CN114045358A - Primer composition for detecting twelve potato disease pathogenic bacteria based on loop-mediated isothermal amplification technology and detection method - Google Patents
Primer composition for detecting twelve potato disease pathogenic bacteria based on loop-mediated isothermal amplification technology and detection method Download PDFInfo
- Publication number
- CN114045358A CN114045358A CN202111203360.8A CN202111203360A CN114045358A CN 114045358 A CN114045358 A CN 114045358A CN 202111203360 A CN202111203360 A CN 202111203360A CN 114045358 A CN114045358 A CN 114045358A
- Authority
- CN
- China
- Prior art keywords
- bip
- fip
- primer
- detection
- fusarium
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Health & Medical Sciences (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Biophysics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Botany (AREA)
- Mycology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a primer composition for detecting twelve potato disease pathogenic bacteria based on a loop-mediated isothermal amplification technology and a detection method. The method is a molecular detection method for phytophthora infestans, alternaria alternata, fusarium oxysporum, fusarium equiseti, fusarium graminearum, fusarium laminarinum, fusarium sambucus, rhizoctonia solani, ralstonia solanacearum, fusarium solani, streptomyces and eschar pulcherrima. The method of the invention does not need complex instruments, can better meet the field detection of 12 potato disease pathogenic bacteria, provides a new technical platform for the detection of quarantine pathogenic bacteria, can better meet the urgent need of the field detection of potato diseases at present, is used for the field detection of import and export quarantine, field quarantine and the like, and is easy to popularize and apply in a large range.
Description
Technical Field
The invention particularly relates to a primer composition for detecting twelve potato disease pathogenic bacteria by using a color-determination-based loop-mediated isothermal amplification (LAMP) technology and a detection method, belonging to the technical field of biology. Is specially used for important potato disease pathogenic bacteria in the field: phytophthora infestans (Phytophthora infestans), Alternaria (Alternaria solani), Fusarium oxysporum (Fusarium oxysporum), Fusarium equiseti (Fusarium equiseti), Fusarium graminearum (Fusarium graminearum), Fusarium proliferatum (Fusarium proliferatum), Fusarium sambucinum (Fusarium sambucinum), Rhizoctonia solani (Rhizoctonia solani), Raltonia solani (Raltonia solanacerum), Fusarium nigrum (Pectobacterium nigrum), Streptomyces nigrospermis (Pectobacterium atrosepticum), Streptomyces scabiosus (Streptomyces scabies), and high-sensitivity rapid detection of Sporotaria scab (Spongospora subranea) can be used for both early diagnosis of potato diseases in the field and monitoring of pathogenic bacteria.
Background
The potato diseases are caused by the fact that potatoes are infected by various pathogenic fungi and oomycetes, and the production of the potatoes is seriously damaged. The main causative agents of potato diseases are Phytophthora infestans (Phytophthora infestans), Alternaria alternata (Alternaria solani), Fusarium oxysporum (Fusarium oxysporum), Fusarium equiseti (Fusarium equiseti), Fusarium graminearum (Fusarium graminearum), Fusarium solani (Fusarium proliferatum), Fusarium sambucinum (Fusarium sambucinum), Rhizoctonia solani (Rhizoctonia solani), Ralstonia solani (Ralstonia solanaceum), Fusarium solani (solanaceum), Streptomyces atropisum (Streptomyces), scab sp (spongosorosea), and the like. Potato diseases caused by the above pathogenic bacteria include: potato late blight, potato early blight, potato wilt, potato dry rot, potato black nevus, potato bacterial wilt, potato black shank, potato scab, potato powdery scab, etc. These diseases are widespread and highly harmful, often resulting in severe losses in agricultural production. The pathogenic bacteria can be accurately detected in time, which is beneficial to the rapid diagnosis of diseases and the timely guidance of prevention and treatment.
The traditional method for detecting various pathogenic bacteria is to separate and purify the pathogenic bacteria. The traditional method plays an important role in pathogen detection, but is time-consuming and labor-consuming, and requires operators to have professional pathogen separation, morphological identification knowledge and rich experience. With the development of nucleic acid-related identification methods, PCR-based methods have been successfully used for detecting pathogenic bacteria, although the specificity and sensitivity of PCR methods are greatly improved, the detection time is still long, about 4-5 h, and the PCR methods rely on precise temperature cycling devices. The detection sensitivity is high, but the detection process is complex, and the requirement of rapid detection cannot be met.
Loop-mediated isothermal amplification (LAMP) is a novel nucleic acid amplification technology invented by the Rongji Kabushiki Kaisha in Japan, and becomes a novel nucleic acid amplification technology capable of replacing PCR because of the advantages of simple operation, rapidness, high specificity, low cost and the like. It designs 4 specific primers aiming at 6 regions of a target gene, causes self-circulation strand displacement reaction under the action of Bst large-fragment polymerase, and generates a byproduct, namely white magnesium pyrophosphate precipitate while synthesizing a large amount of target DNA within 60-65 ℃ within 60 min. The LAMP amplification process depends on 6 independent areas for identifying the target sequence, so the reaction specificity is very strong, the nucleic acid amplification process is carried out under the constant temperature condition, a common water bath or equipment with a stable heat source can meet the reaction requirement, and the detection cost is greatly reduced.
The selection of target genes is one of the important factors for LAMP detection. The invention analyzes the difference of target genes in different species and among different species of phytophthora infestans, alternaria alternata, fusarium oxysporum, fusarium equiseti, fusarium graminearum, fusarium laminarinum, fusarium sambucinum, rhizoctonia solani, ralstonia solanacearum, fusarium solani, streptomyces and eschar, designs specific LAMP primers, and establishes an LAMP system for detecting phytophthora infestans on the basis.
Disclosure of Invention
The invention aims to solve the problems that the biological detection method for common potato disease pathogenic bacteria needs long period, wastes time and labor, is complicated and has poor specificity in the prior art and the PCR detection technology needs a thermal cycler and cannot rapidly detect each potato disease pathogenic bacteria, and provides an LAMP primer composition, a kit and a visual detection method for detecting twelve potato disease pathogenic bacteria. The method is a new molecular detection method for phytophthora infestans, alternaria alternata, fusarium oxysporum, fusarium equiseti, fusarium graminearum, fusarium laminarinum, fusarium sambucinum, rhizoctonia solani, ralstonia solanacearum, fusarium solani, streptomyces and eschar pulcherrima, performs LAMP detection on the twelve pathogenic bacteria, and has the advantages of short detection period (only 1h), high accuracy, high sensitivity and visual inspection of detection results.
