CN114032249B - Engineering bacteria and microbial inoculum for alkaline protease expression and application of engineering bacteria and microbial inoculum in alkaline protease production - Google Patents

Abstract

The invention relates to engineering bacteria and microbial inoculum for alkaline protease expression and application thereof in alkaline protease production. The invention takes Trichoderma viride (Trichoderma viride) Tv-1511 as a starting strain, and constructs a recombinant Trichoderma viride strain Tv-1511-delta TvPacC with the coding gene of the starting strain TvPacC knocked out in a homologous recombination mode. According to the measurement, the recombinant strain has stronger alkaline protease secretion capability and remarkably improved enzyme activity, and has better alkaline environment adaptability, and the colony diameter and biomass under alkaline conditions are remarkably improved. The recombinant strain has good practical application value in industry and agriculture as engineering bacteria for expressing alkaline protease.

Description

Engineering bacteria and microbial inoculum for alkaline protease expression and application of engineering bacteria and microbial inoculum in alkaline protease production

Technical Field

The invention belongs to the technical field of alkaline protease engineering bacteria, and in particular relates to an engineering bacteria for alkaline protease expression, a microbial inoculum containing the strain and application of the microbial inoculum in alkaline protease production.

Background

The disclosure of this background section is only intended to increase the understanding of the general background of the invention and is not necessarily to be construed as an admission or any form of suggestion that this information forms the prior art already known to those of ordinary skill in the art.

Trichoderma is an important source of microbial proteases, and many studies have demonstrated that Trichoderma has a complex extracellular proteolytic enzyme system, and that differences in culture conditions can affect the type and composition of extracellular proteases. Most of the trichoderma extracellular proteases are serine protease and aspartic protease, can degrade various protein substrates such as casein, bovine serum albumin, lysozyme, collagen, nematode body wall and the like, and have no specific substrate enzyme cutting sites. Alkaline protease (Alkaline Protease) belongs to serine extracellular high alkaline protease, can hydrolyze protein molecules, has strong protein decomposing capability, can be used for degrading and utilizing industrial and agricultural wastes, and plays an important role in interaction of trichoderma viride with other pathogenic bacteria. Meanwhile, the good biochemical characteristics of the trichoderma protease can be applied to the industrial field, and the alkaline protease can be widely applied to the fields of food processing, washing and the like. Microbial enzyme production is affected by a variety of parameters including pH, carbon source, temperature, etc. Wherein pH is a major factor in altering metabolic pathways, affecting industrial enzyme production and enzyme synthesis efficiency. Studies have shown that trichoderma reesei (t.reesei) is capable of secreting acid aspartic proteases at pH below 5; trichoderma reesei (T.reesei) is capable of secreting a trypsin-like alkaline serine protease when the pH is controlled at 6.0 and above.

In nature, the pH value of the environment where fungi are located is constantly changing, and the change has very important influence on physiological activities such as growth, development, secondary metabolism and the like of the fungi. For survival and multiplication, fungi must adapt to changing acid-base environments. Therefore, research on the adaptation mechanism of fungi to acid-base environment is an important content for cognizing the life activity rule of fungi. The former has found in many fungi that there is a relatively conserved pH response signaling pathway, the Pal pathway. The Pal pathway is activated by an alkaline pH signal and, through a series of passes, ultimately acts on the PacC/Riml01 transcription factor.

PacC is a critical component in the Pal pathway and is also a central regulator of fungi to adapt to acid-base environments, and its expression is inhibited by acidic conditions and induced by saline-alkali conditions. It has been found that PacC gene plays an important role in adapting fungi to high pH environment, and expression of many genes related to salt stress and metal toxicity response in fungi is regulated by PacC transcription factors. PacC/Rim101 is capable of modulating the production of a variety of exocrine enzymes, such as proteases, chitinases, beta-1, 3-glucanases, and the like, in different fungi. The protease secreted by the maize middling 101 knockout strain is significantly reduced compared with the wild type and the anaplerotic strain. In metarhizium anisopliae (m.robertsii), mrPacC deletion has no effect on protease production, but results in reduced chitinase activity and gene expression. Chitinase, beta-1, 3-glucanase and protease activities of the CmPac deletion strain of the shield fungus (C.minitans) are obviously reduced. PacC deficiency in rice blast (M.oryzae) results in a significant decrease in the enzymatic activity of a variety of secreted carbohydrate degrading enzymes, including polygalacturonase, alpha-glucosidase, beta-glucosidase, alpha-galactosidase, beta-1, 3-glucanase, and the like.

Disclosure of Invention

The TvPacC gene is a coding gene which is identified from the genome of Trichoderma viride (Trichoderma viride) Tv-1511 and codes for the pH response factor PacC. The details of the TvPacC gene and its encoded proteins were obtained by earlier whole genome sequencing and fine genome mapping work performed on Tv-1511 (GenBank Accession No. VCEC00000000; bioProject: PRJNA543939; biosample: SAMN 11791795). Further, the present invention demonstrates that the strain from which the TvPacC gene described above was knocked out exhibits more excellent alkaline protease production characteristics.

