CN114032318A - Method for detecting whether enterobacteriaceae bacteria contain tet (X) gene variant capable of mediating tigecycline drug resistance - Google Patents
Method for detecting whether enterobacteriaceae bacteria contain tet (X) gene variant capable of mediating tigecycline drug resistance Download PDFInfo
- Publication number
- CN114032318A CN114032318A CN202111440024.5A CN202111440024A CN114032318A CN 114032318 A CN114032318 A CN 114032318A CN 202111440024 A CN202111440024 A CN 202111440024A CN 114032318 A CN114032318 A CN 114032318A
- Authority
- CN
- China
- Prior art keywords
- tet
- raa
- drug resistance
- tigecycline
- bacteria
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Abstract
The invention discloses a method for detecting whether enterobacteriaceae bacteria contain tet (X) gene variant capable of mediating tigecycline drug resistance. The invention establishes a bacterial DNA extraction method without using a centrifugal machine based on a Chelex-100 lysis method, and further combines the bacterial DNA extraction method, RAA and a lateral flow chromatography test strip to construct a rapid visual detection method of tet (X4) drug resistance genes and/or tet (X6) drug resistance genes. The detection method has the technical advantages of rapidness, high sensitivity, strong specificity and capability of carrying out on-site detection, and is suitable for monitoring the prevalence of tigecycline tet (X4) drug resistance genes and/or tet (X6) drug resistance genes in clinical and livestock and poultry breeding industries. The invention has important application value.
Description
Technical Field
The invention belongs to the technical field of biology, and particularly relates to a method for detecting whether enterobacteriaceae bacteria contain tet (X) gene variants capable of mediating tigecycline drug resistance, wherein the tet (X) gene variants are tet (X4) drug resistance genes and/or tet (X6) drug resistance genes.
Background
Tigecycline is the first glycylcycline drug approved by the Food and Drug Administration (FDA) for clinical use, and is a new generation of tetracycline derivative obtained by modifying minocycline. Tigecycline has broad-spectrum and strong antibacterial activity, plays an important role in treating infections caused by carbapenem and colistin drug-resistant bacteria, and is currently listed as an important antibacterial drug for treating clinical multiple drug-resistant bacteria infections by WHO. However, with the clinical use of tigecycline, the problems of tigecycline resistance caused by tigecycline become more severe. Especially, the widespread prevalence of the novel transferable drug-resistance gene tet (X4) and tet (X6) capable of mediating high-level drug resistance of tigecycline, which is widely present in enterobacteriaceae in recent years, in livestock and poultry breeding has posed a serious threat to the development of animal husbandry and public health safety. To better control their spread, their prevalence should be monitored extensively. When monitoring is carried out, the rapid detection of these genes in situ becomes an important part. However, the conventional nucleic acid detection methods such as PCR and Sanger sequencing are time-consuming and labor-consuming, and cannot meet the requirement of rapid detection in the field.
In recent years, recombinase-mediated amplification (RAA) has received much attention from researchers because of its short amplification time and high detection sensitivity, and can be combined with lateral flow chromatography (LFD) detection for rapid nucleic acid detection. However, in the nucleic acid detection of drug-resistant genes, extraction of bacterial DNA is usually required, the traditional extraction method of the kit is time-consuming and labor-consuming (at least 1h), and a heavy centrifuge is required, so that the rapid operation on site is inconvenient.
Disclosure of Invention
The invention aims to detect tigecycline resistance of bacteria so as to prevent and control.
The invention firstly protects a reagent set which comprises an RAA upstream primer, an RAA downstream primer and an RAA probe;
the RAA upstream primer can be a single-stranded DNA molecule shown in SEQ ID NO. 1;
the RAA downstream primer can be a single-stranded DNA molecule shown in SEQ ID NO. 2;
the RAA probe sequentially comprises a DNA fragment A, tetrahydrofuran and a DNA fragment B from 5 'to 3';
the DNA fragment A can be a single-stranded DNA molecule shown in SEQ ID NO. 3;
the DNA fragment B can be a single-stranded DNA molecule shown in SEQ ID NO. 4;
the use of the kit may be a1) or a2) or a 3):
a1) detecting whether the sample to be tested contains tet (X) variants; the tet (X) variant is a tet (X4) drug resistance gene and/or a tet (X6) drug resistance gene;
a2) detecting tigecycline drug resistance;
a3) controlling bacteria that are tigecycline resistant.
The RAA probe may specifically consist of the DNA fragment a, tetrahydrofuran, and the DNA fragment b from 5 'to 3'.
In the RAA downstream primer, the 5' end can be provided with a biotin label.
The 5' end of the DNA fragment A can be modified by a fluorescent group FITC.
The 3' end of the DNA fragment B may have a phosphorylation modification.
The kit may specifically comprise any of the above-described RAA upstream primers, any of the above-described RAA downstream primers, and any of the above-described RAA probes.
Any one of the kits described above further comprising Chelex-100 lysis extract;
the Chelex-100 lysis extract can specifically consist of Chelex-100, TritonX-100 and TE buffer solution; in the Chelex-100 lysis extract, the proportion of Chelex-100, TritonX-100 and TE buffer solution can be 2.5 g: 500. mu.L: 50 mL.
Any one of the kits may specifically comprise any one of the RAA upstream primers, any one of the RAA downstream primers, any one of the RAA probes, and any one of the Chelex-100 lysis extracts.
The invention also provides the use of any one of the kits described above, which may be at least one of a1) -a 6):
a1) detecting whether the sample to be tested contains tet (X) variants;
a2) detecting tigecycline drug resistance;
a3) controlling bacteria that have tigecycline resistance;
a4) preparing a kit for detecting whether a sample to be tested contains a tet (X) variant;
a5) preparing a kit for detecting tigecycline drug resistance;
a6) preparing a kit for controlling bacteria with tigecycline drug resistance;
the tet (X) variant is a tet (X4) drug resistance gene and/or a tet (X6) drug resistance gene;
the use is for the diagnosis and treatment of non-diseases.
The invention also provides a kit containing any one of the kit of parts.
The invention also provides the application of a kit containing any one of the kit reagents, which can be at least one of a1) -a 3):
a1) detecting whether the sample to be tested contains tet (X) variants;
a2) detecting tigecycline drug resistance;
a3) controlling bacteria that have tigecycline resistance;
the tet (X) variant is a tet (X4) drug resistance gene and/or a tet (X6) drug resistance gene;
the use is for the diagnosis and treatment of non-diseases.