The purpose of the invention can be realized by the following technical scheme:
a LAMP primer composition for detecting twelve types of potato disease pathogenic bacteria, which comprises at least one of the following primer sets (1) to (12):
(1) phytophthora infestans detection primer sets (F3, B3, FIP, BIP, LB);
(2) a primer group for detecting Alternaria alternata (F3, B3, FIP, BIP, LF);
(3) fusarium oxysporum detection primer sets (F3, B3, FIP, BIP, LF);
(4) a fusarium equiseti detection primer group (F3, B3, FIP, BIP, LF and LB);
(5) fusarium graminearum detection primer sets (F3, B3, FIP, BIP, LF, LB);
(6) detecting primer groups (F3, B3, FIP, BIP, LF and LB) of the layered fusarium;
(7) fusarium sambucinum detection primer set (F3, B3, FIP, BIP, LF);
(8) a rhizoctonia solani detection primer group (F3, B3, FIP, BIP, LB);
(9) a detection primer group (F3, B3, FIP, BIP, LF and LB) for the ralstonia solanacearum;
(10) a primer group for detecting the black rot fruit jelly bacillus (F3, B3, FIP, BIP, LF and LB);
(11) a streptomycete detection primer group (F3, B3, FIP, BIP and LB);
(12) a callus detection primer group (F3, B3, FIP, BIP, LF and LB);
wherein the content of the first and second substances,
(1) the LAMP molecular detection primer group for phytophthora infestans consists of five specific primers FIP, BIP, F3, B3 and LB:
(2) the primer group for LAMP molecular detection of Alternaria alternata consists of five specific primers FIP, BIP, F3, B3 and LF:
(3) the fusarium oxysporum LAMP molecular detection primer group consists of five specific primers FIP, BIP, F3, B3 and LF:
(4) the primer group for detecting the LAMP molecules of the fusarium equiseti consists of six specific primers FIP, BIP, F3, B3, LF and LB:
(5) the fusarium graminearum LAMP molecular detection primer group consists of six specific primers FIP, BIP, F3, B3, LF and LB:
(6) the LAMP molecular detection primer group of the layered fusarium consists of six specific primers FIP, BIP, F3, B3, LF and LB:
(7) the LAMP molecular detection primer group of the fusarium sambuci consists of five specific primers FIP, BIP, F3, B3 and LF:
(8) the LAMP molecular detection primer group of the rhizoctonia solani consists of five specific primers FIP, BIP, F3, B3 and LB:
(9) the LAMP molecular detection primer group of the Ralstonia solanacearum consists of six specific primers FIP, BIP, F3, B3, LF and LB:
(10) the LAMP molecular detection primer group of the black rot fruit jelly bacillus consists of six specific primers FIP, BIP, F3, B3, LF and LB:
(11) the streptomycete LAMP molecular detection primer group consists of five specific primers FIP, BIP, F3, B3 and LB:
(12) the Elsinoe farinosa LAMP molecular detection primer group consists of six specific primers FIP, BIP, F3, B3, LF and LB:
the invention selects Ypt1 sequence of phytophthora infestans, Alt a1 sequence of alternaria alternata, TEF-1 alpha sequence of fusarium oxysporum, TEF-1 alpha sequence of fusarium equiseti, TEF-1 alpha sequence of fusarium graminearum, RED1 sequence of fusarium exuberculosum, TEF-1 alpha sequence of fusarium sambucinum, ITS sequence of solanum solani, 16S rRNA sequence of ralstonia solani, gryB sequence of fusarium solani, Nec1 sequence of streptomycete and ITS sequence of eschar pulcherrima as target genes to design LAMP molecular detection primer sets of twelve potato diseases (the sequences of all target genes of the twelve potato disease pathogenic bacteria are disclosed);
specific primers FIP, BIP, F3, B3, LB for the Ypt1 sequence of Phytophthora infestans are designed as shown in FIG. 3;
specific primers FIP, BIP, F3, B3 and LF for Alt a1 sequence of Alt a of Alternaria alternata are designed as shown in FIG. 4;
specific primers FIP, BIP, F3, B3 and LF designed for the TEF-1 alpha sequence of Fusarium oxysporum are shown in figure 5;
specific primers FIP, BIP, F3, B3, LF and LB aiming at the TEF-1 alpha sequence of fusarium equiseti are designed as shown in figure 6;
specific primers FIP, BIP, F3, B3, LF and LB for the TEF-1 alpha sequence of Fusarium graminearum are designed as shown in figure 7;
specific primers FIP, BIP, F3, B3, LF and LB for the RED1 sequence of Fusarium proliferatum are designed as shown in FIG. 8;
specific primers FIP, BIP, F3, B3 and LF designed for TEF-1 alpha sequence of Fusarium sambucinum are shown in figure 9;
the design of specific primers FIP, BIP, F3, B3 and LB aiming at ITS sequence of Rhizoctonia solani is shown in figure 10;
specific primers FIP, BIP, F3, B3, LF and LB designed for 16S rRNA sequence of Ralstonia solanacearum are shown in figure 11;
specific primers FIP, BIP, F3, B3, LF and LB designed for gryB sequence of Pythium gracile are shown in FIG. 12;
specific primers FIP, BIP, F3, B3 and LB designed for the Nec1 sequence of Streptomyces are shown in FIG. 13;
specific primers FIP, BIP, F3, B3, LF and LB for the ITS sequence of eschar chalcogramma were designed as shown in FIG. 14.
The LAMP primer composition is applied to detection of twelve potato disease pathogenic bacteria.
The LAMP primer composition is applied to preparation of a kit for detecting twelve potato disease pathogenic bacteria.
A LAMP kit for detecting twelve potato disease pathogenic bacteria comprises the LAMP primer composition.
As a preferred technical scheme, the reaction system of the kit is as follows:
1mL of assay solution comprises: 20 μ M forward inner primer FIP, 20 μ M reverse inner primer BIP, 10 μ M forward outer primer F3, 10 μ M reverse outer primer B3, 10 μ M forward loop primer LF, 10 μ M reverse loop primer LB, 10 XBuffer, 10mM dNTPs, 50mM MgSO45M betaine, Bst DNA polymerase 8U/. mu.L, and ultrapure water was added thereto to prepare 1mL of a detection solution. The shelf life was 1 year.
The LAMP kit is applied to detection of twelve potato disease pathogenic bacteria.
The LAMP kit is adopted to carry out LAMP reaction, and the LAMP reaction program is as follows: 70min at 62 ℃; detection of the amplification product: adding SYBR Green I (fluorescent dye) into a product after constant-temperature amplification as a reaction indicator, and taking the color change of the fluorescent dye as a result judgment standard; the yellow green indicates that the detection is positive, target pathogenic bacteria exist, and the orange yellow indicates that the detection result is negative.
The method for detecting twelve potato disease pathogens by using the LAMP detection kit specifically comprises the following steps:
(1) LAMP detection of twelve potato disease pathogenic bacteria: adding 18 mu L of kit solution and 3 mu L of sterilized deionized water into 4 mu L of DNA solution, wherein the total volume is 25 mu L;
(2) the reaction procedure is as follows: 70min at 62 ℃;
(3) detection of the amplification product: after amplification, a fluorescent dye (SYBR Green I) is added as a reaction indicator, and the color change of the product is used as a result judgment standard. Yellow-green indicates a positive test, the presence of this pathogen. Orange color indicates that the detection result is negative.
The invention relates to a detection kit for detecting Phytophthora infestans (Phytophthora infestans), Alternaria alternata (Alternaria solani), Fusarium oxysporum (Fusarium oxysporum), Fusarium equiseti (Fusarium equiseti), Fusarium graminearum (Fusarium graminearum), Fusarium stratified (Fusarium proliferatum), Fusarium sambucinum (Fusarium sambucinum), Rhizoctonia solani (Rhizoctonia solani), Ralstonia solani (Ralstonia solanacearum), corynebacterium nigrosporanum (Pectobacterium atrosepticum), Streptomyces (Streptomyces absces), and scab (sporum), belonging to the field of crop disease prevention and treatment based on a color determination loop-mediated isothermal amplification (LAMP) technology. Through detection and verification, the kit has good specificity and sensitivity, rapid and efficient amplification and simple and convenient identification. The detection system can quickly, conveniently, efficiently, highly specifically and sensitively detect phytophthora infestans, alternaria alternata, fusarium oxysporum, fusarium equiseti, fusarium graminearum, fusarium laminarinum, fusarium sambucus, rhizoctonia solani, ralstonia solani, gliobacillus nigricans, streptomyces and eschar, does not need complex instruments, can better meet the field detection of 12 potato disease pathogenic bacteria, provides a new technical platform for the detection of the quarantine pathogenic bacteria, can better meet the urgent need of the field detection of the potato diseases at present, is used for the field detection of import and export quarantine, and the like, and is easy to popularize and apply in a large range in the field.
Compared with the prior art, the invention has the advantages and positive effects that:
(1) the practicability is good. The gel electrophoresis of the products by the common PCR reaction is easy to cause product diffusion, which is a main source of laboratory pollution; ethidium Bromide (EB) is extremely toxic and can accumulate carcinogenesis; the long-term observation of the ultraviolet lamp can also cause certain damage to the experimenters. The LAMP reaction is only carried out in a constant-temperature water bath kettle, and the result can be directly judged through the color change of the product after the reaction is finished, so that the application value of the LAMP reaction in the field is increased.
(2) And (5) performing isothermal amplification. Constant temperature amplification is realized, thermal cycling is not needed in a PCR method, so that the dependence on a thermal cycler is eliminated, LAMP reaction can be performed as long as a stable heat source exists, the application range of LAMP is greatly expanded, and the LAMP can perform reaction under the constant heat source because betaine is added into LAMP reaction liquid, double-stranded DNA is in the dynamic balance of melting, and amplification is realized under the action of Bst DNA polymerase.
(3) The accuracy is high. Because the traditional pathogen detection technology only determines the quarantine object according to morphological characteristics, the interference of human factors cannot be eliminated, the similar species with similar morphology are difficult to distinguish, and the detection accuracy is only 60-80%; the invention selects 12 specific or universal target genes of potato disease pathogenic bacteria, and the target genes not only show high specificity among common pathogenic agents of other potatoes, but also show high conservation in the same pathogenic bacteria, so that a Ypt1 sequence of phytophthora infestans, an Alt a1 sequence of alternaria alternata, a TEF-1 alpha sequence of fusarium oxysporum, a TEF-1 alpha sequence of fusarium equiseti, a TEF-1 alpha sequence of fusarium graminearum, a RED1 sequence of layered fusarium, a TEF-1 alpha sequence of fusarium sambucinum, an ITS sequence of rhizoctonia solani, a 16S rRNA sequence of ralstonia solani, a gryB sequence of the fusarium solani, a Nec1 sequence of streptomyces and an ITS sequence of eschar farinosa are finally selected as the target genes. The sequences of different pathogenic bacteria, other races and other pathogenic bacteria are compared by using Bioedit software, and a section of LAMP primer with specific sequence design is selected and is specific to each pathogenic bacteria. LAMP primer design is carried out by using PrimeExpiore V5 software, a group of primers are screened out according to indexes such as primer length, GC content, Gibbs free energy and the like, LAMP reaction specifically recognizes 6 independent regions on a target sequence through 4 primers, and specificity and sensitivity are higher compared with 2 independent regions of the target sequence recognized by PCR primers.
Drawings
FIG. 1 shows specificity of LAMP detection on twelve pathogenic bacteria of potato diseases.
LAMP amplification was performed by a total of 12 strains of 12 causative potato disease pathogenic bacteria. (1: negative control H)2O; 2: pathogenic strain Pi; 3: fusarium equiseti Fe; 4: fusarium oxysporum Fo; 5: fusarium graminearum Fg; 6: rhizoctonia solani Rs; 7: alternaria alternata As; 8: fusarium sp Fp is layered; 9: black rot pectin bacillus Pba; 10: ralstonia solanacearum Rs-2; 11: streptomyces Ss; 12: eschar chalcogramma Ss-2; 13: fusarium sambuci Fsam). And (3) detecting the specificity of the LAMP method, and judging the result according to the color change in the reaction tube after reacting for 70 min.
(a) The color determination LAMP detects a specific color development picture of phytophthora infestans. The positive reaction is yellow-green, and the negative control is orange-yellow.
(b) Color determination LAMP detects a specific color development map of Alternaria alternata. The positive reaction is yellow-green, and the negative control is orange-yellow.
(c) Color determination LAMP detects the specific color development of fusarium oxysporum. The positive reaction is yellow-green, and the negative control is orange-yellow.
(d) Color determination LAMP detects the specific color development of fusarium equiseti. The positive reaction is yellow-green, and the negative control is orange-yellow.
(e) Color determination LAMP detects the specific color development of fusarium graminearum. The positive reaction is yellow-green, and the negative control is orange-yellow.
(f) And (3) determining the specific color development of fusarium on the LAMP detection layer by color. The positive reaction is yellow-green, and the negative control is orange-yellow.
(g) The color determination LAMP detects a specific color development picture of fusarium sambuci. The positive reaction is yellow-green, and the negative control is orange-yellow.
(h) Color judgment LAMP detects the specific color development of the rhizoctonia solani. The positive reaction is yellow-green, and the negative control is orange-yellow.
(i) Color determination LAMP detects a specific color development picture of the Ralstonia solanacearum. The positive reaction is yellow-green, and the negative control is orange-yellow.
(j) Color determination LAMP detects the specific color development of the black rot pectin bacillus. The positive reaction is yellow-green, and the negative control is orange-yellow.
(k) Color determination LAMP detects the specific color development of streptomyces. The positive reaction is yellow-green, and the negative control is orange-yellow.
(l) Color determination LAMP detection of the specific color development of the Elsinoe farinosa. The positive reaction is yellow-green, and the negative control is orange-yellow.
FIG. 2 shows the sensitivity of LAMP for detection of Phytophthora infestans, Alternaria alternata, Fusarium oxysporum, Fusarium equiseti, Fusarium graminearum, Fusarium proliferatum, Fusarium sambucinum, Rhizoctonia solani, Ralstonia solani, Fusarium solani, Streptomyces tenebrio, and Sclerotium solani.
Wherein, genomic DNA with different concentrations is amplified by LAMP; 25. mu.L of each reaction from left to right contained 1ng, 100pg, 10pg, and 1pg of DNA.
(a) And (3) carrying out color determination, namely detecting a sensitivity color development map of the phytophthora infestans by LAMP. The positive reaction is yellow-green, and the negative control is orange-yellow. The color development shows that the sensitivity of LAMP reaction reaches 1 pg.
(b) Color determination the sensitivity color development of detection of alternaria alternate by LAMP. The positive reaction is yellow-green, and the negative control is orange-yellow. The color development shows that the sensitivity of LAMP reaction reaches 1 pg.
(c) Color determination the sensitivity color development of LAMP detection of Fusarium oxysporum. The positive reaction is yellow-green, and the negative control is orange-yellow. The color development shows that the sensitivity of LAMP reaction reaches 1 pg.
(d) Color determination the sensitivity color development of LAMP detection of fusarium equiseti. The positive reaction is yellow-green, and the negative control is orange-yellow. The color development shows that the sensitivity of LAMP reaction reaches 100 pg.
(e) Color determination the sensitivity color development of LAMP detection of fusarium graminearum. The positive reaction is yellow-green, and the negative control is orange-yellow. The color development shows that the sensitivity of LAMP reaction reaches 1 pg.
(f) And (3) determining the sensitivity color development of fusarium on the LAMP detection layer by color. The positive reaction is yellow-green, and the negative control is orange-yellow. The color development shows that the sensitivity of LAMP reaction reaches 1 pg.
(g) Color determination the sensitivity color development of LAMP detection of Fusarium sambucinum. The positive reaction is yellow-green, and the negative control is orange-yellow. The color development shows that the sensitivity of LAMP reaction reaches 1 ng.
(h) The color judgment LAMP detects the sensitivity color development of the rhizoctonia solani. The positive reaction is yellow-green, and the negative control is orange-yellow. The color development shows that the sensitivity of LAMP reaction reaches 1 pg.
(i) Color determination the sensitivity color development picture of LAMP detection of Ralstonia solanacearum. The positive reaction is yellow-green, and the negative control is orange-yellow. The color development shows that the sensitivity of LAMP reaction reaches 1 pg.
(j) Color determination the sensitivity color development of LAMP detection of the Bacillus mucilaginosus. The positive reaction is yellow-green, and the negative control is orange-yellow. The color development shows that the sensitivity of LAMP reaction reaches 100 pg.
(k) And (3) carrying out color determination, namely detecting a sensitivity color development map of the streptomyces by LAMP. The positive reaction is yellow-green, and the negative control is orange-yellow. The color development shows that the sensitivity of LAMP reaction reaches 100 pg.
(l) Color determination the sensitivity color development of LAMP detection of Elsinoe ampelina. The positive reaction is yellow-green, and the negative control is orange-yellow. The color development shows that the sensitivity of LAMP reaction reaches 10 pg.
FIG. 3 is a design diagram of specific primers FIP, BIP, F3, B3 and LB of the Phytophthora infestans LAMP molecular detection primer group.
FIG. 4 is a design diagram of specific primers FIP, BIP, F3, B3 and LF of the primer group for LAMP molecular detection of Alternaria alternata.
FIG. 5 is a design diagram of specific primers FIP, BIP, F3, B3 and LF of a fusarium oxysporum LAMP molecular detection primer group.
FIG. 6 is a design diagram of specific primers FIP, BIP, F3, B3, LF and LB of a detection primer group of fusarium equiseti LAMP molecules.