Based on the technical effects, the invention provides the following technical scheme:

in a first aspect of the invention, there is provided an engineered bacterium for alkaline protease expression, the engineered bacterium being modified to have reduced expression of a pH response signal pathway compared to a wild-type strain.

The engineering bacteria of the first aspect of the invention are trichoderma and include, but are not limited to, one of trichoderma harzianum (t.harzianum), trichoderma asperellum (t.asperellum), trichoderma viride (t.viride), trichoderma longibrachiatum (t.longibrachiatum), trichoderma koningii (t.koningi) or trichoderma reesei (t.reesei).

In a practical manner provided by the invention, the engineering bacteria are trichoderma viride, in a specific embodiment, the trichoderma viride (Trichoderma viride) Tv-1511 separated and identified by the inventor subject group is preserved in China general microbiological culture Collection center (China general microbiological culture Collection center) at the date of 12 months and 20 days, and has the address of China general microbiological culture collection center (China general academy of sciences) No.3 of the North Chen West road 1 in the Chat of Beijing, and the strain has the strain preservation number of CGMCC No.16800 and is disclosed in the patent with the application number of 2019106265259.

The "modified to have reduced expression of the pH response signaling pathway" of the engineering bacterium according to the first aspect of the present invention as compared to the wild-type strain means reduced expression of the pH response signaling pathway-associated protein in the modified microorganism, including inhibited expression of the associated protein and/or reduced protein viability. Preferably, the pH responsive signal pathway is the Pal pathway, further, the reduced pH responsive signal pathway is reduced expression of a TvPacC protein, and in one embodiment of the "reduced expression of a TvPacC protein", the sequence of the TvPacC protein is shown in SEQ ID NO.1 and the nucleotide sequence of the TvPacC is shown in SEQ ID NO. 2.

In addition, the decrease in the pH responsive active protein is not limited to the TvPacC protein shown in the above sequence, but also includes a protein having 70% or more similarity with the above sequence, which can be found by BLAST alignment. Preferably, the protein similarity is 80% or more; more preferably, 90% or more; further preferably, 95% or more; still further, 98% or more of the amino acid sequence homologous thereto.

Preferably, the modification to have reduced expression of the pH responsive signaling pathway may be performed by any method known in the art, e.g., homologous recombination. The invention provides a specific construction method of engineering bacteria expressed by alkaline protease, which comprises the following steps:

(1) Primers are designed based on a TvPacC gene 5 'flanking sequence (upstream), a 3' flanking sequence (downstream) and a resistance gene Hyg-R sequence, and a TvPacC knockout gene fragment is constructed by a fusion PCR method;

(2) The constructed knocked-out gene fragment passes through PEG-CaCl ₂ Transferring into Trichoderma viride Tv-1511 protoplast;

(3) Colony PCR was performed to screen positive mutants using Hyg-R resistance (as shown in FIG. 4).

In a specific embodiment provided by the invention, trichoderma viride (Trichoderma viride) Tv-1511 is taken as a starting strain, and the trichoderma viride strain Tv-1511-delta TvPacC lacking the TvPacC gene is obtained by the construction method. In the strain Tv-1511-delta TvPacC, the transcriptional expression of the TvPacC can not be detected, and the strain is an engineering strain with the TvPacC gene completely knocked out. According to the measurement, the activity of protease produced by the original strain Trichoderma viride (Trichoderma viride) Tv-1511 under alkaline condition (pH 9) is obviously lower than that of protease produced by the original strain under acidic condition (pH 5), and compared with the original strain, the strain Tv-1511-delta TvPacC has better alkaline environment adaptability, the colony diameter and biomass under alkaline condition are obviously improved, the strain has stronger alkaline protease secretion capacity, and the activity of alkaline protease in fermentation liquor is obviously improved.

In a second aspect of the invention, there is provided a microbial inoculum comprising the engineered bacterium expressed by the alkaline protease of the first aspect and/or a culture of the engineered bacterium.

In a specific embodiment provided by the invention, a Trichoderma engineering bacterium Tv-1511-delta TvPacC with a TvPacC gene is provided, and the strain has no obvious difference from a wild strain in the form of normal culture conditions.

In a third aspect of the present invention, there is provided a method for culturing the engineering strain according to the first aspect, wherein the culturing method comprises the following steps: PDA (potato dextrose agar) or PD (potato dextrose liquid) culture medium is adopted for culture, and the culture temperature is 25-30 ℃.

In the above-mentioned culture method, a further preferable culture temperature is 26 ℃, 27 ℃ or 28 ℃, and in an embodiment where the effect is good, the culture temperature is 28 ℃.

When the PD culture medium is adopted for culture, the rotation speed of the shaking table is 160-200 r/min; further, the flow rate was 180r/min. According to a fourth aspect of the invention, there is provided an engineering bacterium for alkaline protease expression according to the first aspect, and the use of the microbial inoculum according to the second aspect in alkaline protease production.

In a fifth aspect of the invention, there is provided a method of increasing alkaline protease enzyme activity, the method comprising reducing protein activity of a pH responsive pathway in the starting strain.

The beneficial effects of the above technical scheme are:

the invention identifies a coding gene of a pH response factor TvPacC and a corresponding protein in Trichoderma viride (Trichoderma viride) Tv-1511, and constructs a Trichoderma engineering strain with the TvPacC gene deleted by utilizing a homologous recombination method. The invention discovers that the adaptation capacity of the alkaline environment of the trichoderma viride is improved, the alkaline protease production capacity of the trichoderma viride strain is enhanced by knocking out the TvPacC gene, and the method has good practical application value in industrial and agricultural aspects.

Drawings

The accompanying drawings, which are included to provide a further understanding of the invention and are incorporated in and constitute a part of this specification, illustrate embodiments of the invention and together with the description serve to explain the invention.

FIG. 1 is a schematic representation of the amino acid sequence domain of said TvPacC.

FIG. 2 shows the transcript levels of TvPacC in the Trichoderma viride starting strain at different pH conditions in example 1.

FIG. 3 shows the measurement of protease producing ability of Trichoderma viride starting strain under different pH conditions in example 1.

FIG. 4 is a schematic diagram of the construction of a TvPacC gene knockout fragment in example 2;

wherein, FIG. 4A is a flow chart for constructing Trichoderma viride TvPacC gene deletion engineering bacteria;

FIG. 4B is a primer amplification electrophoretogram.

FIG. 5 shows the qPCR detection results of the expression of the TvPacC gene in the Trichoderma viride starting strain and the engineering bacterium in example 2;

wherein, FIG. 5A shows the transcriptional expression results of TvPacC in wild-type and TvPacC deletion engineering strains;

FIG. 5B is a TvPacC protein expression band in wild-type and TvPacC deleted engineered strains;

FIG. 5C is a histogram of TvPacC protein expression in wild-type and TvPacC deleted engineered strains.

FIG. 6 is an alkaline environment adaptation capacity analysis of Trichoderma viride starting strain and engineering strain Tv-1511-DeltaTvPacC in example 3;

wherein, FIG. 6A shows the culture results of wild type and TvPacC deletion engineering strains under alkaline conditions;

FIG. 6B is colony diameters of wild-type and TvPacC deleted engineered strains;

FIG. 6C is the dry weight of wild type and TvPacC deleted engineered strains after cultivation.

FIG. 7 is an analysis of alkaline protease secretion ability of Trichoderma viride starting strain and engineering strain Tv-1511-DeltaTvPacC in example 4;

the hydrolysis circles on the MM plates of skim milk powder at pH9 are more pronounced (FIG. 7A), and the activity of alkaline protease in the fermentation broth is significantly improved (FIG. 7B)

Wherein, FIG. 7A is the result of hydrolysis circle of TvPacC deleted engineering strain;

FIG. 7B shows the results of alkaline protease activity assay in fermentation broth of TvPacC deleted engineering strain.

Detailed Description

It should be noted that the following detailed description is illustrative and is intended to provide further explanation of the invention. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

It is noted that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of exemplary embodiments according to the present invention. As used herein, the singular is also intended to include the plural unless the context clearly indicates otherwise, and furthermore, it is to be understood that the terms "comprises" and/or "comprising" when used in this specification are taken to specify the presence of stated features, steps, operations, devices, components, and/or combinations thereof.

As described in the background art, the pH signal pathway has a plurality of influences on the physiological activity of the strain, and the TvPacC gene is the coding gene of the pH response factor PacC in the Trichoderma viride (Trichoderma viride) Tv-1511 genome. The research of the invention shows that the recombinant strain obtained by knocking out TvPacC gene has more excellent alkaline protease secretion capacity, and is expected to be applied as an alkaline protease engineering bacterium.

In order to enable those skilled in the art to more clearly understand the technical scheme of the present invention, the technical scheme of the present invention will be described in detail with reference to specific embodiments.

EXAMPLE 1 determination of the transcriptional expression level and the protease production level of the Trichoderma viride starting Strain pH response factor TvPacC under different pH conditions

mu.L spores of Trichoderma initial strain Tv-1511 were inoculated into MM liquid medium (1 LddH ₂ O+15g KH ₂ PO ₄ +5g(NH ₄ ) ₂ SO ₄ +0.6g MgSO ₄ (or 1.23g MgSO ₄ ^. 7H ₂ O)+0.6g CaCl ₂ (or 0.8g CaCl ₂ ·2H ₂ O)+0.005g FeSO ₄ ·7H ₂ O+0.0016g MnSO ₄ ·H ₂ O+0.0014g ZnSO ₄ ·7H ₂ O+0.0037g CoCl ₂ ·6H ₂ O (or 0.002g CoCl) ₂ ) +20g glucose), at 28℃and 180rpm, and filtered through 2 layers of sterile gauze to obtain sterile mycelia. Inoculating equal amounts of mycelia into MM liquid nitrogen-free medium (1L ddH) containing 2% skimmed milk powder at different pH values (pH 5, pH7, and pH 9) ₂ O+15g KH ₂ PO ₄ +0.6g MgSO ₄ (or 1.23g MgSO _4. 7H ₂ O),+0.6g CaCl ₂ (or 0.8g CaCl ₂ ·2H ₂ O)+0.005g FeSO ₄ ·7H ₂ O+0.0016g MnSO ₄ ·H ₂ O+0.0014g ZnSO ₄ ·7H ₂ O+0.0037g CoCl ₂ ·6H ₂ O (or 0.002g CoCl) ₂ ) +20g glucose), at 28℃and 180rpm, and collecting mycelia and fermentation broth, respectively.

Mycelium is ground by liquid nitrogen, total RNA is extracted by using a Trizol method, cDNA is prepared, primers shown as SEQ ID NO.3 and SEQ ID NO.4 are used, and a fluorescent quantitative PCR method is used for detecting the transcriptional expression of TvPacC.

SEQ ID NO.3:TvPacC-qPCR-F:GATACTCTGGCGGAATGC；

SEQ ID NO.4:TvPacC-qPCR-R:ATCCTTGCGAATGCGATT。

The recovered liquid fermentation broth was centrifuged at 10,000rpm, and the supernatant was collected to prepare a crude enzyme extract, which was used for measuring protease activity by using Fu Lin Fenfa.

Activating Trichoderma initial strain Tv-1511 on PDA plate, culturing at 28deg.C in dark for 48-72 hr to make Trichoderma grow uniformly, preparing bacterial blocks with uniform size by using puncher, inoculating into MM solid nitrogen-free culture medium (MM liquid nitrogen-free culture medium+2% agar) containing 2% skimmed milk powder at different pH (pH 5, pH7, pH 9), standing at 28deg.C for 48 hr, and observing colony diameter and hydrolysis circle.

The detection result of fluorescent quantitative PCR shows that: the TvPacC gene is expressed in low amounts under acidic conditions (pH 5), whereas the transcriptional expression of the TvPacC gene is significantly increased under alkaline conditions (pH 9) (fig. 2).

The results of protease activity detection revealed that: under alkaline conditions (pH 9), the protease hydrolysis of the starting strain was not apparent and the activity of the alkaline protease was very low (FIG. 3). Indicating that under alkaline conditions, the synthesis of alkaline protease in the starting strain is inhibited.

EXAMPLE 2 construction of Trichoderma viride TvPacC Gene-deleted engineering bacterium

(1) Construction of knockout fragments

The upstream and downstream fragments of the TvPacC gene were amplified using Trichoderma viride Tv-1511 genomic DNA as a template (FIG. 4A). The knockout fragment amplification primers are respectively as follows: upstream fragment amplification primer

TvPacC-UP-F：GATTCGGGCGTCTCGAGATA(SEQ ID NO.5)

TvPacC-up-R：

GAGAGCTACCTTACATCAATATGGCAAGAGGCGCTTTGGCGCA(SEQ ID NO.6)；

Downstream fragment amplification primers:

TvPacC-DOWN-F：

GGTACTATGGCTTAGATGGAATACCCGCACTGAGACGTTCATGGCATTT(SEQ ID NO.7)

TvPacC-down-R：TCACTGCATGGCGTCTCCTT(SEQ ID NO.8)。

the hygromycin resistance gene (HygR) is amplified by using the linearized pBARGPE1-Hygro plasmid as a template, and the amplification primers are as follows: hygR-F GAGAGCTACCTTACATCAATATGGC (SEQ ID NO. 9) and HygR-R GGTACTATGGCTTAGATGGAATACCC (SEQ ID NO. 10) (FIG. 4B). The knockout fragment was constructed by fusion PCR at a final concentration of 312 ng/. Mu.L, OD _260/280 1.88, a total of 40. Mu.L.

(2) Protoplast preparation

Inoculating Trichoderma viride Tv-1511 on PDA plate, culturing at 28deg.C for 10 days, and generating a large amount of fresh conidium; the mycelium surface was washed with 10mL of physiological saline (0.9% NaCl,0.05% Tween-20), filtered through cellophane, and the mycelium was removed to give a spore suspension.

Coating 200 mu L of spore suspension on a PDA plate covered by cellophane, and culturing at 28 ℃ in a dark place for 24 hours to enable spores on the PDA plate to germinate;

preparing a dissolving enzyme solution: 0.15g of lytic enzyme (Sigma: L1412) was dissolved in 20mL of solution I (1.2. 1.2M D-sorbitol,0.1M KH) ₂ PO _4, pH 5.6), 0.2. Mu.M filter membrane for sterilization;

taking out the PDA flat plate, taking out the fiber membrane with hypha, reversely attaching the fiber membrane to the flat plate containing 3-4mL of lysate, and treating for 100min at 28 ℃ and 100 rpm;

taking out the fiber membrane in the flat plate under the sterile super clean bench, ensuring that most mycelium remains in the flat plate, flushing mycelium blocks remained on the microscopic membrane with the solution A in the process, repeatedly blowing and sucking the mycelium blocks in the liquid for more than 200 times by using the gun head, and fully releasing the protoplast in the interior;

the mixture was filtered through a 1.5mL tube containing 4 layers of gauze, the lower filtrate was retained and centrifuged at 4℃and 2000rpm for 10min, the supernatant was discarded, and the bottom protoplast was retained.

Adding 1mL of solution A, centrifuging again, and discarding the supernatant;

1mL of pre-chilled solution II at 4deg.C (1M sorbitol,50mM CaCl) ₂ 10mM Tris-HCl, pH 7.5) on ice to obtain protoplasts; the protoplasts were diluted to 10 by counting with a hemocytometer ⁷ And each mL. (3) Protoplast transformation and mutant screening

A15 mL centrifuge tube was placed on ice, and 200. Mu.L of the protoplast suspension, 10. Mu.L of the purified PCR product, and 50. Mu.L of PEG solution (25%PEG600,50mM CaCl) ₂ 10mM Tris-HCl, pH 7.5); mixing with gun head, and standing on ice for 20min;

adding 2mLPEG solution, mixing gently, and standing at room temperature for 5min; adding 2mL of solution II, and gently mixing;

adding 2mL of the mixed solution, coating the mixed solution on a 1M sucrose-containing PDA flat plate covered with chromatographic paper, and cutting the chromatographic paper into strips in advance; culturing at 28deg.C in dark for 24 hr;

the strip chromatographic paper is transduced on a PDA plate containing antibiotics, is cultivated for 36 hours at 28 ℃ in a dark place, and after bacterial colonies grow out of the edge of the strip chromatographic paper, colonies are picked and transferred to a fresh antibiotic plate for cultivation for 2 days.

After transformation, transformant 8 strain Tv-1511 was obtained. Detecting transcription expression of the TvPacC by using the obtained TvPacC deletion engineering strain and adopting a fluorescent quantitative PCR method, wherein amplification primers are as follows: tvPacC-qPCR-F GATACTCTGGCGGAATGC (SEQ ID NO. 3) and TvPacC-qPCR-R ATCCTTGCGAATGCGATT (SEQ ID NO. 4); protein expression of TvPacC was detected using western blotting WB method. The results showed that no transcriptional expression (fig. 5A) and no protein expression (fig. 5b,5 c) of TvPacC could be detected in the TvPacC deletion engineering strain.

Example 3 determination of the ability of Trichoderma viride engineering Strain Tv-1511-DeltaTvPacC to adapt to alkaline stress Environment (1) collection of sterile spores

Inoculating Trichoderma viride original strain and Tv-1511-delta TvPacC engineering bacteria to a PDA plate, and culturing at 28 ℃ for 10 days to generate a large number of fresh conidia; washing the mycelium surface with 10mL physiological saline (0.9% NaCl,0.05% Tween), filtering with glass wool paper, and removing mycelium to obtain spore suspension; suspending with 30% glycerol, mixing, packaging into 1.5mL centrifuge tube, marking name and time, and freezing at-80deg.C; and taking a tube of spore liquid for viable count, and determining the concentration of the spore liquid.

(2) Alkali resistance test of flat plate

Activating Trichoderma initial strain (Wildtype) and Tv-1511-delta TvPacC engineering bacteria on a PDA plate, culturing at 28 ℃ in a dark place for 48-72 hours to ensure that the original strain and mutant engineering bacteria Trichoderma grow uniformly, preparing bacterial blocks with uniform size by using a puncher, and transferring to the PDA plate with the pH value of 9. After the plate with the bacterial block was incubated at 28℃for 72 hours, the colony growth diameter was measured.

The result shows that: tv-1511-DeltaTvPacC engineering bacteria are more suitable for alkaline environment with high pH, and the colony diameter is obviously increased compared with that of a starting strain (Wildtype) (FIG. 6A).

(3) Alkali-resistant experiment of liquid shaking bottle

Spores of 200. Mu.L of Trichoderma original strain (Wildtype) and Tv-1511-delta TvPacC engineering bacteria were inoculated into PDB liquid medium, respectively, cultured at 28℃for 48 hours at 180rpm, and filtered through 2 layers of sterile gauze to obtain sterile mycelia. Equal amounts of mycelia were inoculated into PDB liquid medium at pH9, cultured at 28℃and 180rpm for 72 hours, and mycelia were collected to measure biomass of the mycelia.

The result shows that: under alkaline conditions at pH9, the biomass of Tv-1511-DeltaTvPacC engineering bacteria was significantly increased compared to the starting strain (Wildtype) (FIG. 6B).

Example 4 determination of alkaline protease production ability of Trichoderma viride engineering Strain Tv-1511-DeltaTvPacC

Sterile spore collection was performed as described in example 3 above.

Plate hydrolysis circle experiment: activating Trichoderma original strain (Wildtype) and Tv-1511-delta TvPacC engineering bacteria on MM solid plate, culturing at 28deg.C in dark for 48-72 hr to make original strain and mutant engineering bacteria Trichoderma grow uniformly, preparing bacterial block with uniform size by using puncher, and transferring to MM liquid solid nitrogen-free medium (1L ddH) containing 2% skimmed milk powder at pH9 ₂ O+15g KH ₂ PO ₄ +0.6g MgSO ₄ (or1.23g MgSO ₄ ^. 7H ₂ O)+0.6g CaCl ₂ (or 0.8g CaCl ₂ ·2H ₂ O)+0.005g FeSO ₄ ·7H ₂ O+0.0016g MnSO ₄ ·H ₂ O+0.0014g ZnSO ₄ ·7H ₂ O+0.0037g CoCl ₂ ·6H ₂ O (or 0.002g CoCl) ₂ ) +20g glucose+20 g agar) plates. After the plates with the bacterial blocks were incubated at 28℃for 72 hours, the protease hydrolysis circles were observed.

Liquid fermentation protease production experiment: spores of 200. Mu.L of Trichoderma original strain (Wildtype) and Tv-1511-delta TvPacC engineering strain are inoculated into MM liquid culture medium respectively, cultured at 28 ℃ and 180rpm for 48 hours, and mycelium of the engineering strain and original strain is obtained by filtering through 2 layers of sterile gauze. Equal amounts of mycelia were inoculated into MM liquid nitrogen-free medium (1L ddH) containing 2% skim milk powder at pH9 ₂ O+15g KH ₂ PO ₄ +0.6g MgSO ₄ (or 1.23g MgSO ₄ ^. 7H ₂ O)+0.6gCaCl ₂ (or 0.8gCaCl ₂ ·2H ₂ O)+0.005g FeSO ₄ ·7H ₂ O+0.0016g MnSO ₄ ·H ₂ O+0.0014g ZnSO ₄ ·7H ₂ O+0.0037g CoCl ₂ ·6H ₂ O (or 0.002g CoCl) ₂ ) +20g glucose), the culture was carried out at 28℃and 180rpm, and the protease induction was carried out, and after 72 hours, the mycelia were filtered through 2 layers of sterile gauze to recover a liquid fermentation broth.

The recovered liquid fermentation broth was centrifuged at 10,000rpm, and the supernatant was collected to prepare a crude enzyme extract, which was used for measuring protease activity by using Fu Lin Fenfa.

The result shows that: the Trichoderma engineering strain Tv-1511-delta TvPacC has stronger alkaline protease secretion capacity than the original strain, the hydrolysis circle of the Trichoderma engineering strain on a skimmed milk powder MM plate with pH of 9 is more obvious (figure 7A), and the activity of the alkaline protease in fermentation liquor is obviously improved (figure 7B).

The above description is only of the preferred embodiments of the present invention and is not intended to limit the present invention, but various modifications and variations can be made to the present invention by those skilled in the art. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

SEQUENCE LISTING

<110> Shandong national academy of sciences institute of biology

<120> engineering bacterium for alkaline protease expression, microbial inoculum and application thereof in alkaline protease production

<130> 2010

<160> 8

<170> PatentIn version 3.3

<210> 1

<211> 616

<212> PRT

<213> artificial sequence

<400> 1

Met Ser Ala Gln Val Pro Asp Gln Ala Ala Leu Ser Pro Ser His Asp

1 5 10 15

Thr Lys Ser Ala Ser Pro Thr Asp Ala Ser Ser Thr Thr Ser Pro Asn

20 25 30

Gly Ser Thr Ser Asn Asn Gly Ser Ser Ala Ser Ser Asn Ala Gln Val

35 40 45

Ser Pro Ser Leu Gly Asp Ala Ile Asp Ala Pro Arg Gln Leu Val Cys

50 55 60

Arg Trp Asn Gln Cys Gly Gln Lys Phe Thr Asn Ala Glu Thr Leu Tyr

65 70 75 80

Glu His Ile Cys Glu Arg His Val Gly Arg Lys Ser Thr Asn Asn Leu

85 90 95

Ser Leu Thr Cys Gln Trp Asn Ser Cys Arg Thr Thr Thr Val Lys Arg

100 105 110

Asp His Ile Thr Ser His Ile Arg Val His Val Pro Leu Lys Pro His

115 120 125

Lys Cys Glu Phe Cys Gly Lys Ser Phe Lys Arg Pro Gln Asp Leu Lys

130 135 140

Lys His Val Lys Thr His Ala Asp Asp Ser Val Leu Ser Arg Pro Gly

145 150 155 160

Gln Asp Ser Gln Pro Gly Met Asn Tyr Arg Pro Gln Ala Pro Lys Arg

165 170 175

Asp Tyr Tyr Asp His Asn Gly Gln Met Arg Ser Pro Val Thr Gly Phe

180 185 190

Pro Gln Pro His Ala Gly Gly Tyr Tyr Ala Pro Gln Pro Ser Thr Asn

195 200 205

Tyr Gly Leu Tyr Phe Asn Gln Gln His Val Asn Pro Ala Pro Arg Thr

210 215 220

Glu His Ile Gly Tyr Ser Ala Ser Tyr Asp Arg Lys Arg Thr Gln Ala

225 230 235 240

His Glu Met Val Asp Asp Phe Phe Gly Ser Ala Lys Arg Arg Gln Ile

245 250 255

Asp Pro Thr Ser Tyr Ala Gln Ile Gly Arg Ser Leu Leu Pro Leu His

260 265 270

Asn Ala Leu Ala Met Pro Ser Gly Pro Met Ala Ala Thr Glu Ser Tyr

275 280 285

Phe Pro Gln Pro Ala Gly His Ala Val Gly His Gly Val Val His Ala

290 295 300

Ala Pro Ala Pro Ala Pro Thr Gln Asn Pro Leu Ala Gln Gln Tyr Tyr

305 310 315 320

Leu Pro Met Pro Asn Ala Arg Thr Gln Lys Asp Leu Ile Gln Leu Asp

325 330 335

Gln Met Leu Gly Gln Met Gln Asp Thr Val Tyr Glu Thr Ala Pro Gln

340 345 350

Ile Thr Ala Gly Met His Pro His Asp Ser Gln Phe Ala Gly Tyr Arg

355 360 365

Ser Thr Pro Ser Pro Thr Thr Leu His Arg Gly Pro Gly Ala Ile His

370 375 380

Val Ala Pro Asp Gly Tyr His Gln Pro Val Ser Ala Ala Ser Met Ala

385 390 395 400

Ser Pro Leu Thr Ala Ile Ser Ser Thr Gly Thr Pro Ala Val Thr Pro

405 410 415

Pro Ser Ser Ala Leu Ser Tyr Thr Ser Gly His Ser Pro Ser Pro Ser

420 425 430

Ala Ser Ser Gly Phe Ser Pro Gln Ser Arg His Ser Ser Thr Ala Ser

435 440 445

Ser Ile Met Tyr Pro Ser Leu Pro Thr Ser Leu Pro Ala Val Ser Gln

450 455 460

Gly Phe Gly Gln Ser Thr Thr Ala Thr Leu Gly Pro Ser Phe Asp Ala

465 470 475 480

Gly Glu Arg Arg Arg Tyr Ser Gly Gly Met Leu Gln Arg Ala Arg Gly

485 490 495

Ala Pro Pro Arg Ser Val Glu Glu Pro Ser Gly Ala Val Thr Pro Lys

500 505 510

Ala Ser Glu Ser Thr Pro Pro Ile Gly Ser Pro Ser Ser Glu Ser Ser

515 520 525

Asp Val Ser Asp Ala Thr Arg Glu Arg Glu Glu Gln Tyr Asp Arg Trp

530 535 540

Val Asp Asn Met Arg Val Ile Glu Ala Leu Arg Glu Tyr Val Gln Gly

545 550 555 560

Arg Leu Lys Arg Gly Glu Phe Glu Gln Glu Tyr Pro Ser Val Asn Arg

565 570 575

Ile Arg Lys Asp Val Asp Ala Met Asp Leu Glu Gly Lys Ser Arg Ser

580 585 590

Pro Leu Ala Asn Glu Arg Pro Met Ser Lys Glu Ser Asn Pro Leu Tyr

595 600 605

Pro Val Leu Pro Val Pro Gly Thr

610 615

<210> 2

<211> 1851

<212> DNA

<213> artificial sequence

<400> 2

atgagcgcgc aggtgcccga ccaggccgcc cttagcccca gccacgacac caagagcgcc 60

agtccaaccg acgcgtcgtc cacaacctcg ccaaacggtt ccaccagcaa caatggttcc 120

tccgccagct ccaatgcaca agtctcacct tccctcggcg atgcaattga tgcaccgcgc 180

cagctcgtct gccgctggaa ccagtgcggt cagaaattca cgaatgccga gacgctctac 240

gagcacatct gcgagcgaca tgtcggacgg aagagcacaa acaacctgag tctgacttgc 300

cagtggaact cgtgtagaac aacaacggtg aagagggatc acattactag ccacatccga 360

gtccacgtgc cgcttaagcc ccacaagtgt gagttctgcg gcaagtcctt caagcgcccg 420

caagatctca agaagcacgt caagacgcac gccgacgact ctgttctttc acggccggga 480

caagactccc agcccggcat gaactatcgc cctcaggcgc ccaaacgaga ctactacgac 540

cacaacggcc agatgaggag cccagtcacg ggcttccctc agcctcatgc ggggggatac 600

tatgctccgc aaccgtcgac caactacggc ctctacttca accaacagca tgtcaaccct 660

gctcctcgta cagagcacat cggctattcg gcatcatacg acaggaagcg gacacaagct 720

cacgagatgg tggatgactt cttcggctcc gccaagcgac gccaaatcga cccgacgtcc 780

tatgcccaga ttggcagatc tctgctaccc ttgcacaatg ctttggccat gccttccggc 840

cctatggccg cgaccgagag ctactttccc cagcccgccg ggcatgctgt gggtcatggc 900

gtggtccatg ctgcccccgc accggcgccc acgcagaacc ccctggctca gcagtattac 960

ctgcccatgc ccaacgcgag gacccaaaag gacttgatcc agctggatca gatgctaggc 1020

caaatgcagg acacggtcta cgaaacagcc ccgcagatca ccgcaggcat gcacccgcat 1080

gatagccagt tcgccggtta ccgctcgacg ccatcaccca ccaccctcca tcgcggccca 1140

ggcgccatcc atgttgcgcc tgacgggtac caccagccag tttcggccgc gagcatggct 1200

tcccccctca cggctatatc atccaccggc acgcctgccg ttactccgcc aagctccgcc 1260

ctctcttaca cgagtggcca ctctccatct ccgtcagcat cgtcgggctt tagcccacag 1320

tcccgccaca gctctaccgc ctcgtccatc atgtacccgt cgttgcctac ctctctccct 1380

gcggtatctc aggggtttgg ccagtcaact actgcgaccc tggggccctc ctttgacgca 1440

ggagaacgga ggcgatactc tggcggaatg ctgcagcggg cacgaggagc cccgcctcgg 1500

agcgtggagg agcccagcgg ggccgttact cccaaggctt cagagtcgac cccgcccatc 1560

ggatctccct cgtccgaatc gtcagacgtc tcggacgcca cgagagaaag agaagagcag 1620

tacgatcgat gggtcgacaa catgcgggtg attgaggcgc tgcgcgagta cgtccaagga 1680

cgtctcaaaa ggggtgaatt tgagcaggag tatccctctg taaatcgcat tcgcaaggat 1740

gtcgatgcca tggacctgga aggcaaaagc cggtcacccc ttgccaacga gcgtcctatg 1800

tccaaggagt ccaacccgct gtatccggtg ctgcccgtcc caggcacttg a 1851

<210> 3

<211> 18

<212> DNA

<213> artificial sequence

<400> 3

gatactctgg cggaatgc 18

<210> 4

<211> 18

<212> DNA

<213> artificial sequence

<400> 4

atccttgcga atgcgatt 18

<210> 5

<211> 20

<212> DNA

<213> artificial sequence

<400> 5

gattcgggcg tctcgagata 20

<210> 6

<211> 43

<212> DNA

<213> artificial sequence

<400> 6

gagagctacc ttacatcaat atggcaagag gcgctttggc gca 43

<210> 7

<211> 49

<212> DNA

<213> artificial sequence

<400> 7

ggtactatgg cttagatgga atacccgcac tgagacgttc atggcattt 49

<210> 8

<211> 20

<212> DNA

<213> artificial sequence

<400> 8

tcactgcatg gcgtctcctt 20

Claims (4)

1. An application of engineering bacteria in alkaline protease production;

the engineered bacterium is modified to have reduced pH response signaling pathway expression compared to a wild strain; the reduced pH response signaling pathway is reduced TvPacC protein expression;

the sequence of the TvPacC protein is shown as SEQ ID NO.1, and the nucleotide sequence of the TvPacC protein is shown as SEQ ID NO. 2;

the original strain of the engineering bacteria is Trichoderma viride (Trichoderma viride) Tv-1511, which is preserved in China general microbiological culture Collection center (China Committee) for culture Collection of microorganisms in 12 months and 20 days in 2018, and has a strain preservation number of CGMCC No.16800;

the application is embodied in: compared with the original strain, the strain has stronger capability of secreting alkaline protease; at pH9, the activity of alkaline protease in the fermentation broth is obviously improved;

the construction method of the engineering bacteria comprises the following steps: (1) Designing primers based on a5 'flanking sequence, a 3' flanking sequence and a resistance gene Hyg-R sequence of the TvPacC gene, and constructing a knockout gene fragment of the TvPacC by a fusion PCR method;

the primers of the 5 'flanking sequence and the 3' flanking sequence are TvPacC-UP-F respectively:

GATTCGGGCGTCTCGAGATA (SEQ ID NO. 5) and TvPacC-up-R:

GAGAGCTACCTTACATCAATATGGCAAGAGGCGCTTTGGCGCA (SEQ ID NO. 6) or TvPacC-DOWN-F:

GGTACTATGGCTTAGATGGAATACCCGCACTGAGACGTTCATGGCATTT (SEQ ID NO. 7) and TvPacC-down-R: TCACTGCATGGCGTCTCCTT (SEQ ID NO. 8).

2. The application of claim 1, wherein the construction method of the engineering bacteria further comprises the following steps:

(2) Transferring the constructed knockout gene fragment into Trichoderma viride Tv-1511 protoplast by a PEG-CaCl2 method;

(3) Colony PCR was performed to screen positive mutants using Hyg-R resistance.

3. The use according to claim 1, wherein the engineering bacteria are cultured in a manner comprising: culturing with PDA or PD culture medium;

the culture temperature is 26 ℃, 27 ℃ or 28 ℃;

when PD culture medium is adopted for culture, the rotation speed of the shaking table is 160-200 r/min.

4. The use according to claim 3, wherein the culture temperature is 28 ℃; the rotation speed of the shaking table is 180r/min.