The invention also provides a method for detecting whether a sample to be tested contains or is suspected to contain a tet (X) variant, which comprises the following steps:
(1) adding any one of the above Chelex-100 lysis extract into a sample to be detected, resuspending, reacting at 90-100 deg.C (such as 90-95 deg.C, 95-100 deg.C, 90 deg.C, 95 deg.C or 100 deg.C) for 5-15min (such as 5-10min, 10-15min, 5min, 10min or 15min), and filtering for sterilization to obtain DNA of the sample to be detected;
(2) taking the DNA of the sample to be detected obtained in the step (1) as a template, and carrying out RAA by using any one of the RAA upstream primer, any one of the RAA downstream primer and any one of the RAA probe to obtain an RAA amplification product; then the following evaluations were made: if a positive signal is detectable for the RAA amplification product, the test sample contains or is suspected of containing a tet (X) variant; if the RAA amplification product does not detect a positive signal, the test sample does not contain or is suspected to contain the tet (X) variant;
the tet (X) variant is a tet (X4) drug resistance gene and/or a tet (X6) drug resistance gene;
if the sample to be tested contains tet (X) variant, the sample to be tested has or is suspected to have tigecycline drug resistance;
if the sample to be tested does not contain the tet (X) variant, the sample to be tested does not have or is suspected to have tigecycline drug resistance;
the method is used for the control of bacteria with tigecycline resistance.
In the above method, the RAA is carried out at 41 deg.C for 15 min.
The invention also provides a method for detecting whether the bacteria to be detected have tigecycline drug resistance, which comprises the following steps:
(1) adding any one of the above Chelex-100 lysis extract into bacteria to be tested, resuspending, reacting at 90-100 deg.C (such as 90-95 deg.C, 95-100 deg.C, 90 deg.C, 95 deg.C or 100 deg.C) for 5-15min (such as 5-10min, 10-15min, 5min, 10min or 15min), and filtering to remove bacteria to obtain DNA of bacteria to be tested;
(2) taking the DNA of the bacteria to be detected obtained in the step (1) as a template, and carrying out RAA by using any one of the RAA upstream primer, any one of the RAA downstream primer and any one of the RAA probe to obtain an RAA amplification product; then the following evaluations were made: if the RAA amplification product can detect a positive signal, the bacteria to be detected have or are suspected to have tigecycline drug resistance; if the RAA amplification product can not detect a positive signal, the bacteria to be detected do not have or are suspected to have tigecycline drug resistance;
the method is used for the control of bacteria with tigecycline resistance.
In the above method, the RAA is carried out at 41 ℃ for 15 min.
Any of the above bacteria may be a bacterium of the family Enterobacteriaceae.
As described above, the method of determining whether a positive signal is detected in the RAA amplification product may be: adding 150 mu L of PBS buffer solution and 1.5 mu L of gold nanoparticles marked with Anti-biotin (HRP conjugate) into a small hole of an enzyme label plate, and blowing and uniformly mixing by using a micropipette; then adding 25 mu L of RAA amplification product, and uniformly blowing and beating by using a micropipettor to obtain a solution to be detected; vertically inserting the tail end of a sample pad of the lateral flow chromatography test strip into a solution to be tested, taking out the lateral flow chromatography test strip after 5min, observing whether strips appear in a detection line and a quality control line, and judging as follows: if the quality control line has a strip and the detection line has no strip, the RAA amplification product can not detect a positive signal; if the detection line and the quality control line have strips, the RAA amplification product can detect a positive signal.
In order to achieve the purpose of rapid field detection of the tet (X4) drug-resistant gene and/or the tet (X6) drug-resistant gene, the inventor establishes a bacterial DNA extraction method without using a centrifugal machine based on a Chelex-100 lysis method through a large number of experiments, and further combines the bacterial DNA extraction method, RAA and lateral flow chromatography test paper to construct a rapid visual detection method of the tet (X4) drug-resistant gene and/or the tet (X6) drug-resistant gene. The detection method has the technical advantages of rapidness, high sensitivity, strong specificity and capability of carrying out on-site detection, and is suitable for monitoring the prevalence of tigecycline tet (X4) drug resistance genes and/or tet (X6) drug resistance genes in clinical and livestock and poultry breeding industries. The invention has important application value.
Drawings
FIG. 1 shows the results of screening for primer pairs in example 2
FIG. 2 shows the optimized result of the method for rapidly detecting whether the test sample contains tet (X4) drug resistance gene in step four of example 2. Wherein A is the optimized result of the reaction time, and B is the optimized result of the reaction temperature.
FIG. 3 shows the results of the specificity test in example 3.
FIG. 4 shows the results of detection of tet (X4) drug-resistant gene positive control solution 1-tet (X4) drug-resistant gene positive control solution 10 in example 4.
FIG. 5 shows the results of detection of tet (X6) drug-resistant gene positive control solution a-tet (X6) drug-resistant gene positive control solution j in example 4.
Detailed Description
The present invention is described in further detail below with reference to specific embodiments, which are given for the purpose of illustration only and are not intended to limit the scope of the invention. The examples provided below serve as a guide for further modifications by a person skilled in the art and do not constitute a limitation of the invention in any way.
The experimental procedures in the following examples, unless otherwise indicated, are conventional and are carried out according to the techniques or conditions described in the literature in the field or according to the instructions of the products. Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.
The RAA reaction kit is a product of Hangzhou mass testing biotechnology limited company. The RAA reaction unit tube, the RAA amplification reaction buffer solution and the magnesium acetate solution are all components in the RAA reaction kit.
Example 1 establishment of a bacterial DNA extraction method based on the Chelex-100 lysis method without using a centrifuge
Establishment of bacterial DNA extraction method without using centrifugal machine
The inventor establishes a bacterial DNA extraction method without using a centrifugal machine through a large number of experiments based on a Chelex-100 cracking method. The method comprises the following specific steps:
1. monoclonal bacterial colonies on solid media were scraped into centrifuge tubes using a blue inoculating loop.
2. After completion of step 1, the tube was removed, 200. mu.L of Chelex-100 lysis extract was added using a micropipette, vortexed for 30s, and resuspended thoroughly.
Chelex-100 lysis extract: 2.5g of Chelex-100 and 500. mu.L of TritonX-100 were added to 50mL of TE buffer, and vortexed to mix them well, thereby obtaining a Chelex-100 lysis extract.
3. After the step 2 is completed, the centrifuge tube is taken out and placed at 100 ℃ for reaction for 10 min.
4. And (3) after the step 3 is finished, using a 1mL syringe to extract the liquid in the centrifugal tube, then pulling out the needle of the syringe, inserting the syringe into a filtering membrane with the aperture of 0.45 mu m, and slowly pushing the piston of the syringe to filter the liquid into a new centrifugal tube to obtain the bacterial DNA.
5. After completion of step 4, OD of bacterial DNA was determined using NanoDrop260/OD280And OD260/OD230。
6. After completion of step 4, the bacterial DNA concentration was determined using a Qubit.
Secondly, extracting the bacterial DNA by adopting the method established in the step one
And (3) respectively extracting DNA of 95 strains of bacteria by adopting the method established in the step one.