FIG. 7 is a design diagram of specific primers FIP, BIP, F3, B3, LF and LB of a fusarium graminearum LAMP molecular detection primer set.
FIG. 8 is a design diagram of specific primers FIP, BIP, F3, B3, LF and LB of the layered fusarium LAMP molecular detection primer group.
FIG. 9 is a design diagram of specific primers FIP, BIP, F3, B3 and LF of the LAMP molecule detection primer group for Fusarium sambucinum.
FIG. 10 shows the design of specific primers FIP, BIP, F3, B3 and LB of LAMP molecular detection primer set for Rhizoctonia solani.
FIG. 11 shows the design of specific primers FIP, BIP, F3, B3, LF and LB of the LAMP molecular detection primer set for Ralstonia solanacearum.
FIG. 12 is a design diagram of specific primers FIP, BIP, F3, B3, LF and LB of the LAMP molecular detection primer group of Pythium gracile.
FIG. 13 is a design diagram of specific primers FIP, BIP, F3, B3 and LB of the LAMP molecule detection primer set for Streptomyces.
FIG. 14 is a design diagram of specific primers FIP, BIP, F3, B3, LF and LB of the Elsinoe farinosa LAMP molecule detection primer group.
FIG. 15 shows a first sample, which is a LAMP system, for detecting the presence of twelve pathogenic bacteria in potato leaves with disease in urban fields in the City of Guizhou province.
(1: Phytophthora infestans strain Pi; 2: Alternaria alternata As; 3: Fusarium equiseti Fe; 4: Fusarium graminearum Fg; 5: Fusarium oxysporum Fo; 6: Fusarium stratified out Fp; 7: Rhizoctonia solani Rs; 8: Ralstonia solani Rs-2; 9: Pythium melanosporum Pba; 10: Streptomyces Ss; 11: Scottelia Ss-2; 12: Fusarium sambucinum Fsam). And detecting field samples by using the LAMP system, and judging the result according to the color change in the reaction tube after reacting for 70 min.
FIG. 16 is a sample II for detecting the existence of twelve pathogenic bacteria in potato leaves with disease in the urban field of the urban city, Guizhou province by using the LAMP system.
(1: Phytophthora infestans strain Pi; 2: Alternaria alternata As; 3: Fusarium equiseti Fe; 4: Fusarium graminearum Fg; 5: Fusarium oxysporum Fo; 6: Fusarium stratified out Fp; 7: Rhizoctonia solani Rs; 8: Ralstonia solani Rs-2; 9: Pythium melanosporum Pba; 10: Streptomyces Ss; 11: Scottelia Ss-2; 12: Fusarium sambucinum Fsam). And detecting field samples by using the LAMP system, and judging the result according to the color change in the reaction tube after reacting for 70 min.
Detailed Description
In order to make those skilled in the art better understand the technical solutions of the present invention, the present invention will be further described with reference to the following preferred embodiments, which are only a part of, but not all of the embodiments of the present invention, and the present invention is not limited by the following preferred embodiments.
Unless otherwise specified, the reagents used in the examples of the present invention are all commercially available products, and the test methods used are all conventional methods unless otherwise specified.
EXAMPLE 1 kit Components
The twelve potato disease pathogen detection kit comprises the following components:
five specific primers FIP, BIP, F3, B3 and LB for phytophthora infestans LAMP molecular detection:
f3 (forward outer primer): GCTAAGTGATGGACCGCTT, respectively;
b3 (reverse outer primer): AGCCATCATCATGAATGCCT, respectively;
FIP (forward inner primer) (F1C + F2): TTGGCCGTTAGATCGCTCTTGT-TGATTTGCAGATACGCCTGT;
BIP (reverse inner primer) (B1C + B2): CCGACGCCGCCAAGGAATTT-GTTCTTCGCACTGGTCTCC;
LB (reverse loop primer): AGCAGCTTGTTCACGTTCTC
Five specific primers FIP, BIP, F3, B3 and LF for Alternaria alternata LAMP molecular detection:
f3 (forward outer primer): GCTTGAGGATCACAAGTGGT, respectively;
b3 (reverse outer primer): TGGGAAGAGTGGTGGTGG, respectively;
FIP (forward inner primer) (F1C + F2): CTTCTGCCTCAGGAGCAGGC-ACTCTTGCGGCGAGAACA;
BIP (reverse inner primer) (B1C + B2): CGACGAGTAAGTTGCCCTCGTG-CGACGTAGGTGATGCTGGA;
LF (forward loop primer): TCGAAAGAGAAGTCCATGAAGC are provided.
Five specific primers FIP, BIP, F3, B3 and LF for detecting fusarium oxysporum LAMP molecules:
f3 (forward outer primer): GCGTTTGCCCTCTTACCATT, respectively;
b3 (reverse outer primer): GCATGAGCGACAACATACCA, respectively;
FIP (forward inner primer) (F1C + F2): CGAGCTCAGCGGCTTCCTATT-CACAACCTCAATGAGTGCGT;
BIP (reverse inner primer) (B1C + B2): TTCTTGACAAGCTCAAGGCCGA-AGGAGTCTCGAACTTCCAGA;
LF (forward loop primer): GACTGCTTCACACGTGACG are provided.
Six specific primers FIP, BIP, F3, B3, LF and LB for detecting fusarium equiseti LAMP molecules:
f3 (forward outer primer): TGCATAGACCGGTCACTTGA, respectively;
b3 (reverse outer primer): GCCCCACCAAAAAATTACGG, respectively;
FIP (forward inner primer) (F1C + F2): GCGTGCGATCGAGGAAAATGGA-TACCAGTGCGGTGGTATCG;
BIP (reverse inner primer) (B1C + B2): CCTCTGCCCATCGATCCAGC-TGTACTCGAGCGGGGTAAC;
LF (forward loop primer): ACTTCTCGATGGTTCGCTTGT, respectively;
LB (reverse loop primer): ACCCGAATCAGTCTCGACG are provided.
Six specific primers FIP, BIP, F3, B3, LF and LB for detecting fusarium graminearum LAMP molecules:
f3 (forward outer primer): GAATCGCCCTCACACGAC, respectively;
b3 (reverse outer primer): AGGAACCCTTACCGAGCT, respectively;
FIP (forward inner primer) (F1C + F2): TGAGCCCCACCGGGAAAAAAAT-CGATACGCGCCTGTTACC;
BIP (reverse inner primer) (B1C + B2): GTCTGCCCTCTTCCCACAAACC-GACAGGTGGTTAGTGACTGG;
LF (forward loop primer): CAAAATTTTTGACCTCGAGCGG, respectively;
LB (reverse loop primer): CGCTCATCATCACGTGTCAA are provided.
Six specific primers FIP, BIP, F3, B3, LF and LB for detecting the LAMP molecules of the submerged fusarium:
f3 (forward outer primer): CGTTCGAGAACCCGCATAT, respectively;
b3 (reverse outer primer): TCTCAAGGGCATAGCCGATT, respectively;
FIP (forward inner primer) (F1C + F2): GTGAGCTGGCAACTCCACTGTA-ACCTGGGATCATTGCGACA;
BIP (reverse inner primer) (B1C + B2): TGGCTTGCATCAGAGGAAGCT-CAGAAGCTCTTGGGCGTC;
LF (forward loop primer): ACTGAGGTCGGGATTGATTCC, respectively;
LB (reverse loop primer): GAGTTCTTAAAGGGCAAGTTCACC are provided.
Five specific primers FIP, BIP, F3, B3 and LF for detecting the LAMP molecules of the fusarium sambuci:
f3 (forward outer primer): ACCGGTCACTTGATCTACCA, respectively;
b3 (reverse outer primer): GCTTTAGAGGAAGGGCATGT, respectively;
FIP (forward inner primer) (F1C + F2): GAAAGTAGGGCGCGCGATCG-CAAGCGAACCATCGAGAAGT;
BIP (reverse inner primer) (B1C + B2): GACTCGACACACGCCTGCTAC-GGGTATGAGCCCCACCAA;
LF (forward loop primer): GAAAATGAGACCAACCTTCTCGA are provided.
Five specific primers FIP, BIP, F3, B3 and LB for detecting the LAMP molecule of the rhizoctonia solani:
f3 (forward outer primer): GGTATTGGAGGTCTTTTGCA, respectively;
b3 (reverse outer primer): AGATCAGATCATAAAGGTATTGTC, respectively;
FIP (forward inner primer) (F1C + F2): TTATCACGCCGAGTGGAACC-GCTCCTCTTTGTTCATTAGCT;
BIP (reverse inner primer) (B1C + B2): TCTATCGCTGAGGACACTGTAA-AAGTCAATGGACTATTAGAAGC;
LB (reverse loop primer): AAGGTGGCCAAGGTAAATGC are provided.
Six specific primers FIP, BIP, F3, B3, LF and LB for detecting the LAMP molecules of the ralstonia solanacearum:
f3 (forward outer primer): CGACCTGAGGGTGAAAGTG, respectively;
b3 (reverse outer primer): TGTCCAAAATTCCCCACTGC, respectively;
FIP (forward inner primer) (F1C + F2): GGTAGGCCTTTACCCCACCAAC-CGCAAGGCCTCATGCTAT;
BIP (reverse inner primer) (B1C + B2): AAGGCGACGATCAGTAGCTGGT-TGCCTCCCGTAGGAGTCT;
LF (forward loop primer): ATCAGACATCGGCCGCTCC, respectively;
LB (reverse loop primer): CTGAGAGGACGATCAGCCA are provided.
Six specific primers FIP, BIP, F3, B3, LF and LB for detecting the LAMP molecule of the black rot fruit jelly bacillus:
f3 (forward outer primer): GGCGGTATCAAGGCATTCG, respectively;
b3 (reverse outer primer): GTATTCAGCGTACGGGTCAT, respectively;
FIP (forward inner primer) (F1C + F2): TCCACGCCGATGTCATCTTTCA-ACCTGAACCGTAACAAGACG;
BIP (reverse inner primer) (B1C + B2): TGCAGTGGAACGATGGTTTCCA-AAGTGTGTACCACCATCACG;
LF (forward loop primer): ACACGTTCGGGTGGATTGG, respectively;
LB (reverse loop primer): TACTGCTTTACCAACAATATTCCGC are provided.
Five specific primers FIP, BIP, F3, B3 and LB detected by streptomycete LAMP molecules:
f3 (forward outer primer): TGACTCTCTCTTCGCTGACC, respectively;
b3 (reverse outer primer): TCGAAGGAGATCAGCACGA, respectively;
FIP (forward inner primer) (F1C + F2): TCAAGACGTTCGCTGACGCG-ATTCAGCATTGCAGAGGGCA;
BIP (reverse inner primer) (B1C + B2): CGCGCAGCAGATCGGGACT-TGACCGCATCCGACAGTC;
LB (reverse loop primer): GAGGTTGTCTTCGGCGAGGG are provided.
Six specific primers FIP, BIP, F3, B3, LF and LB for Elsinoe farinosa LAMP molecular detection
F3 (forward outer primer): GGTTCCCACAACGATGAAGA, respectively;
b3 (reverse outer primer): CTTTCAAGCCATGGACCGA, respectively;
FIP (forward inner primer) (F1C + F2): CGAAAGCGCAACTTGCGTTCAA-GCAGCGAAATGCGATACGT;
BIP (reverse inner primer) (B1C + B2): AGCATGCCTCTTTGAGTGTCGG-CCAGAGCTCATAGTCCCCTT;
LF (forward loop primer): GATTCACTGAATTCTGCAATTCGC, respectively;
LB (reverse loop primer): TTTCTATTCTCCCGGAAACGCCTG are provided.
Kit reaction system
1mL of assay solution comprises: 20 μ M forward inner primer FIP, 20 μ M reverse inner primer BIP, 10 μ M forward outer primer F3, 10 μ M reverse outer primer B3, 10 μ M forward loop primer LF, 10 μ M reverse loop primer LB, 10 XBuffer, 10mM dNTPs, 50mM MgSO45M betaine, Bst DNA polymerase 8U/. mu.L, and ultrapure water was added thereto to prepare 1mL of a detection solution. The shelf life was 1 year.
Example 2 the Presence of twelve pathogenic bacteria in leaves of potato having a field attack in City of Guizhou province
The method for detecting twelve pathogenic bacteria of the twelve potato diseases by using the kit comprises the following steps:
1) collecting field samples:
the school subjects of 4 months in 2021 randomly collected diseased potato leaves from the fields of urban districts, Guizhou province, and 5 points were randomly selected and sampled at positions 4-10 steps away from four sides of the field block by a five-point sampling method, and the sampled potato leaves were placed in a plastic package bag for individual storage.
2) Isolation of potato disease pathogenic bacteria on diseased tissue:
washing fresh diseased leaves with tap water, sucking water, placing a filter paper sheet at the bottom of a culture dish with the diameter of 90mm, spraying a little of sterilizing water, placing the cleaned fresh diseased leaves on the wet filter paper sheet with the back face upward, and filling a gun head to suspend diseased tissues in the air. Moistening the diseased potato leaves for about 24h until a large amount of white mildew layer grows at the diseased spots, then selecting hyphae to inoculate on a rye selective culture medium (containing antibiotics ampicillin, rifampicin and quintozene) plate and a PDA culture medium plate, and separating oomycetes and fungi.
Cutting ill potato leaves, putting the potato leaves into a 50mL centrifuge tube containing sterilized water, vibrating by using a vortex oscillator to obtain a microorganism suspension, then diluting in a series (such as 1:10, 1:100, 1:1000 and 1:10000), dipping a little microorganism suspension to be separated by using an inoculating ring in an aseptic operation mode, carrying out continuous scribing on the surface of an aseptic plate, wherein the number of microorganism cells is reduced along with the increase of the scribing times, and picking a single bacterial colony on the surface of the aseptic plate for separating bacteria.
3) LAMP detection of diseased potato leaves comprising:
(1) extracting DNA of diseased potato leaves: extracting the genome of the potato leaves with the lesion spots by adopting a novel plant genome extraction kit (Tiangen DP320-100 times), wherein the method conforms to the instruction;
(2) LAMP detection of different pathogenic bacteria: adding 18 mu L of kit solution and 3 mu L of sterilized deionized water into 4 mu L of field sample DNA solution, wherein the total volume is 25 mu L;
(3) the reaction procedure is as follows: 70min at 62 ℃;
(4) detection of the amplification product: detecting the conditions of twelve potato disease pathogens on diseased potato leaves by using an LAMP system, adding SYBR Green I (fluorescent dye) into a product after LAMP amplification as a reaction indicator, and taking the color change of the fluorescent dye as a result judgment standard. The yellow green indicates that the detection is positive, target pathogenic bacteria exist, and the orange yellow indicates that the detection result is negative. By detecting two diseased potato leaves in the city of city, Guizhou province, Phytophthora infestans, Alternaria alternata, Fusarium graminearum, Ralstonia solanacearum and Pythium gracile were detected (see FIGS. 15 and 16).
4) Sequencing verification of isolated pathogenic bacteria
Extracting DNA from the separated field pathogenic bacteria with different forms, designing corresponding primers according to the conserved ITS gene of fungi and the conserved 16S rRNA gene of bacteria, performing Blast comparison on the sequenced sequence information on NCBI, and determining the types of the separated pathogenic bacteria. Comparing the LAMP detection result of the field sample with the separated pathogenic bacteria to verify the accuracy of the LAMP primer, and determining and separating phytophthora infestans, alternaria alternate and fusarium graminearum after sequencing comparison. The LAMP detection system can be used for detecting the Ralstonia solanacearum and the Pythium melanosporum, but the two pathogenic bacteria cannot be separated later, and the analysis reason is as follows: the separated material is diseased potato leaves, the potato black shank is a stem disease, the potato bacterial wilt is a systemic disease which damages the stems and potato blocks of the potatoes, the solanaceae ralstonia and the black pythium are not main bacteria on the diseased potato leaves, and the leaves are difficult to separate.
Sequence listing
<110> Nanjing university of agriculture
<120> primer composition for detecting twelve potato disease pathogenic bacteria based on loop-mediated isothermal amplification technology and detection method
<160> 66
<170> SIPOSequenceListing 1.0
<210> 1
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
gctaagtgat ggaccgctt 19
<210> 2
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
agccatcatc atgaatgcct 20
<210> 3
<211> 42
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
ttggccgtta gatcgctctt gttgatttgc agatacgcct gt 42
<210> 4
<211> 39
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
ccgacgccgc caaggaattt gttcttcgca ctggtctcc 39
<210> 5
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
agcagcttgt tcacgttctc 20
<210> 6
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
gcttgaggat cacaagtggt 20
<210> 7
<211> 18
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
tgggaagagt ggtggtgg 18
<210> 8
<211> 38
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
cttctgcctc aggagcaggc actcttgcgg cgagaaca 38
<210> 9
<211> 41
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 9
cgacgagtaa gttgccctcg tgcgacgtag gtgatgctgg a 41
<210> 10
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 10
tcgaaagaga agtccatgaa gc 22
<210> 11
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 11
gcgtttgccc tcttaccatt 20
<210> 12
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 12
gcatgagcga caacatacca 20
<210> 13
<211> 41
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 13
cgagctcagc ggcttcctat tcacaacctc aatgagtgcg t 41
<210> 14
<211> 42
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 14
ttcttgacaa gctcaaggcc gaaggagtct cgaacttcca ga 42
<210> 15
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 15
gactgcttca cacgtgacg 19
<210> 16
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 16
tgcatagacc ggtcacttga 20
<210> 17
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 17
gccccaccaa aaaattacgg 20
<210> 18
<211> 41
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 18
gcgtgcgatc gaggaaaatg gataccagtg cggtggtatc g 41
<210> 19
<211> 39
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 19
cctctgccca tcgatccagc tgtactcgag cggggtaac 39
<210> 20
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 20
acttctcgat ggttcgcttg t 21
<210> 21
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 21
acccgaatca gtctcgacg 19
<210> 22
<211> 18
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 22
gaatcgccct cacacgac 18
<210> 23
<211> 18
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 23
aggaaccctt accgagct 18
<210> 24
<211> 40
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 24
tgagccccac cgggaaaaaa atcgatacgc gcctgttacc 40
<210> 25
<211> 42
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 25
gtctgccctc ttcccacaaa ccgacaggtg gttagtgact gg 42
<210> 26
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 26
caaaattttt gacctcgagc gg 22
<210> 27
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 27
cgctcatcat cacgtgtcaa 20
<210> 28
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 28
cgttcgagaa cccgcatat 19
<210> 29
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 29
tctcaagggc atagccgatt 20
<210> 30
<211> 41
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 30
gtgagctggc aactccactg taacctggga tcattgcgac a 41
<210> 31
<211> 39
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 31
tggcttgcat cagaggaagc tcagaagctc ttgggcgtc 39
<210> 32
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 32
actgaggtcg ggattgattc c 21
<210> 33
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 33
gagttcttaa agggcaagtt cacc 24
<210> 34
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 34
accggtcact tgatctacca 20
<210> 35
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 35
gctttagagg aagggcatgt 20
<210> 36
<211> 40
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 36
gaaagtaggg cgcgcgatcg caagcgaacc atcgagaagt 40
<210> 37
<211> 39
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 37
gactcgacac acgcctgcta cgggtatgag ccccaccaa 39
<210> 38
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 38
gaaaatgaga ccaaccttct cga 23
<210> 39
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 39
ggtattggag gtcttttgca 20
<210> 40
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 40
agatcagatc ataaaggtat tgtc 24
<210> 41
<211> 41
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 41
ttatcacgcc gagtggaacc gctcctcttt gttcattagc t 41
<210> 42
<211> 44
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 42
tctatcgctg aggacactgt aaaagtcaat ggactattag aagc 44
<210> 43
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 43
aaggtggcca aggtaaatgc 20
<210> 44
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 44
cgacctgagg gtgaaagtg 19
<210> 45
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 45
tgtccaaaat tccccactgc 20
<210> 46
<211> 40
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 46
ggtaggcctt taccccacca accgcaaggc ctcatgctat 40
<210> 47
<211> 40
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 47
aaggcgacga tcagtagctg gttgcctccc gtaggagtct 40
<210> 48
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 48
atcagacatc ggccgctcc 19
<210> 49
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 49
ctgagaggac gatcagcca 19
<210> 50
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 50
ggcggtatca aggcattcg 19
<210> 51
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 51
gtattcagcg tacgggtcat 20
<210> 52
<211> 42
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 52
tccacgccga tgtcatcttt caacctgaac cgtaacaaga cg 42
<210> 53
<211> 42
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 53
tgcagtggaa cgatggtttc caaagtgtgt accaccatca cg 42
<210> 54
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 54
acacgttcgg gtggattgg 19
<210> 55
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 55
tactgcttta ccaacaatat tccgc 25
<210> 56
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 56
tgactctctc ttcgctgacc 20
<210> 57
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 57
tcgaaggaga tcagcacga 19
<210> 58
<211> 40
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 58
tcaagacgtt cgctgacgcg attcagcatt gcagagggca 40
<210> 59
<211> 37
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 59
cgcgcagcag atcgggactt gaccgcatcc gacagtc 37
<210> 60
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 60
gaggttgtct tcggcgaggg 20
<210> 61
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 61
ggttcccaca acgatgaaga 20
<210> 62
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 62
ctttcaagcc atggaccga 19
<210> 63
<211> 41
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 63
cgaaagcgca acttgcgttc aagcagcgaa atgcgatacg t 41
<210> 64
<211> 42
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 64
agcatgcctc tttgagtgtc ggccagagct catagtcccc tt 42
<210> 65
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 65
gattcactga attctgcaat tcgc 24
<210> 66
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 66
tttctattct cccggaaacg cctg 24
Claims (7)
1. A LAMP primer composition for detecting twelve types of potato disease pathogens, characterized by comprising at least one of the following primer sets (1) to (12): (1) detecting a primer group for phytophthora infestans; (2) detecting primer group of Alternaria alternata; (3) detecting a primer group by fusarium oxysporum; (4) detecting a primer group for fusarium equiseti; (5) fusarium graminearum detection primer group; (6) a fusarium detection primer group is layered; (7) detecting a primer group for fusarium sambuci; (8) a solanum solanacearum detection primer group; (9) a detection primer set for ralstonia solanacearum; (10) detecting a primer group for the black rot fruit jelly bacillus; (11) detecting a primer group by streptomycete; (12) a callus detection primer group;
the phytophthora infestans detection primer group consists of five specific primers F3, B3, FIP, BIP and LB:
F3：GCTAAGTGATGGACCGCTT；
B3：AGCCATCATCATGAATGCCT；
FIP：TTGGCCGTTAGATCGCTCTTGTTGATTTGCAGATACGCCTGT；
BIP：CCGACGCCGCCAAGGAATTTGTTCTTCGCACTGGTCTCC；
LB：AGCAGCTTGTTCACGTTCTC；
the primer group for detecting the alternaria alternata consists of five specific primers F3, B3, FIP, BIP and LF:
F3：GCTTGAGGATCACAAGTGGT；
B3：TGGGAAGAGTGGTGGTGG；
FIP：CTTCTGCCTCAGGAGCAGGCACTCTTGCGGCGAGAACA；
BIP：CGACGAGTAAGTTGCCCTCGTGCGACGTAGGTGATGCTGGA；
LF：TCGAAAGAGAAGTCCATGAAGC；
the fusarium oxysporum detection primer group consists of five specific primers F3, B3, FIP, BIP and LF:
F3：GCGTTTGCCCTCTTACCATT；
B3：GCATGAGCGACAACATACCA；
FIP：CGAGCTCAGCGGCTTCCTATTCACAACCTCAATGAGTGCGT；
BIP：TTCTTGACAAGCTCAAGGCCGAAGGAGTCTCGAACTTCCAGA；
LF：GACTGCTTCACACGTGACG；
the primer group for detecting the fusarium equiseti consists of six specific primers F3, B3, FIP, BIP, LF and LB:
F3：TGCATAGACCGGTCACTTGA；
B3：GCCCCACCAAAAAATTACGG；
FIP：GCGTGCGATCGAGGAAAATGGATACCAGTGCGGTGGTATCG；
BIP：CCTCTGCCCATCGATCCAGCTGTACTCGAGCGGGGTAAC；
LF：ACTTCTCGATGGTTCGCTTGT；
LB：ACCCGAATCAGTCTCGACG；
the fusarium graminearum detection primer group consists of six specific primers F3, B3, FIP, BIP, LF and LB:
F3：GAATCGCCCTCACACGAC；
B3：AGGAACCCTTACCGAGCT；
FIP：TGAGCCCCACCGGGAAAAAAATCGATACGCGCCTGTTACC；
BIP：GTCTGCCCTCTTCCCACAAACCGACAGGTGGTTAGTGACTGG；
LF：CAAAATTTTTGACCTCGAGCGG；
LB：CGCTCATCATCACGTGTCAA；
the detection primer group for the layered fusarium consists of six specific primers F3, B3, FIP, BIP, LF and LB:
F3：CGTTCGAGAACCCGCATAT；
B3：TCTCAAGGGCATAGCCGATT；
FIP：GTGAGCTGGCAACTCCACTGTAACCTGGGATCATTGCGACA；
BIP：TGGCTTGCATCAGAGGAAGCTCAGAAGCTCTTGGGCGTC；
LF：ACTGAGGTCGGGATTGATTCC；
LB：GAGTTCTTAAAGGGCAAGTTCACC；
the fusarium sambuci detection primer group consists of five specific primers F3, B3, FIP, BIP and LF:
F3：ACCGGTCACTTGATCTACCA；
B3：GCTTTAGAGGAAGGGCATGT；
FIP：GAAAGTAGGGCGCGCGATCGCAAGCGAACCATCGAGAAGT；
BIP：GACTCGACACACGCCTGCTACGGGTATGAGCCCCACCAA；
LF：GAAAATGAGACCAACCTTCTCGA；
the primer group for detecting the rhizoctonia solani consists of five specific primers F3, B3, FIP, BIP and LB:
F3：GGTATTGGAGGTCTTTTGCA；
B3：AGATCAGATCATAAAGGTATTGTC；
FIP：TTATCACGCCGAGTGGAACCGCTCCTCTTTGTTCATTAGCT；
BIP：TCTATCGCTGAGGACACTGTAAAAGTCAATGGACTATTAGAAGC；
LB：AAGGTGGCCAAGGTAAATGC；
the detection primer group of the Ralstonia solanacearum comprises six specific primers F3, B3, FIP, BIP, LF and LB:
F3：CGACCTGAGGGTGAAAGTG；
B3：TGTCCAAAATTCCCCACTGC；
FIP：GGTAGGCCTTTACCCCACCAACCGCAAGGCCTCATGCTAT；
BIP：AAGGCGACGATCAGTAGCTGGTTGCCTCCCGTAGGAGTCT；
LF：ATCAGACATCGGCCGCTCC；
LB：CTGAGAGGACGATCAGCCA；
the primer group for detecting the black rot pectin bacillus consists of six specific primers F3, B3, FIP, BIP, LF and LB:
F3：GGCGGTATCAAGGCATTCG；
B3：GTATTCAGCGTACGGGTCAT；
FIP：TCCACGCCGATGTCATCTTTCAACCTGAACCGTAACAAGACG；
BIP：TGCAGTGGAACGATGGTTTCCAAAGTGTGTACCACCATCACG；
LF：ACACGTTCGGGTGGATTGG；
LB：TACTGCTTTACCAACAATATTCCGC；
the streptomyces detection primer group consists of five specific primers F3, B3, FIP, BIP and LB:
F3：TGACTCTCTCTTCGCTGACC；
B3：TCGAAGGAGATCAGCACGA；
FIP：TCAAGACGTTCGCTGACGCGATTCAGCATTGCAGAGGGCA；
BIP：CGCGCAGCAGATCGGGACTTGACCGCATCCGACAGTC；
LB：GAGGTTGTCTTCGGCGAGGG；
the primer group for detecting the eschar farinosa consists of six specific primers F3, B3, FIP, BIP, LF and LB:
F3：GGTTCCCACAACGATGAAGA；
B3：CTTTCAAGCCATGGACCGA；
FIP：CGAAAGCGCAACTTGCGTTCAAGCAGCGAAATGCGATACGT；
BIP：AGCATGCCTCTTTGAGTGTCGGCCAGAGCTCATAGTCCCCTT；
LF：GATTCACTGAATTCTGCAATTCGC；
LB：TTTCTATTCTCCCGGAAACGCCTG。
2. the LAMP primer composition of claim 1, which is used for detecting twelve pathogenic bacteria of potato diseases.
3. The application of the LAMP primer composition of claim 1 in preparation of a kit for detecting twelve potato disease pathogens.
4. A LAMP kit for detecting twelve pathogenic bacteria of potato diseases, which is characterized by comprising the LAMP primer composition of claim 1.
5. The LAMP kit for detecting twelve pathogenic bacteria of potato diseases according to claim 4, characterized in that the reaction system of the kit is as follows:
1mL of assay solution comprises: 20 μ M forward inner primer FIP, 20 μ M reverse inner primer BIP, 10 μ M forward outer primer F3, 10 μ M reverse outer primer B3, 10 μ M forward loop primer LF, 10 μ M reverse loop primer LB, 10 XBuffer, 10mM dNTPs, 50mM MgSO45M betaine, Bst DNA polymerase 8U/. mu.L, and ultrapure water was added thereto to prepare 1mL of a detection solution.
6. The LAMP kit of claim 4 or 5, for use in detecting twelve potato disease pathogens.
7. An LAMP detection method for twelve potato disease pathogenic bacteria, which is characterized in that the LAMP kit of claim 4 or 5 is adopted to carry out LAMP reaction, and the program of the LAMP reaction is as follows: 70min at 62 ℃; detection of the amplification product: adding SYBR Green I into the product after constant temperature amplification as a reaction indicator, and taking the color change of the fluorescent dye as a result judgment standard; the yellow green indicates that the detection is positive, target pathogenic bacteria exist, and the orange yellow indicates that the detection result is negative.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111203360.8A CN114045358B (en) | 2021-10-15 | 2021-10-15 | Primer composition for detecting twelve potato disease pathogenic bacteria based on loop-mediated isothermal amplification technology and detection method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111203360.8A CN114045358B (en) | 2021-10-15 | 2021-10-15 | Primer composition for detecting twelve potato disease pathogenic bacteria based on loop-mediated isothermal amplification technology and detection method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114045358A true CN114045358A (en) | 2022-02-15 |
| CN114045358B CN114045358B (en) | 2023-08-18 |
Family
ID=80205142
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111203360.8A Active CN114045358B (en) | 2021-10-15 | 2021-10-15 | Primer composition for detecting twelve potato disease pathogenic bacteria based on loop-mediated isothermal amplification technology and detection method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114045358B (en) |
Citations (13)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2006123423A1 (en) * | 2005-05-20 | 2006-11-23 | Sapporo Breweries Limited | Primer for detecting fungus of the genus fusarium |
| CN104195254A (en) * | 2014-09-09 | 2014-12-10 | 南京农业大学 | Method and primer composition for detecting fusarium equiseti based on loop-mediated isothermal amplification technology |
| CN104313128A (en) * | 2014-09-09 | 2015-01-28 | 南京农业大学 | Loop-mediated isothermal amplification (LAMP)-based method and primer composition for detection of fusarium graminearum |
| CN104313175A (en) * | 2014-11-13 | 2015-01-28 | 南京林业大学 | LAMP detection primer composition for phytophthora infestans and LAMP detection kit and LAMP detection method of LAMP detection primer composition |
| CN106755342A (en) * | 2016-11-30 | 2017-05-31 | 中华人民共和国昆山出入境检验检疫局 | Based on the ring mediated isothermal amplification that color judges（LAMP）Technology for detection chestnut phytophthora Heisui River germ |
| CN106987653A (en) * | 2017-06-09 | 2017-07-28 | 福建省农业科学院植物保护研究所 | A kind of phytophthora infestans LAMP detection primer and its visible detection method |
| CN108315469A (en) * | 2018-04-09 | 2018-07-24 | 中国农业科学院农产品加工研究所 | Primer composition and kit of the pathogenic sickle-like bacteria of ring mediated isothermal amplification method detection and application thereof |
| CN108624655A (en) * | 2017-03-17 | 2018-10-09 | 河北农业大学 | Phytophthora infestans real-time fluorescence LAMP detection method and kit |
| CN108676851A (en) * | 2018-07-10 | 2018-10-19 | 南京农业大学 | It is a kind of detection phytophthora infestans loop-mediated isothermal amplification (LAMP) primer composition and its application |
| CN108796118A (en) * | 2018-06-26 | 2018-11-13 | 福建省农业科学院植物保护研究所 | A kind of target collarium mediated amplification detection primer and its detection method |
| CN110129474A (en) * | 2019-05-08 | 2019-08-16 | 福建农林大学 | A method of three kinds of potato disease opportunistic pathogens are detected using multiple PCR technique |
| CN110878373A (en) * | 2019-11-14 | 2020-03-13 | 南京农业大学 | Recombinase polymerase amplification detection kit for phytophthora infestans and application thereof |
| CN111560450A (en) * | 2020-05-22 | 2020-08-21 | 河北农业大学 | LAMP detection method for potato scab germs |
-
2021
- 2021-10-15 CN CN202111203360.8A patent/CN114045358B/en active Active
Patent Citations (13)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2006123423A1 (en) * | 2005-05-20 | 2006-11-23 | Sapporo Breweries Limited | Primer for detecting fungus of the genus fusarium |
| CN104195254A (en) * | 2014-09-09 | 2014-12-10 | 南京农业大学 | Method and primer composition for detecting fusarium equiseti based on loop-mediated isothermal amplification technology |
| CN104313128A (en) * | 2014-09-09 | 2015-01-28 | 南京农业大学 | Loop-mediated isothermal amplification (LAMP)-based method and primer composition for detection of fusarium graminearum |
| CN104313175A (en) * | 2014-11-13 | 2015-01-28 | 南京林业大学 | LAMP detection primer composition for phytophthora infestans and LAMP detection kit and LAMP detection method of LAMP detection primer composition |
| CN106755342A (en) * | 2016-11-30 | 2017-05-31 | 中华人民共和国昆山出入境检验检疫局 | Based on the ring mediated isothermal amplification that color judges（LAMP）Technology for detection chestnut phytophthora Heisui River germ |
| CN108624655A (en) * | 2017-03-17 | 2018-10-09 | 河北农业大学 | Phytophthora infestans real-time fluorescence LAMP detection method and kit |
| CN106987653A (en) * | 2017-06-09 | 2017-07-28 | 福建省农业科学院植物保护研究所 | A kind of phytophthora infestans LAMP detection primer and its visible detection method |
| CN108315469A (en) * | 2018-04-09 | 2018-07-24 | 中国农业科学院农产品加工研究所 | Primer composition and kit of the pathogenic sickle-like bacteria of ring mediated isothermal amplification method detection and application thereof |
| CN108796118A (en) * | 2018-06-26 | 2018-11-13 | 福建省农业科学院植物保护研究所 | A kind of target collarium mediated amplification detection primer and its detection method |
| CN108676851A (en) * | 2018-07-10 | 2018-10-19 | 南京农业大学 | It is a kind of detection phytophthora infestans loop-mediated isothermal amplification (LAMP) primer composition and its application |
| CN110129474A (en) * | 2019-05-08 | 2019-08-16 | 福建农林大学 | A method of three kinds of potato disease opportunistic pathogens are detected using multiple PCR technique |
| CN110878373A (en) * | 2019-11-14 | 2020-03-13 | 南京农业大学 | Recombinase polymerase amplification detection kit for phytophthora infestans and application thereof |
| CN111560450A (en) * | 2020-05-22 | 2020-08-21 | 河北农业大学 | LAMP detection method for potato scab germs |
Non-Patent Citations (3)
| Title |
|---|
| JEAN B. RISTAINO ET AL.: "Detection of Phytophthora infestans by Loop-Mediated Isothermal Amplification, Real-Time LAMP, and Droplet Digital PCR", 《PLANT DISEASE》, pages 708 - 716 * |
| R. LENARCIC ET AL.: "Fast real-time detection of Potato spindle tuber viroid by RT-LAMP", 《PLANT PATHOLOGY》, pages 1147 * |
| 戴婷婷等: "等温扩增技术快速检测棕榈疫霉", 《林业科学》, vol. 52, no. 10, pages 162 - 166 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN114045358B (en) | 2023-08-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105331714B (en) | A kind of peronophythora litchi LAMP primer and its rapid detection method | |
| CN112961930B (en) | Primer group, kit and method for identifying environmental bacteria at genus level | |
| CN111534621A (en) | Primer and detection method for real-time fluorescent quantitative PCR (polymerase chain reaction) detection of colletotrichum gloeosporioides | |
| CN107338314B (en) | Closed-tube visual eel-derived aeromonas hydrophila loop-mediated isothermal amplification detection method | |
| CN114196766B (en) | Molecular marker, primer pair, kit and method for specifically identifying rice ralstonia solanacearum Xoo | |
| CN104946760B (en) | A kind of method and dedicated kit for detecting Pythium inflatum | |
| CN113444825A (en) | Primer group, kit and constant-temperature amplification method for species level identification of environmental bacteria | |
| CN109811073B (en) | Primer for rapidly detecting streptococcus agalactiae and streptococcus iniae at early stage by double PCR (polymerase chain reaction) and application of primer | |
| CN111850155A (en) | Application of specific target primer in simultaneous and rapid identification of two pathogenic bacteria of strawberry infection | |
| CN111635959A (en) | LAMP primer of Fluoxapiprolin resistance genotype G700V phytophthora capsici and application | |
| CN111440887A (en) | Pseudomonas proteorum TaqMan real-time fluorescence quantitative PCR detection kit and preparation method thereof | |
| CN114045358A (en) | Primer composition for detecting twelve potato disease pathogenic bacteria based on loop-mediated isothermal amplification technology and detection method | |
| KR101846182B1 (en) | Primer sets for simultaneous detection of Staphylococcus aureus, Bacillus cereus and Salmonella spp., polymerase chain reaction kit thereof | |
| CN114015799B (en) | LAMP (loop-mediated isothermal amplification) detection primer group, kit and LAMP detection method for Helminthosporium putrescens | |
| JP3525259B2 (en) | Detection of Pectinatus spp. | |
| CN114032334A (en) | Primer group and kit for detecting quinoa phomopsis and detection method thereof | |
| CN109897911B (en) | LAMP (loop-mediated isothermal amplification) detection primer and detection kit for phytophthora P.hydropathica and application of LAMP detection primer and detection kit | |
| CN110923342A (en) | RPA detection primer, kit and detection method for sweet potato blast bacteria | |
| CN114164296B (en) | Primer probe composition for detecting pythium oligandrum, kit and application and detection method | |
| CN114438257B (en) | Primer group and kit for simultaneously detecting 5 pathogenic bacteria of tobacco and application of primer group and kit | |
| CN114317796B (en) | LAMP primer composition for detecting pythium admittedly and detection method thereof | |
| CN110699483B (en) | Primer for visually detecting isaria fumosorosea based on LAMP (loop-mediated isothermal amplification), detection method and application | |
| CN113430289B (en) | Primer pair, kit and method for detecting and identifying Dike's bacteria | |
| CN111944919B (en) | Banana fusarium wilt tropical No.4 small species visual detection technology system capable of being operated in field and at normal temperature | |
| CN113789401B (en) | Primer for detecting phytophthora nicotianae by loop-mediated isothermal amplification method and detection method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB02 | Change of applicant information |
Address after: 210043 Nanjing Agricultural University, Baguazhou street, Qixia District, Nanjing City, Jiangsu Province Applicant after: NANJING AGRICULTURAL University Address before: 211225 Jiangsu Nanjing Lishui District Baima Town National Agricultural Science and Technology Park Nanjing Agricultural University base Applicant before: NANJING AGRICULTURAL University |
|
| CB02 | Change of applicant information | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |