with 20mM PB and 1M NaCl (pH6.0), and collecting eluted samples according to peaks. The following table 2 is a data statistical table of the monoclonal antibodies finally obtained.

TABLE 2 statistics of monoclonal antibody data

As can be seen from Table 2, the monoclonal antibody with higher monomer quality and similar acid-base variants can be obtained under the condition of lower transient infection expression level compared with a control group, and the denaturation Temperature (TM) value of the monoclonal antibody obtained by the invention is higher than that of the control group, so that the monoclonal antibody has better thermal stability; meanwhile, the monoclonal antibody has higher isoelectric point, and is favorable for stable storage in a buffer solution.

3. Detection and analysis

Protein purity was analyzed by SDS-PAGE on 4-12% gradient gels and SEC-HPLC.

Wherein, FIG. 1 is a 4-12% gradient gel electrophoresis chart of monoclonal antibodies RB0021-S1, RB0021-S2, RB0021-S3 and RB0021-S4 SDS-PAGE, and FIGS. 2, 3, 4 and 5 are respectively RB0021-S1, RB0021-S2, RB0021-S3 and RB0021-S4 SEC-HPLC chromatograms. As can be seen from FIGS. 1 to 5, the electrophoresis patterns of RB0021-S1, RB0021-S2, RB0021-S3 and RB0021-S4 are single bands and single peaks, which indicates that the monoclonal antibody obtained by the present invention has a high expression level and contains few impurities.

The following table 3 shows the dispersion index of the monoclonal antibody obtained by SEC detection.

TABLE 3 Dispersion index of monoclonal antibodies

As shown in Table 3, the monoclonal antibody of the present invention has better dispersion index at three different concentrations, i.e., large, medium and small, compared with the control, indicating that it has better solution stability.

EXAMPLE 3 monoclonal antibody affinity assay

Biacore affinity assay with GE 8K, HBS-EP + as assay buffer, was performed at 25 deg.C, ligand was diluted to 5. mu.g/mL and immobilized on Protein A chips at a flow rate of 10. mu.L/min for 20 s. The analyte CD38 was gradient diluted to 0, 0.111, 0.333, 1, 3, 9(× 3), 27, 81nM flow rate 30 μ L/min, bound for 300s, dissociated for 300s, regenerated with 10mM Glycine-HCl (pH 1.5) flow rate 100 μ L/min for 30s, and repeated once. The measured affinity data are shown in table 4 below:

table 4 affinity data

Antibodies	affinity(human)
		RB0021 PC(Daratumumab)	8.86E-08
RB0021-S1	1.17E-09
		RB0021-S2	1.17E-09
RB0021-S3	1.04E-09
		RB0021-S4	1.04E-09

As can be seen from Table 4 above, the monoclonal antibody of the present invention can specifically recognize human CD38 protein, and has better affinity for CD38 protein than the control monoclonal antibody.

Example 4 binding to cell surface antigens

Daudi cells cultured in RPMI1640+ 10% FBS medium were added to a 96-well plate, the supernatant was discarded, 100 μ L/well gradient diluted antibody resuspended cell pellet (RB 0021 PC as positive control and Isotype control as negative control) was added, incubation was performed at 2-8 ℃ for 1 hour, the supernatant was discarded, 100 μ L/well pre-diluted secondary antibody (FITC) resuspended cells were added, and incubation was performed at 2-8 ℃ for 0.5 hour and then detected on a flow cytometer.

TABLE 5 binding data to cell surface antigens

As shown in Table 5, the monoclonal antibody of the present invention has a better ability to bind to the cell surface CD38 antigen.

Example 5 antibody-dependent cell-mediated cytotoxicity (ADCC) Activity

1 x 10 of⁵NCI-H929 cells were added to 96-well plates, 40. mu.L of antibody (RB 0021 PC as positive control, Isotype control as negative control) diluted in a gradient was added, 37 ℃ C., 5% CO₂Incubating for 1 hour; then 2 x 10⁵Jurkat-Lucia-NFAT-CD16 cells were added to 96-well plates. 37 ℃ and 5% CO₂After 6 hours of incubation, 50. mu.L of Quanti-LUC was added, and the fluorescence signal was read after 5 minutes of reaction at room temperature.

TABLE 6 ADCC Activity assay data

Sample ID	EC50(μg/mL)	Top MFI
			RB0021 PC(Daratumumab)	0.017	57161
RB0021-S1	0.018	65759
			RB0021-S2	0.011	45150
RB0021-S3	0.011	47332
			RB0021-S4	0.014	56729
Istype Control	0.375	2118

As can be seen from Table 6, the values of the monoclonal antibodies RB0021-S2, RB0021-S3 and RB0021-S4 EC50 of the invention are obviously lower than those of the control group, and the values of RB0021-S1 EC50 are basically the same as those of the control group, which shows that the ADCC activities of the monoclonal antibodies RB0021-S2, RB0021-S3 and RB0021-S4 EC50 of the invention are better than those of the control group, and the ADCC activities of RB0021-S1 are similar to those of the control group. Therefore, the monoclonal antibody of the present invention has an effective ADCC activity.

Example 6 Complement Dependent Cytotoxic (CDC) Activity

Daudi cells cultured in RPMI1640+ 10% FBS medium were added to a 96-well plate, 40. mu.L of the antibody diluted in a gradient was added, and 40. mu.L of the previously diluted complement was added at 37 ℃ and 5% CO₂The culture was carried out for 6 hours. RB0021 PC (Daratumumab) is used as positive control, Isotype control is used as negative control, and Cell Titer-Glo is used^TMReagent detects cell killing.

TABLE 7 CDC Activity assay data

As can be seen from Table 7, the monoclonal antibodies RB0021-S2 and RB0021-S4 of the present invention are significantly superior to the control group in complement-dependent cytotoxic activity (CDC) activity against Daudi cells.

Example 7 in vivo Activity assay

1 x 10 of⁷one/mL NCI-H929 cell, equal volume of mixed matrigel, 0.2 mL/only inoculated in 5-6 weeks NOD/SCID mice right side axillary subcutaneous. Mean tumor volume of 150mm³On the left and right sides, tumor-bearing animals with vigorous tumor growth, no rupture and good health condition were selected for grouping and administration was started. Mice were divided into 11 groups (N ═ 13) so that the mean tumor size was similar for all groups, and dosing was initiated by tail vein injection (day 0) twice weekly. Group 1 (FIGS. 11G1-22, G1-32, G1-47, G1-48, G1-73, G1-93) received 45mg/kg of negative control antibody twice weekly; group 2 (FIGS. 11G2-9, G2-10, G2-39, G2-74, G2-88, G2-92) received 5mg/kg of positive control antibody (Daratumumab) twice weekly; group 3 (FIGS. 11G3-36, G3-38, G3-76, G3-77, G3-85, G3-86) received 45mg/kg of positive control antibody (Daratumumab) twice weekly. Group 4 (FIGS. 11G4-1, G4-17, G4-43, G4-64, G4-66, G4-82) Receiving 5mg/kg of RB0021-S1 antibody twice weekly; group 5 (FIGS. 11G5-3, G5-4, G5-19, G5-30, G5-44, G5-91) received 45mg/kg of RB0021-S1 antibody twice a week. Group 6 (FIGS. 11G6-5, G6-50, G6-51, G6-60, G6-80, G6-100) received 5mg/kg of RB0021-S2 antibody administered twice weekly; group 7 (FIGS. 11G7-6, G7-18, G7-23, G7-28, G7-67, G7-75) received 45mg/kg of RB0021-S2 antibody twice a week. Group 8 (FIGS. 11G8-27, G8-40, G8-54, G8-55, G8-57, G8-78) received 5mg/kg of RB0021-S3 antibody twice weekly; group 9 (FIGS. 11G9-21, G9-24, G9-37, G9-83, G9-84, G9-90) received 45mg/kg of RB0021-S3 antibody twice weekly. Group 10 (FIGS. 11G10-16, G10-42, G10-61, G10-63, G10-69, G10-79) received 5mg/kg of RB0021-S4 antibody twice weekly; group 11 (FIGS. 11G11-7, G11-12, G11-13, G11-26, G11-70, G11-81) received 45mg/kg of RB0021-S4 antibody twice weekly. Tumor volumes at different time points were determined using the formula: tumor volume (mm)³) 1/2 × long diameter × short diameter²The anti-tumor efficacy is judged according to the growth condition of the tumor. Body weight was measured twice a week to monitor toxicity, all treatments were well tolerated.

The inhibition effect of different treatments on tumor growth is different, fig. 9 is the statistical result of the average tumor volume of the mice, fig. 10 is the statistical result of the average tumor weight of the mice, and as can be seen from fig. 9 and fig. 10, the anti-CD 38 monoclonal antibody of the present invention shows potent anti-tumor efficacy in vivo, which is superior to that of the control monoclonal antibody, wherein the groups of RB0021-S1 antibody and RB0021-S4 antibody given 45mg/kg can significantly inhibit tumor growth (P < 0.05).

The above-mentioned embodiments only express several embodiments of the present invention, and the description thereof is more specific and detailed, but not construed as limiting the scope of the present invention. It should be noted that, for a person skilled in the art, several variations and modifications can be made without departing from the inventive concept, which falls within the scope of the present invention. Therefore, the protection scope of the present patent shall be subject to the appended claims.

Sequence listing

<110> Ruiyang (Suzhou) Biotechnology Ltd

<120> anti-human CD38 humanized monoclonal antibody and application thereof

<130> 20200813

<160> 16

<170> SIPOSequenceListing 1.0

<210> 1

<211> 5

<212> PRT

<213> Artificial sequence (artificial sequence)

<400> 1

Ser His Gly Ile Asn

1 5

<210> 2

<211> 17

<212> PRT

<213> Artificial sequence (artificial sequence)

<400> 2

Tyr Ile Tyr Ile Gly Asn Gly Tyr Thr Glu Tyr Asn Glu Lys Phe Lys

1 5 10 15

Gly

<210> 3

<211> 11

<212> PRT

<213> Artificial sequence (artificial sequence)

<400> 3

Ser His Tyr Asp Ser Ser Ser Trp Phe Ala Tyr

1 5 10

<210> 4

<211> 16

<212> PRT

<213> Artificial sequence (artificial sequence)

<400> 4

Arg Ser Ser Gln Ser Pro Glu His Ser Asn Gly Asn Thr Tyr Leu His

1 5 10 15

<210> 5

<211> 7

<212> PRT

<213> Artificial sequence (artificial sequence)

<400> 5

Lys Val Ser Asn Arg Phe Ser

1 5

<210> 6

<211> 9

<212> PRT

<213> Artificial sequence (artificial sequence)

<400> 6

Ser Gln Gly Thr His Phe Pro Phe Thr

1 5

<210> 7

<211> 120

<212> PRT

<213> Artificial sequence (artificial sequence)

<400> 7

Gln Val Thr Leu Lys Glu Ser Gly Pro Thr Leu Val Lys Pro Thr Gln

1 5 10 15

Thr Leu Thr Leu Thr Cys Thr Thr Ser Gly Tyr Thr Phe Thr Ser His

20 25 30

Gly Ile Asn Trp Val Arg Gln Pro Pro Gly Lys Ala Leu Glu Trp Ile

35 40 45

Gly Tyr Ile Tyr Ile Gly Asn Gly Tyr Thr Glu Tyr Asn Glu Lys Phe

50 55 60

Lys Gly Arg Ala Thr Leu Thr Ser Asp Thr Ser Lys Asn Gln Ala Val

65 70 75 80

Leu Thr Met Thr Asn Met Asp Pro Val Asp Thr Ala Thr Tyr Phe Cys

85 90 95

Ala Arg Ser His Tyr Asp Ser Ser Ser Trp Phe Ala Tyr Trp Gly Gln

100 105 110

Gly Thr Leu Val Thr Val Ser Ser

115 120

<210> 8

<211> 120

<212> PRT

<213> Artificial sequence (artificial sequence)

<400> 8

Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ser

1 5 10 15

Ser Val Lys Val Ser Cys Lys Thr Ser Gly Tyr Thr Phe Thr Ser His

20 25 30

Gly Ile Asn Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Ile

35 40 45

Gly Tyr Ile Tyr Ile Gly Asn Gly Tyr Thr Glu Tyr Asn Glu Lys Phe

50 55 60

Lys Gly Arg Ala Thr Leu Thr Ser Asp Thr Ser Thr Ser Thr Ala Tyr

65 70 75 80

Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Phe Cys

85 90 95

Ala Arg Ser His Tyr Asp Ser Ser Ser Trp Phe Ala Tyr Trp Gly Gln

100 105 110

Gly Thr Leu Val Thr Val Ser Ser

115 120

<210> 9

<211> 113

<212> PRT

<213> Artificial sequence (artificial sequence)

<400> 9

Asp Val Val Met Thr Gln Ser Pro Asp Ser Leu Ala Val Ser Leu Gly

1 5 10 15

Glu Arg Ala Thr Ile Asn Cys Arg Ser Ser Gln Ser Pro Glu His Ser

20 25 30

Asn Gly Asn Thr Tyr Leu His Trp Tyr Gln Gln Lys Pro Gly Gln Pro

35 40 45

Pro Lys Leu Leu Ile Tyr Lys Val Ser Asn Arg Phe Ser Gly Val Pro

50 55 60

Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile

65 70 75 80

Ser Ser Leu Gln Ala Glu Asp Val Ala Val Tyr Phe Cys Ser Gln Gly

85 90 95

Thr His Phe Pro Phe Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys

100 105 110

Arg

<210> 10

<211> 113

<212> PRT

<213> Artificial sequence (artificial sequence)

<400> 10

Asp Val Gln Met Thr Gln Ser Pro Ser Ser Val Ser Ala Ser Val Gly

1 5 10 15

Asp Arg Val Thr Ile Thr Cys Arg Ser Ser Gln Ser Pro Glu His Ser

20 25 30

Asn Gly Asn Thr Tyr Leu His Trp Tyr Gln Gln Lys Pro Gly Lys Ala

35 40 45

Pro Lys Leu Leu Ile Tyr Lys Val Ser Asn Arg Phe Ser Gly Val Pro

50 55 60

Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile

65 70 75 80

Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr Phe Cys Ser Gln Gly

85 90 95

Thr His Phe Pro Phe Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys

100 105 110

Arg

<210> 11

<211> 450

<212> PRT

<213> Artificial sequence (artificial sequence)

<400> 11

Gln Val Thr Leu Lys Glu Ser Gly Pro Thr Leu Val Lys Pro Thr Gln

1 5 10 15

Thr Leu Thr Leu Thr Cys Thr Thr Ser Gly Tyr Thr Phe Thr Ser His

20 25 30

Gly Ile Asn Trp Val Arg Gln Pro Pro Gly Lys Ala Leu Glu Trp Ile

35 40 45

Gly Tyr Ile Tyr Ile Gly Asn Gly Tyr Thr Glu Tyr Asn Glu Lys Phe

50 55 60

Lys Gly Arg Ala Thr Leu Thr Ser Asp Thr Ser Lys Asn Gln Ala Val

65 70 75 80

Leu Thr Met Thr Asn Met Asp Pro Val Asp Thr Ala Thr Tyr Phe Cys

85 90 95

Ala Arg Ser His Tyr Asp Ser Ser Ser Trp Phe Ala Tyr Trp Gly Gln

100 105 110

Gly Thr Leu Val Thr Val Ser Ser Ala Ser Thr Lys Gly Pro Ser Val

115 120 125

Phe Pro Leu Ala Pro Ser Ser Lys Ser Thr Ser Gly Gly Thr Ala Ala

130 135 140

Leu Gly Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro Val Thr Val Ser

145 150 155 160

Trp Asn Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe Pro Ala Val

165 170 175

Leu Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val Thr Val Pro

180 185 190

Ser Ser Ser Leu Gly Thr Gln Thr Tyr Ile Cys Asn Val Asn His Lys

195 200 205

Pro Ser Asn Thr Lys Val Asp Lys Lys Val Glu Pro Lys Ser Cys Asp

210 215 220

Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly Gly

225 230 235 240

Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile

245 250 255

Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser His Glu

260 265 270

Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val His

275 280 285

Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg

290 295 300

Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys

305 310 315 320

Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu

325 330 335

Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr

340 345 350

Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gln Val Ser Leu

355 360 365

Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp

370 375 380

Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val

385 390 395 400

Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp

405 410 415

Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met His

420 425 430

Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro

435 440 445

Gly Lys

450

<210> 12

<211> 450

<212> PRT

<213> Artificial sequence (artificial sequence)

<400> 12

Gln Val Thr Leu Lys Glu Ser Gly Pro Thr Leu Val Lys Pro Thr Gln

1 5 10 15

Thr Leu Thr Leu Thr Cys Thr Thr Ser Gly Tyr Thr Phe Thr Ser His

20 25 30

Gly Ile Asn Trp Val Arg Gln Pro Pro Gly Lys Ala Leu Glu Trp Ile

35 40 45

Gly Tyr Ile Tyr Ile Gly Asn Gly Tyr Thr Glu Tyr Asn Glu Lys Phe

50 55 60

Lys Gly Arg Ala Thr Leu Thr Ser Asp Thr Ser Lys Asn Gln Ala Val

65 70 75 80

Leu Thr Met Thr Asn Met Asp Pro Val Asp Thr Ala Thr Tyr Phe Cys

85 90 95

Ala Arg Ser His Tyr Asp Ser Ser Ser Trp Phe Ala Tyr Trp Gly Gln

100 105 110

Gly Thr Leu Val Thr Val Ser Ser Ala Ser Thr Lys Gly Pro Ser Val

115 120 125

Phe Pro Leu Ala Pro Ser Ser Lys Ser Thr Ser Gly Gly Thr Ala Ala

130 135 140

Leu Gly Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro Val Thr Val Ser

145 150 155 160

Trp Asn Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe Pro Ala Val

165 170 175

Leu Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val Thr Val Pro

180 185 190

Ser Ser Ser Leu Gly Thr Gln Thr Tyr Ile Cys Asn Val Asn His Lys

195 200 205

Pro Ser Asn Thr Lys Val Asp Lys Lys Val Glu Pro Lys Ser Cys Asp

210 215 220

Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly Gly

225 230 235 240

Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile

245 250 255

Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser His Glu

260 265 270

Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val His

275 280 285

Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg

290 295 300

Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys

305 310 315 320

Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu

325 330 335

Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Lys Pro Gln Val Tyr

340 345 350

Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gln Val Ser Leu

355 360 365

Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp

370 375 380

Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val

385 390 395 400

Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp

405 410 415

Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met His

420 425 430

Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro

435 440 445

Gly Lys

450

<210> 13

<211> 450

<212> PRT

<213> Artificial sequence (artificial sequence)

<400> 13

Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ser

1 5 10 15

Ser Val Lys Val Ser Cys Lys Thr Ser Gly Tyr Thr Phe Thr Ser His

20 25 30

Gly Ile Asn Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Ile

35 40 45

Gly Tyr Ile Tyr Ile Gly Asn Gly Tyr Thr Glu Tyr Asn Glu Lys Phe

50 55 60

Lys Gly Arg Ala Thr Leu Thr Ser Asp Thr Ser Thr Ser Thr Ala Tyr

65 70 75 80

Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Phe Cys

85 90 95

Ala Arg Ser His Tyr Asp Ser Ser Ser Trp Phe Ala Tyr Trp Gly Gln

100 105 110

Gly Thr Leu Val Thr Val Ser Ser Ala Ser Thr Lys Gly Pro Ser Val

115 120 125

Phe Pro Leu Ala Pro Ser Ser Lys Ser Thr Ser Gly Gly Thr Ala Ala

130 135 140

Leu Gly Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro Val Thr Val Ser

145 150 155 160

Trp Asn Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe Pro Ala Val

165 170 175

Leu Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val Thr Val Pro

180 185 190

Ser Ser Ser Leu Gly Thr Gln Thr Tyr Ile Cys Asn Val Asn His Lys

195 200 205

Pro Ser Asn Thr Lys Val Asp Lys Lys Val Glu Pro Lys Ser Cys Asp

210 215 220

Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly Gly

225 230 235 240

Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile

245 250 255

Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser His Glu

260 265 270

Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val His

275 280 285

Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg

290 295 300

Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys

305 310 315 320

Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu

325 330 335

Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr

340 345 350

Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gln Val Ser Leu

355 360 365

Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp

370 375 380

Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val

385 390 395 400

Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp

405 410 415

Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met His

420 425 430

Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro

435 440 445

Gly Lys

450

<210> 14

<211> 450

<212> PRT

<213> Artificial sequence (artificial sequence)

<400> 14

Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ser

1 5 10 15

Ser Val Lys Val Ser Cys Lys Thr Ser Gly Tyr Thr Phe Thr Ser His

20 25 30

Gly Ile Asn Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Ile

35 40 45

Gly Tyr Ile Tyr Ile Gly Asn Gly Tyr Thr Glu Tyr Asn Glu Lys Phe

50 55 60

Lys Gly Arg Ala Thr Leu Thr Ser Asp Thr Ser Thr Ser Thr Ala Tyr

65 70 75 80

Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Phe Cys

85 90 95

Ala Arg Ser His Tyr Asp Ser Ser Ser Trp Phe Ala Tyr Trp Gly Gln

100 105 110

Gly Thr Leu Val Thr Val Ser Ser Ala Ser Thr Lys Gly Pro Ser Val

115 120 125

Phe Pro Leu Ala Pro Ser Ser Lys Ser Thr Ser Gly Gly Thr Ala Ala

130 135 140

Leu Gly Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro Val Thr Val Ser

145 150 155 160

Trp Asn Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe Pro Ala Val

165 170 175

Leu Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val Thr Val Pro

180 185 190

Ser Ser Ser Leu Gly Thr Gln Thr Tyr Ile Cys Asn Val Asn His Lys

195 200 205

Pro Ser Asn Thr Lys Val Asp Lys Lys Val Glu Pro Lys Ser Cys Asp

210 215 220

Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly Gly

225 230 235 240

Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile

245 250 255

Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser His Glu

260 265 270

Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val His

275 280 285

Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg

290 295 300

Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys

305 310 315 320

Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu

325 330 335

Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Lys Pro Gln Val Tyr

340 345 350

Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gln Val Ser Leu

355 360 365

Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp

370 375 380

Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val

385 390 395 400

Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp

405 410 415

Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met His

420 425 430

Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro

435 440 445

Gly Lys

450

<210> 15

<211> 219

<212> PRT

<213> Artificial sequence (artificial sequence)

<400> 15

Asp Val Val Met Thr Gln Ser Pro Asp Ser Leu Ala Val Ser Leu Gly

1 5 10 15

Glu Arg Ala Thr Ile Asn Cys Arg Ser Ser Gln Ser Pro Glu His Ser

20 25 30

Asn Gly Asn Thr Tyr Leu His Trp Tyr Gln Gln Lys Pro Gly Gln Pro

35 40 45

Pro Lys Leu Leu Ile Tyr Lys Val Ser Asn Arg Phe Ser Gly Val Pro

50 55 60

Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile

65 70 75 80

Ser Ser Leu Gln Ala Glu Asp Val Ala Val Tyr Phe Cys Ser Gln Gly

85 90 95

Thr His Phe Pro Phe Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys

100 105 110

Arg Thr Val Ala Ala Pro Ser Val Phe Ile Phe Pro Pro Ser Asp Glu

115 120 125

Gln Leu Lys Ser Gly Thr Ala Ser Val Val Cys Leu Leu Asn Asn Phe

130 135 140

Tyr Pro Arg Glu Ala Lys Val Gln Trp Lys Val Asp Asn Ala Leu Gln

145 150 155 160

Ser Gly Asn Ser Gln Glu Ser Val Thr Glu Gln Asp Ser Lys Asp Ser

165 170 175

Thr Tyr Ser Leu Ser Ser Thr Leu Thr Leu Ser Lys Ala Asp Tyr Glu

180 185 190

Lys His Lys Val Tyr Ala Cys Glu Val Thr His Gln Gly Leu Ser Ser

195 200 205

Pro Val Thr Lys Ser Phe Asn Arg Gly Glu Cys

210 215

<210> 16

<211> 219

<212> PRT

<213> Artificial sequence (artificial sequence)

<400> 16

Asp Val Gln Met Thr Gln Ser Pro Ser Ser Val Ser Ala Ser Val Gly

1 5 10 15

Asp Arg Val Thr Ile Thr Cys Arg Ser Ser Gln Ser Pro Glu His Ser

20 25 30

Asn Gly Asn Thr Tyr Leu His Trp Tyr Gln Gln Lys Pro Gly Lys Ala

35 40 45

Pro Lys Leu Leu Ile Tyr Lys Val Ser Asn Arg Phe Ser Gly Val Pro

50 55 60

Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile

65 70 75 80

Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr Phe Cys Ser Gln Gly

85 90 95

Thr His Phe Pro Phe Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys

100 105 110

Arg Thr Val Ala Ala Pro Ser Val Phe Ile Phe Pro Pro Ser Asp Glu

115 120 125

Gln Leu Lys Ser Gly Thr Ala Ser Val Val Cys Leu Leu Asn Asn Phe

130 135 140

Tyr Pro Arg Glu Ala Lys Val Gln Trp Lys Val Asp Asn Ala Leu Gln

145 150 155 160

Ser Gly Asn Ser Gln Glu Ser Val Thr Glu Gln Asp Ser Lys Asp Ser

165 170 175

Thr Tyr Ser Leu Ser Ser Thr Leu Thr Leu Ser Lys Ala Asp Tyr Glu

180 185 190

Lys His Lys Val Tyr Ala Cys Glu Val Thr His Gln Gly Leu Ser Ser

195 200 205

Pro Val Thr Lys Ser Phe Asn Arg Gly Glu Cys

210 215

Claims

1. A monoclonal antibody that binds to CD38 protein, wherein the monoclonal antibody that binds to CD38 protein comprises:

2. The monoclonal antibody of claim 1, wherein the monoclonal antibody comprises:

3. The monoclonal antibody of claim 1 or2, wherein the monoclonal antibody comprises:

4. The monoclonal antibody of claim 3, wherein the monoclonal antibody comprises:

5. A nucleic acid molecule encoding the monoclonal antibody of any one of claims 1-4.

6. A vector comprising the nucleic acid molecule of claim 5.

7. A cell comprising or producing the monoclonal antibody of any one of claims 1-4.

8. Use of the monoclonal antibody of any one of claims 1-4, the nucleic acid molecule of claim 5, the vector of claim 6, and the cell of claim 7 in the manufacture of a medicament, kit, and/or device for the prevention and/or treatment of a CD 38-positive disease or disorder.

9. The use according to claim 8, wherein the CD38 positive disease or disorder is an immunological disease and/or a hematological neoplasm.

10. The use of claim 9, wherein the hematological neoplasm is multiple myeloma.