Species, DNA concentration, OD of 95 strains of bacteria260/OD280And OD260/OD230The statistical results are shown in Table 1. The results show that the method established in step one can successfully extract bacterial DNA.
TABLE 1
Example 2 method for rapidly determining whether a bacterium of the Enterobacteriaceae family contains a tet (X4) resistance gene and/or a tet (X6) resistance gene capable of mediating high level resistance to tigecycline
Through a large number of experiments, the inventor of the invention combines the bacterial DNA extraction method, RAA and lateral flow chromatography test paper strips established in example 1 to establish a method for rapidly detecting whether the enterobacteriaceae bacteria contain a tet (X4) drug resistance gene and/or a tet (X6) drug resistance gene capable of mediating high-level drug resistance of tigecycline. The method comprises the following specific steps:
construction of gold nanoparticle-lateral flow chromatography test strip
1. Preparation of gold nanoparticles
The preparation method is characterized by adopting a method of reducing chloroauric acid by trisodium citrate and comprises the following steps:
(1) soaking the measuring cylinder, the magnetic stirrer and the round-bottom flask in an acid cylinder overnight, then sequentially washing with clear water and distilled water for three times, and finally washing with deionized water for three times.
(2) After the completion of the step (1), 186mL of deionized water was added to the cleaned round-bottom flask, 2mL of a 1% chloroauric acid solution was added thereto, and the mixture was heated and boiled using a magnetic stirrer.
(3) After the step (2) is finished, adding 12mL of trisodium citrate solution after the solution is boiled, continuing heating and boiling, and heating for 10min when the solution turns to wine red.
(4) After the step (3) is completed, the temperature of the solution is rapidly reduced to room temperature by using cold water, the solution in the flask is transferred to a 50mL centrifuge tube to obtain gold nanoparticles, and the gold nanoparticles are stored at 4 ℃ for later use.
2. Preparation of Anti-biotin (HRP conjugate) -labeled gold nanoparticles
(1) Draw 1mL of prepared gold nanoparticles into a 1.5mL centrifuge tube using 0.02M K2CO3The pH of the solution is adjusted to 8.2-8.5.
(2) After completion of step (1), 30. mu.L of Anti-biotin (HRP conjugate) (Cell Signaling Technology, cat. No.: 5571S) was added and vortexed.
(3) After the step (2) is completed, standing for 1h, adding 200 mu L of 10% BSA solution, uniformly mixing by vortex, and standing for 1 h.
(4) After completion of step (3), the mixture was centrifuged at 11000rpm at 4 ℃ for 10min, and the supernatant was discarded.
(5) After completing step (4), 100. mu.L of concentrated sample diluent (Beijing Vierweikang Biotechnology Co., Ltd., product number: B-KITW.006.03.01) was added to resuspend the precipitate, to obtain Anti-biotin (HRP conjugate) -labeled gold nanoparticles, and the gold nanoparticles were stored at 4 ℃.
3. Assembly and cutting of lateral flow chromatography test strip
(1) A test strip scriber (Shanghai gold-labeled Biotechnology Co., Ltd., product number: HM3035) is used for marking FITC antibody (Proteintech, product number is 80003-1-RR) and goat anti-rabbit IgG antibody (Jackson ImmunoResearch, product number is 111-005-003-one) at the detection line and quality control line positions of the nitrocellulose membrane at the speed of 1 muL/cm, and the antibodies are naturally dried.
(2) And (2) after the step (1) is completed, assembling the sample pad, the nitrocellulose membrane and the absorbent pad on the PVC backboard in sequence, and enabling the solution to be smoothly chromatographed on the test strip by the 2mm overlapping width flowing out of each part.
The sample pad, nitrocellulose membrane, absorbent pad, and PVC backing were all purchased from shanghai gold-labeled biotechnology limited.
(3) After the completion of step (2), the assembled lateral flow chromatography test strip was cut into a finished product of 3mm width using a programmable slitter (Shanghai gold-labeled Biotech Co., Ltd., product number: ZQ 4000).
Second, construction of tet (X) variant positive control bacterium capable of mediating high-level drug resistance of tigecycline
1. Using tet (X4) drug-resistant gene (Genebank number: NG _065852.1) as a template, and adopting tet (X) universal primers: tet (X) -F: 5'-CCGTTGGACTGACTATGGC-3' (SEQ ID NO:11) and tet (X) -R: 5'-TCAACTTGCGTGTCGGTAA-3' (SEQ ID NO:12) to obtain a PCR amplification product.
2. And (3) after the step 1 is finished, taking the PCR amplification product, and purifying by using a gel recovery kit to obtain a purified sequence.
3. After completion of step 2, the purified sequence was ligated with plasmid pACYC184 (Changsha Aibi vitamin science and technology Co., Ltd., catalog No. HG-VKN0287) to obtain recombinant plasmid pACYC184-tet (X4).
4. The recombinant plasmid pACYC184-tet (X4) is transformed into Escherichia coli DH5 alpha to obtain recombinant Escherichia coli.
5. And respectively inoculating the recombinant escherichia coli monoclonals to 1mL of LB liquid culture medium, and culturing overnight at 37 ℃ to obtain corresponding bacterial liquids.
6. Respectively taking the bacterial liquid obtained in the step 5 as a template, and carrying out PCR amplification by using a primer pair consisting of tet (X) -F and tet (X) -R to obtain a PCR amplification product; the PCR amplification product was then sequenced. If the sequencing result of the PCR amplification product of a certain monoclonal is shown as SEQ ID NO. 13, the monoclonal is identified as a positive clone A.
13 is SEQ ID NO
ccgttggactgactatggcaaaattattacagcaaaacggcatagacgtttcagtttacgaaagagacaacgaccgagaggcaagaatttttggtggaacccttgacctacacaaaggttcaggtcaggaagcaatgaaaaaagcgggattgttacaaacttattatgacttagccttaccaatgggtgtaaatattgctgatgaaaaaggcaatattttatccacaaaaaatgtaaagcccgaaaatcgatttgacaatcctgaaataaacagaaatgacttaagggctatcttgttgaatagtttagaaaacgacacggttatttgggatagaaaacttgttatgcttgaacctggtaagaagaagtggacactaacttttgagaataaaccgagtgaaacagcagatctggttattattgccaatggtggaatgtctaaagtaagaaaatttgttaccgacacggaagttga
According to the above steps, the tet (X4) drug-resistant gene was replaced with the tet (X6) drug-resistant gene (Genebank number: BK011183.1), and the other steps were not changed to obtain the positive clone B.
Preparation of kit for detecting tet (X) variant (tet (X4) drug resistance gene and/or tet (X6) drug resistance gene) capable of mediating high-level drug resistance of tigecycline
1. Synthesis of RAA primers and probes
The tet (X4) drug-resistant gene and the tet (X6) drug-resistant gene were used as target genes. Primers and probes based on the RAA technique were designed and synthesized based on the nucleotide sequences of the tet (X4) resistance gene and the conserved region of the tet (X6) resistance gene. Two groups were synthesized.
The first group consists of an RAA upstream primer 1, an RAA downstream primer 1 and an RAA probe 1, and the nucleotide sequences are as follows:
RAA upstream primer 1: 5'-CCGACAATATCAAGGCATCCATCAACCCGC-3' (SEQ ID NO: 1).
RAA downstream primer 1: 5 '-Biotin-CTACAAAGAACTGATTCGTGTGACATCATC-3' (SEQ ID NO: 2).
RAA Probe 1: 5' -FITC-GAGGCATCAAATGAGCAGCATCTCCAATCA (SEQ ID NO:3)
(THF)CGTTATGGGTAATGGACGC(SEQ ID NO:4)(C3 spacer)-3’(SEQ ID NO:4)。
The second group consists of an RAA upstream primer 2, an RAA downstream primer 2 and an RAA probe 2, and the nucleotide sequences are as follows:
RAA upstream primer 2: 5'-CTGGATGATGAATATCGGCTTGTATATTGA-3' (SEQ ID NO: 5).
RAA downstream primer 2: 5'-GCTTGAACCTGGTAAGAAGAAGTGGACACT-3' (SEQ ID NO: 6).
RAA Probe 2: 5' -FITC-ACATTCCACCATTGGCAATAATAACCAGAT (SEQ ID NO:7)
(THF)TGCTGTTTCACTCGGTTTA(C3 spacer)-3’(SEQ ID NO:8)。
In the RAA downstream primer 1 and the RAA downstream primer 2, the 5' end is labeled with Biotin (Biotin).
In the RAA probe 1 and the RAA probe 2, the 5' end is modified by a fluorescent group FITC; THF is a tetrahydrofuran residue and is a recognition site of endonuclease nfo; the 3' end is modified by phosphorylation (C3-spacer) and is used for blocking the extension of DNA chain.
On tet (X) variant (tet (X4) drug-resistant gene and/or tet (X6) drug-resistant gene), RAA upstream primer 1 and RAA downstream primer 1 are used for amplification to obtain amplification product 1. The nucleotide sequence of the amplification product 1 is shown as SEQ ID NO. 9; and (3) amplifying by adopting an RAA upstream primer 2 and an RAA downstream primer 2 to obtain an amplification product 2. The nucleotide sequence of the amplification product 2 is shown as SEQ ID NO. 10.
CCGACAATATCAAGGCATCCATCAACCCGCTGTTTACGCCTTGTCCTGCAAAAGGAGGCATCAAATGAGCAGCATCTCCAATCATCGTTATGGGTAATGGACGCTTACTTTTCCAAGACTTACCTAAGGGAAATATTCGTGTCGCTAACCCTACAAAAGATGATGTCACACGAATCAGTTCTTTGTAG(SEQ ID NO:9)CTGGATGATGAATATCGGCTTGTATATTGAAAGTACCTGTTTCTTCAACTTCCGTGTCGGTAACAATTTTCTTACTTTAGACATTCCACCATTGGCAATAATAACCAGATCTGCTGTTTCACTCGGTTTATTCTCAAAAGTTAGTGTCCACTTCTTCTTACCAGGTTCAAGC(SEQ ID NO:10)
2. Screening of RAA primers and probes
(1) Preparation of RAA amplification system 1: to the RAA reaction unit tube was added 12.5. mu.L of RAA amplification reaction buffer (for the purpose of dissolving the lyophilized enzyme components in the tube), after which 25.4. mu.L of nuclease-free water, 2. mu.L of aqueous RAA forward primer 1 solution (concentration of 250nM), 2. mu.L of aqueous RAA reverse primer 1 solution (concentration of 250nM), 0.6. mu.L of LRAA probe 1 (concentration of 125nM) and 5. mu.L of nuclease-free water were added at once to the RAA reaction unit tube, and 2.5. mu.L of magnesium acetate solution (concentration of 280mM) was added to the cap of the reaction unit tube, and the reaction unit tube was covered with the cap, and mixed by inverting upside down. Then, the reaction was carried out at 39 ℃ for 15min (RAA amplification was carried out) to obtain RAA amplification product 1.
According to the steps, the RAA upstream primer 1 is replaced by the RAA upstream primer 2, the RAA downstream primer 1 is replaced by the RAA downstream primer 2, the RAA probe 1 is replaced by the RAA probe 2, and other steps are not changed, so that the RAA amplification product 2 is obtained.
(2) After the step (1) is completed, adding 150 mu L of PBS buffer solution and 1.5 mu L of gold nanoparticles marked with Anti-biotin (HRP conjugate) into the small hole of the enzyme label plate, and blowing and uniformly mixing by using a micropipette; then adding 25 mu L of RAA amplification product (RAA amplification product 1 or RAA amplification product 2), and uniformly blowing by using a micropipette to obtain a solution to be detected; vertically inserting the tail end of a sample pad of the lateral flow chromatography test strip into a solution to be tested, taking out the lateral flow chromatography test strip after 5min, observing whether strips appear in a detection line and a quality control line, and judging as follows: if the control line shows a band and the detection line does not show a band, the RAA primers and the probes can be used for detecting tet (X) variants; if bands appear on both the detection line and the quality control line, the RAA primers and probes are not useful for detecting tet (X) variants.
The results of the assay are shown in FIG. 1 (from left to right, designated as 1, 2, 3 and 4, with 1 and 2 being the results of the first group and 3 and 4 being the results of the second group). The results show that the first group consisting of the RAA upstream primer 1, the RAA downstream primer 1 and the RAA probe 1 can be used to detect tet (X) variants, namely tet (X4) resistance genes and/or tet (X6) resistance genes.
3. Preparation of a kit for detecting tet (X) variants mediating high levels of drug resistance to tigecycline
The kit for detecting tet (X) variant capable of mediating high-level drug resistance of tigecycline consists of RAA upstream primer 1, RAA downstream primer 1 and RAA probe 1. The primers and probes are packaged separately.
Optimization of method for rapidly detecting whether to-be-detected sample contains tet (X) variant capable of mediating high-level drug resistance of tigecycline
1. The bacterial DNA of the constructed positive clone A or positive clone B is extracted by the method established in the embodiment 1 to obtain a positive control amplification template.
2. Preparing RAA amplification system. The method comprises the following specific steps: after 12.5. mu.L of RAA amplification reaction buffer (for the purpose of dissolving the lyophilized enzyme components in the tube) was added to the RAA reaction unit tube, 25.4. mu.L of nuclease-free water, 2. mu.L of an aqueous solution of RAA forward primer 1 (at a concentration of 250nM), 2. mu.L of an aqueous solution of RAA reverse primer 1 (at a concentration of 250nM), 0.6. mu.L of RAA probe 1 (at a concentration of 125nM) and 5. mu.L of positive control amplification template were added to the RAA reaction unit tube at once, 2.5. mu.L of a magnesium acetate solution (at a concentration of 280mM) was added to the cap of the reaction unit tube, the cap of the reaction unit tube was covered, and the mixture was inverted upside down.
3. Optimization of RAA reaction time
(1) And (3) taking the RAA amplification system prepared in the step (2), and reacting at 39 ℃ for 10, 15, 20, 25 or 30min (carrying out RAA amplification) to obtain an RAA amplification product.
(2) After the step (1) is completed, adding 150 mu L of PBS buffer solution and 1.5 mu L of gold nanoparticles marked with Anti-biotin (HRP conjugate) into the small hole of the enzyme label plate, and blowing and uniformly mixing by using a micropipette; then adding 25 mu L of RAA amplification product, and uniformly blowing and beating by using a micropipettor to obtain a solution to be detected; vertically inserting the tail end of a sample pad of the lateral flow chromatography test strip into a solution to be tested, taking out the lateral flow chromatography test strip after 5min, and detecting a signal of a detection line of the lateral flow chromatography test strip by using a test strip colorimetric signal detector (Qiagen, ESEQuantlr 3).
The results are shown in FIG. 2A. The result shows that when the reaction time is 15min, the signal intensity of the detection line of the lateral flow chromatography test strip is strongest. Therefore, the optimum time for carrying out the RAA reaction is 15 min.
4. Optimization of RAA reaction temperature
(1) And (3) taking the RAA amplification system prepared in the step (2), and reacting for 15min at 35, 37, 39, 41 or 43 ℃ (carrying out RAA amplification) to obtain an RAA amplification product.
(2) After the step (1) is completed, adding 150 mu L of PBS buffer solution and 1.5 mu L of gold nanoparticles marked with Anti-biotin (HRP conjugate) into the small hole of the enzyme label plate, and blowing and uniformly mixing by using a micropipette; then adding 25 mu L of RAA amplification product, and uniformly blowing and beating by using a micropipettor to obtain a solution to be detected; vertically inserting the tail end of a sample pad of the lateral flow chromatography test strip into a solution to be tested, taking out the lateral flow chromatography test strip after 5min, and detecting a signal of a detection line of the lateral flow chromatography test strip by using a test strip colorimetric signal detector.
The detection result is shown in B in FIG. 2. The result shows that when the reaction temperature is 41 ℃, the signal intensity of the detection line of the lateral flow chromatography test strip is strongest. Therefore, the optimum temperature for the RAA reaction is 41 ℃.
Finally, the optimized RAA amplification reaction conditions are: the reaction temperature is 41 ℃, and the reaction time is 15 min.
The optimal detection conditions are the same because the same set of reagents is used for detecting the tet (X4) drug-resistant gene and the tet (X6) drug-resistant gene.
Establishment of method for rapidly detecting whether to-be-detected sample (to-be-detected bacteria) contains tet (X) variant
The inventor establishes a method for rapidly detecting whether a sample (bacteria to be detected) contains tet (X) variants through a large number of experiments. The method comprises the following specific steps:
1. the DNA of the bacteria to be tested was extracted by the method established in example 1.
2. Preparing RAA amplification system. The method comprises the following specific steps: after 12.5. mu.L of RAA amplification reaction buffer was added to the RAA reaction unit tube, 25.4. mu.L of nuclease-free water, 2. mu.L of an aqueous solution of RAA forward primer 1 (concentration: 250nM), 2. mu.L of an aqueous solution of RAA reverse primer 1 (concentration: 250nM), 0.6. mu.L of RAA probe 1 (concentration: 125nM) and 5. mu.L of the DNA of the bacterium to be tested were added to the cap of the reaction unit tube, 2.5. mu.L of a magnesium acetate solution (280mM) was applied to the cap of the reaction unit tube, and the reaction unit tube was covered and mixed upside down.
3. And (3) taking the RAA amplification system prepared in the step (2), and reacting for 15min at 41 ℃ to obtain an RAA amplification product.
4. After the step 3 is completed, adding 150 mu L of PBS buffer solution and 1.5 mu L of gold nanoparticles marked with Anti-biotin (HRP conjugate) into the small hole of the enzyme label plate, and blowing and uniformly mixing by using a micropipette; then adding 25 mu L of RAA amplification product, and uniformly blowing and beating by using a micropipettor to obtain a solution to be detected; vertically inserting the tail end of a sample pad of the lateral flow chromatography test strip into a solution to be tested, taking out the lateral flow chromatography test strip after 5min, observing whether strips appear in a detection line and a quality control line, and judging as follows:
if the quality control line and the detection line both have strips, the existence of tet (X) variant in the solution to be detected is indicated, namely the existence of tet (X) variant in the bacteria to be detected;
if the quality control line has a strip and the detection line does not have a strip, the tet (X) variant does not exist in the solution to be detected, namely the tet (X) variant does not exist in the bacteria to be detected;
if the quality control line does not have a strip, the lateral flow chromatography test strip is invalid, and the lateral flow chromatography test strip needs to be replaced for retesting.
Example 3, specific detection of the method established in example 2
The method established in the fifth step of example 2 was used to detect whether the test bacteria 1-7 contained tet (X) variants.
The bacterial species and the drug resistance genes of the bacteria 1 to 7 to be detected are shown in Table 2, and the bacteria 3 to 7 to be detected do not contain tet (X) variant.
The bacterium 1 to be tested is the positive clone A constructed in the second step of the example 2.
The bacterium 2 to be tested is the positive clone B constructed in the second step of the example 2.
The bacteria to be tested 3 are described in the following documents: a Multiplex SYBR Green Real-Time PCR Assay for the Detection of ThreeColistin Resistance Genes from Cultured Bacteria, Feces, and environmental samples the strain numbers in the literature are: DH5 a-mcr-1.
The bacteria 4 to be tested are described in the following documents: the following strains in the literature are numbered: E1189.
the bacteria 5 to be tested are described in the following documents: the strains in the literature are numbered as follows: kp 1.
TABLE 2
| Strain numbering | Bacterial species | |
|
| 1 | Escherichia coli | tet(X4) | |
| 2 | Escherichia coli | tet(X6) | |
| 3 | Escherichia coli | mcr-1 | |
| 4 | Escherichia coli | blaNDM | |
| 5 | | bla | KPC |
| 6 | Escherichia coli ATCC25922 | - | |
| 7 | Klebsiella pneumoniae ATCC13883 | - |
Note: "-" indicates that no drug resistance gene is contained.
The detection result is shown in FIG. 3 (from left to right, bacteria to be detected 1 to bacteria to be detected 7). The result shows that the quality control line (C) and the detection line (T) of the lateral flow chromatography test strip are banded only when the bacteria to be tested contain tet (X) variant (tet (X4) drug-resistant gene or tet (X6) drug-resistant gene) capable of mediating the drug resistance of the bacteria in the enterobacteriaceae to tigecycline; the rest bacteria to be detected which do not contain the tet (X4) drug-resistant gene or the tet (X6) drug-resistant gene have bands on the quality control line and no band on the detection line. It can be seen that the method established in step five of example 2 has good specificity for the detection of tet (x) variants which mediate tigecycline resistance in bacteria of the enterobacteriaceae family.
Example 4, sensitivity detection of the method established in example 2
1. The DNA of the positive clone A in step two was extracted by the method established in example 1 to obtain a copy number of 7.63X 109copies/. mu.L of tet (X4) drug resistance gene positive control solution 1. The DNA of the positive clone B in step two was extracted by the method established in example 1 to obtain a copy number of 6.43X 109copies/. mu.L of tet (X6) drug-resistant gene positive control solution a.
2. Taking tet (X4) drug-resistant gene positive control solution 1, and performing 10-fold serial dilution with sterile water to obtain the copy number of 7.63 × 108copy number of tep (X4) drug-resistant gene positive control solution 2 of copies/. mu.L of 7.63X 107copy number of tep (X4) drug-resistant gene positive control solution 3 of copies/. mu.L of 7.63X 106copy number of tep (X4) drug-resistant gene positive control solution 4 of copies/μ L of 7.63X 105copies/. mu.L of tet: (X4) Positive control solution 5 for drug-resistant Gene with copy number of 7.63X 104copy number of the tep (X4) drug-resistant gene positive control solution 6 of copies/μ L of 7.63X 103A tet (X4) drug-resistant gene positive control solution 7 with copies/μ L, a tet (X4) drug-resistant gene positive control solution 8 with a copy number of 763copies/μ L, a tet (X4) drug-resistant gene positive control solution 9 with a copy number of 76.3copies/μ L, and a tet (X4) drug-resistant gene positive control plasmid solution 10 with a copy number of 7.63copies/μ L. Taking tet (X6) drug-resistant gene positive control solution a, and carrying out 10-fold serial dilution by using sterile water to obtain the copy number of 6.43 multiplied by 108copy number of the positive control solution b of the drug-resistant gene (tet (X6)) in copies/. mu.L of 6.43X 107copy number of tet (X6) drug-resistant gene positive control solution c of copies/. mu.L of 6.43X 106copies/. mu.L of tet (X6) drug-resistant gene positive control solution d with copy number of 6.43X 105copy number of 6.43X 10 for the tet (X6) drug-resistant gene positive control solution e4copy number of 6.43X 10 for the positive control solution f of the drug-resistant gene tet (X6) of copies/. mu.L3A tet (X6) drug-resistant gene positive control solution g with copies/mu L, a tet (X6) drug-resistant gene positive control solution h with copy number of 643 copies/mu L, a tet (X6) drug-resistant gene positive control solution i with copy number of 64.3 copies/mu L, and a tet (X6) drug-resistant gene positive control solution j with copy number of 6.43 copies/mu L.
3. Respectively detecting whether tet (X4) drug-resistant gene positive control solution 1-tet (X4) drug-resistant gene positive control plasmid 10 contains tet (X) variant (using deionized water as negative control) by adopting the method established in the fifth step in the example 2; detecting whether tet (X6) drug-resistant gene positive control solution a-tet (X6) drug-resistant gene positive control solution j contains tet (X) variant (using deionized water as negative control)
The sensitivity test results are shown in FIG. 4(1-10 are tet (X4) drug-resistant gene positive control solution 1-tet (X4) drug-resistant gene positive control solution 10, 11 is negative control) and FIG. 5 (tet (X6) drug-resistant gene positive control solution a-tet (X6) drug-resistant gene positive control solution j and negative control from left to right). The result shows that the sensitivity of the method established in the fifth step in the example 2 for detecting the tet (X4) drug-resistant gene is 7.63 copies/mu L, and the method can meet the requirement of detecting the tet (X4) drug-resistant gene with lower copy number; the sensitivity for detecting the tet (X6) drug-resistant gene is 6.43 copies/mu L, and the requirement of detecting the tet (X6) drug-resistant gene with lower copy number can be met.
Practical application of the methods established in examples 5and 2
The tested bacteria are 95 clinically isolated bacteria, and the detection is carried out by a conventional PCR method, wherein 22 strains of the 95 bacteria have tet (X4) drug-resistant genes, 3 strains have tet (X6) drug-resistant genes, and 70 strains do not have tet (X) variant (tet (X4) drug-resistant genes and/or tet (X6) drug-resistant genes).
1. The method established in step five of example 2 was used to test whether 95 strains of bacteria contained tet (X) variants.
The results are shown in Table 3.
TABLE 3
2. The sensitivity and specificity of the method established in step five of example 2 were calculated according to the following formulas.
Sensitivity (true positive number)/(true positive number + false negative number).
Specificity ═ (number of true negatives)/(number of true negatives + number of false positives).
The results show that the sensitivity of the method established in step five of example 2 is 92% (23/(23+2)) and the specificity is 100% (70/70). It can thus be seen that the method established in step five of example 2 can be used for the clinical testing of tet (x) variants which mediate high levels of tigecycline resistance in bacteria of the enterobacteriaceae family.
The results show that the bacterial DNA extraction method based on the Chelex-100 lysis method established in the example 1 is simple and convenient to operate, the bacterial DNA can be extracted within 20min, and the extracted DNA can be used for subsequent nucleic acid amplification detection. The method for rapidly detecting whether the sample to be detected contains the tet (X) variant capable of mediating the high-level drug resistance of the enterobacteriaceae bacteria to the tigecycline or not, which is established in the fifth step in the embodiment 2, has the advantages of strong specificity, high sensitivity and high accuracy, can rapidly and visually detect the tet (X) variant capable of mediating the high-level drug resistance of the enterobacteriaceae bacteria to the tigecycline on site, and has a wide application prospect.
The present invention has been described in detail above. It will be apparent to those skilled in the art that the invention can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the invention and without undue experimentation. While the invention has been described with reference to specific embodiments, it will be appreciated that the invention can be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains. The use of some of the essential features is possible within the scope of the claims attached below.
<110> university of agriculture in China
<120> a method for detecting the presence or absence of a tet (X) gene variant capable of mediating tigecycline resistance in a bacterium of the Enterobacteriaceae family
<160> 13
<170> PatentIn version 3.5
<210> 1
<211> 30
<212> DNA
<213> Artificial sequence
<400> 1
ccgacaatat caaggcatcc atcaacccgc 30
<210> 2
<211> 30
<212> DNA
<213> Artificial sequence
<400> 2
ctacaaagaa ctgattcgtg tgacatcatc 30
<210> 3
<211> 30
<212> DNA
<213> Artificial sequence
<400> 3
gaggcatcaa atgagcagca tctccaatca 30
<210> 4
<211> 19
<212> DNA
<213> Artificial sequence
<400> 4
cgttatgggt aatggacgc 19
<210> 5
<211> 30
<212> DNA
<213> Artificial sequence
<400> 5
ctggatgatg aatatcggct tgtatattga 30
<210> 6
<211> 30
<212> DNA
<213> Artificial sequence
<400> 6
gcttgaacct ggtaagaaga agtggacact 30
<210> 7
<211> 30
<212> DNA
<213> Artificial sequence
<400> 7
acattccacc attggcaata ataaccagat 30
<210> 8
<211> 19
<212> DNA
<213> Artificial sequence
<400> 8
tgctgtttca ctcggttta 19
<210> 9
<211> 188
<212> DNA
<213> Artificial sequence
<400> 9
ccgacaatat caaggcatcc atcaacccgc tgtttacgcc ttgtcctgca aaaggaggca 60
tcaaatgagc agcatctcca atcatcgtta tgggtaatgg acgcttactt ttccaagact 120
tacctaaggg aaatattcgt gtcgctaacc ctacaaaaga tgatgtcaca cgaatcagtt 180
ctttgtag 188
<210> 10
<211> 172
<212> DNA
<213> Artificial sequence
<400> 10
ctggatgatg aatatcggct tgtatattga aagtacctgt ttcttcaact tccgtgtcgg 60
taacaatttt cttactttag acattccacc attggcaata ataaccagat ctgctgtttc 120
actcggttta ttctcaaaag ttagtgtcca cttcttctta ccaggttcaa gc 172
<210> 11
<211> 19
<212> DNA
<213> Artificial sequence
<400> 11
ccgttggact gactatggc 19
<210> 12
<211> 19
<212> DNA
<213> Artificial sequence
<400> 12
tcaacttccg tgtcggtaa 19
<210> 13
<211> 475
<212> DNA
<213> Artificial sequence
<400> 13
ccgttggact gactatggca aaattattac agcaaaacgg catagacgtt tcagtttacg 60
aaagagacaa cgaccgagag gcaagaattt ttggtggaac ccttgaccta cacaaaggtt 120
caggtcagga agcaatgaaa aaagcgggat tgttacaaac ttattatgac ttagccttac 180
caatgggtgt aaatattgct gatgaaaaag gcaatatttt atccacaaaa aatgtaaagc 240
ccgaaaatcg atttgacaat cctgaaataa acagaaatga cttaagggct atcttgttga 300
atagtttaga aaacgacacg gttatttggg atagaaaact tgttatgctt gaacctggta 360
agaagaagtg gacactaact tttgagaata aaccgagtga aacagcagat ctggttatta 420
ttgccaatgg tggaatgtct aaagtaagaa aatttgttac cgacacggaa gttga 475
Claims (10)
1. A kit comprising a RAA upstream primer, a RAA downstream primer and a RAA probe;
the RAA upstream primer is a single-stranded DNA molecule shown in SEQ ID NO. 1;
the RAA downstream primer is a single-stranded DNA molecule shown in SEQ ID NO. 2;
the RAA probe sequentially comprises a DNA fragment A, tetrahydrofuran and a DNA fragment B from 5 'to 3';
the DNA fragment A is a single-stranded DNA molecule shown in SEQ ID NO. 3;
the DNA fragment B is a single-stranded DNA molecule shown in SEQ ID NO. 4;
the use of the kit is a1) or a2) or a 3):
a1) detecting whether the sample to be tested contains tet (X) variants; the tet (X) variant is a tet (X4) drug resistance gene and/or a tet (X6) drug resistance gene;
a2) detecting tigecycline drug resistance;
a3) controlling bacteria that are tigecycline resistant.
2. The kit of claim 1, wherein:
in the RAA downstream primer, a biotin label is arranged at the 5' end;
the 5' end of the DNA fragment A is modified by a fluorescent group FITC;
the 3' terminal of the DNA fragment B has phosphorylation modification.
3. The kit of claim 1, wherein: the kit also comprises Chelex-100 lysis extract;
the Chelex-100 lysis extract consists of Chelex-100, TritonX-100 and TE buffer solution; in the Chelex-100 lysis extract, the proportion of Chelex-100, TritonX-100 and TE buffer solution is 2.5 g: 500. mu.L: 50 mL.
4. Use of a kit according to any of claims 1 to 3, at least one of a1) -a 6):
a1) detecting whether the sample to be tested contains tet (X) variants;
a2) detecting tigecycline drug resistance;
a3) controlling bacteria that have tigecycline resistance;
a4) preparing a kit for detecting whether a sample to be tested contains a tet (X) variant;
a5) preparing a kit for detecting tigecycline drug resistance;
a6) preparing a kit for controlling bacteria with tigecycline drug resistance;
the tet (X) variant is a tet (X4) drug resistance gene and/or a tet (X6) drug resistance gene;
the use is for the diagnosis and treatment of non-diseases.
5. A kit comprising a kit of parts according to any one of claims 1 to 3.
6. The use of the kit of claim 5, being at least one of a1) -a 3):
a1) detecting whether the sample to be tested contains tet (X) variants;
a2) detecting tigecycline drug resistance;
a3) controlling bacteria that have tigecycline resistance;
the tet (X) variant is a tet (X4) drug resistance gene and/or a tet (X6) drug resistance gene;
the use is for the diagnosis and treatment of non-diseases.
7. A method of detecting whether a test sample contains or is suspected of containing a tet (x) variant, comprising the steps of:
(1) adding Chelex-100 lysis extract in claim 3 into a sample to be tested, resuspending, reacting for 5-15min at 90-100 ℃, and then filtering and sterilizing to obtain DNA of the sample to be tested;
(2) RAA is carried out by using the DNA of the sample to be detected obtained in the step (1) as a template and the RAA upstream primer, the RAA downstream primer and the RAA probe in the claim 1 or 2 to obtain an RAA amplification product; then the following evaluations were made: if a positive signal is detectable for the RAA amplification product, the test sample contains or is suspected of containing a tet (X) variant; if the RAA amplification product does not detect a positive signal, the test sample does not contain or is suspected to contain the tet (X) variant;
the tet (X) variant is a tet (X4) drug resistance gene and/or a tet (X6) drug resistance gene;
if the sample to be tested contains tet (X) variant, the sample to be tested has or is suspected to have tigecycline drug resistance;
if the sample to be tested does not contain the tet (X) variant, the sample to be tested does not have or is suspected to have tigecycline drug resistance;
the method is used for the control of bacteria with tigecycline resistance.
8. The method of claim 7, wherein: the RAA was carried out at 41 ℃ for 15 min.
9. A method for detecting whether a bacterium to be detected has tigecycline drug resistance comprises the following steps:
(1) adding Chelex-100 lysis extract in claim 3 into bacteria to be detected, resuspending, reacting at 90-100 ℃ for 5-15min, and filtering for sterilization to obtain DNA of the bacteria to be detected;
(2) RAA is carried out by using the DNA of the bacteria to be detected obtained in the step (1) as a template and the RAA upstream primer, the RAA downstream primer and the RAA probe in the claim 1 or 2 to obtain an RAA amplification product; then the following evaluations were made: if the RAA amplification product can detect a positive signal, the bacteria to be detected have or are suspected to have tigecycline drug resistance; if the RAA amplification product can not detect a positive signal, the bacteria to be detected do not have or are suspected to have tigecycline drug resistance;
the method is used for the control of bacteria with tigecycline resistance.
10. The method of claim 9, wherein: the RAA was carried out at 41 ℃ for 15 min.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111440024.5A CN114032318B (en) | 2021-11-30 | 2021-11-30 | Method for detecting whether enterobacteriaceae bacteria contain tet (X) gene variant capable of mediating tigecycline drug resistance |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111440024.5A CN114032318B (en) | 2021-11-30 | 2021-11-30 | Method for detecting whether enterobacteriaceae bacteria contain tet (X) gene variant capable of mediating tigecycline drug resistance |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114032318A true CN114032318A (en) | 2022-02-11 |
| CN114032318B CN114032318B (en) | 2023-06-09 |
Family
ID=80145929
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111440024.5A Active CN114032318B (en) | 2021-11-30 | 2021-11-30 | Method for detecting whether enterobacteriaceae bacteria contain tet (X) gene variant capable of mediating tigecycline drug resistance |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114032318B (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103160499A (en) * | 2013-04-11 | 2013-06-19 | 上海市普陀区人民医院 | Method for extracting methicillin-resistant staphylococcus aureus DNA (Deoxyribonucleic Acid) |
| CN110257509A (en) * | 2019-08-02 | 2019-09-20 | 浙江大学 | Tigecycline drug resistant gene family tetX multiple PCR detection kit |
| CN110257562A (en) * | 2019-07-31 | 2019-09-20 | 河北农业大学 | A kind of the primer and probe combination and its application of RAA-LFD detection avian infectious laryngotracheitis virus |
| CN112760390A (en) * | 2019-11-05 | 2021-05-07 | 中国农业大学 | Fluorescent quantitative PCR primer composition for detecting tigecycline drug resistance gene tet (X) and variants thereof and application thereof |
-
2021
- 2021-11-30 CN CN202111440024.5A patent/CN114032318B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103160499A (en) * | 2013-04-11 | 2013-06-19 | 上海市普陀区人民医院 | Method for extracting methicillin-resistant staphylococcus aureus DNA (Deoxyribonucleic Acid) |
| CN110257562A (en) * | 2019-07-31 | 2019-09-20 | 河北农业大学 | A kind of the primer and probe combination and its application of RAA-LFD detection avian infectious laryngotracheitis virus |
| CN110257509A (en) * | 2019-08-02 | 2019-09-20 | 浙江大学 | Tigecycline drug resistant gene family tetX multiple PCR detection kit |
| CN112760390A (en) * | 2019-11-05 | 2021-05-07 | 中国农业大学 | Fluorescent quantitative PCR primer composition for detecting tigecycline drug resistance gene tet (X) and variants thereof and application thereof |
Non-Patent Citations (2)
| Title |
|---|
| DONG ET AL: "Prevalence, transmission, and molecular epidemiology of tet(X)-positive bacteria among humans, animals, and environmental niches in China: An epidemiological, and genomic-based study.", 《SCI TOTAL ENVIRON.》 * |
| 孙晓红等: "重组酶等温扩增技术在分析检测中的应用研究进展", 《食品与发酵工业》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN114032318B (en) | 2023-06-09 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Fang et al. | Comparison of real-time, quantitative PCR with molecular beacons to nested PCR and culture methods for detection of Mycobacterium avium subsp. paratuberculosis in bovine fecal samples | |
| CN110551846B (en) | Cpf1 kit for quickly detecting African swine fever virus nucleic acid and detection method thereof | |
| Lucas et al. | High frequency of histamine-producing bacteria in the enological environment and instability of the histidine decarboxylase production phenotype | |
| CN104946749B (en) | A kind of universal primer for field quick detection brucella and probe and kit | |
| CN112159854B (en) | Primer composition for detecting CRISPR/Cas12a of escherichia coli O157-H7 and detection method | |
| CN104862405A (en) | Primer, probe and reagent kit for identifying Brucella S2 vaccine strains in aerocolloid | |
| CN104862406A (en) | Primer and probe for on-site rapid detection of mycobacterium tuberculosis complex and kit thereof | |
| CN109913565B (en) | Kit, primer pair, probe and method for detecting vibrio parahaemolyticus | |
| CN110004250A (en) | A kind of African swine fever virus LAMP visual detection kit | |
| CN111187862A (en) | Recombinase-based micropterus salmoides rhabdovirus isothermal amplification detection kit | |
| Fach et al. | An innovative molecular detection tool for tracking and tracing Clostridium botulinum types A, B, E, F and other botulinum neurotoxin producing Clostridia based on the GeneDisc cycler | |
| CN113249499B (en) | Salmonella typhi detection kit, and preparation method and application thereof | |
| Zeng et al. | A polymerase chain reaction based lateral flow test strip with propidium monoazide for detection of viable Vibrio parahaemolyticus in codfish | |
| Wu et al. | An enhanced visual detection assay for Listeria monocytogenes in food based on isothermal amplified peroxidase-mimicking catalytic beacon | |
| WO2020136595A1 (en) | Fast and portable microfluidic detection system as an alternative to salmonella's classical culture method | |
| CN104911269B (en) | Differentiate primer, probe and the kit of brucella A19 vaccine strains in aerosol | |
| US6268143B1 (en) | Automated high throughput E. coli o157:H7 PCR detection system and uses thereof | |
| CN109337995A (en) | The PCR detection method and kit of bacillus tularense and its subspecies | |
| CN113444777A (en) | CrRNA, CRISPR-Cas12a system for carbapenemase detection and application | |
| CN110804677B (en) | Nested double PCR detection primer and kit for distinguishing wild strain and gene deletion strain of African swine fever virus | |
| CN104342496A (en) | Method for rapidly detecting and identifying Listeria bacteria | |
| CN114032318A (en) | Method for detecting whether enterobacteriaceae bacteria contain tet (X) gene variant capable of mediating tigecycline drug resistance | |
| CN116064878A (en) | Pet helicobacter pylori detection kit based on Cas12a protein | |
| CN108707682A (en) | One kind is for detecting the active fluorescence RAA primers of salmonella, probe and detection method | |
| CN108707695A (en) | A kind of parrot young bird disease virus real-time fluorescence quantitative PCR detection kit |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |