CN114015750A - High-throughput verification method for plant tissue single cell transcriptome sequencing result - Google Patents
High-throughput verification method for plant tissue single cell transcriptome sequencing result Download PDFInfo
- Publication number
- CN114015750A CN114015750A CN202111211503.XA CN202111211503A CN114015750A CN 114015750 A CN114015750 A CN 114015750A CN 202111211503 A CN202111211503 A CN 202111211503A CN 114015750 A CN114015750 A CN 114015750A
- Authority
- CN
- China
- Prior art keywords
- cell
- plant tissue
- single cell
- subcellular
- sequencing results
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Analytical Chemistry (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a high-throughput verification method for a plant tissue unicell transcriptome sequencing result, and relates to the field of gene sequencing. The method comprises the following steps: s1, degrading plant tissues by using the cellulose enzymolysis liquid to prepare cell suspension; s2, measuring the cell concentration and the cell activity in the cell suspension; s3, separating different subcellular groups in the cell suspension; s4, degrading the same subcellular population by using the cellulose enzymolysis liquid; s5, sequencing the cell sediment sample by SMART-seq library construction; and S6, taking the cDNA obtained by library construction as a template, and detecting the expression quantity of the target gene by adopting fluorescent quantitative PCR for verification. According to the method, the cell wall is degraded twice by adopting the cellulose enzymolysis liquid so as to separate different subcellular group cells, the high-throughput verification of the gene expression quantity is carried out on the level of single cells and subcellular cells by carrying out the fluorescent quantitative PCR detection after the SMART-seq database is built, the test period is short, the test cost is reduced, and the verification operation is simple, convenient, efficient and quick.
Description
Technical Field
The invention relates to the technical field of gene sequencing, in particular to a high-throughput verification method for a plant single cell transcriptome sequencing result.
Background
Single-cell RNA sequencing (scra-seq) technology is used as a revolutionary tool to analyze transcriptome at single-cell level, and the core of single-cell research is to divide cell populations and detect differentially expressed genes among cell populations. After obtaining high-throughput single-cell transcriptome data by scRNA-seq, it is still necessary to verify the genes identified by scRNA-seq in different subcellular populations. The in-situ histological verification is a popular research strategy at present and is also used for verifying the spatial distribution positioning backtracking and the result authenticity of valuable molecules screened from a single cell sequencing result. The gene expression level detected by the scRNA-seq can be detected in different subcellular populations of tissues and organs by methods such as RNA in situ hybridization or immunofluorescence staining, but the methods have the problems of high test requirement, long test period, low detection flux and unsatisfactory detection result.
RNA in situ hybridization is an important method for researching the expression of genes in tissue cell groups by using labeled antisense RNA as a probe to hybridize with tissue sections so as to display the expression position and relative abundance of RNA in situ. The RNA in situ hybridization experiment has high requirements and has the general defects that: manufacturing a tissue slide; designing antisense RNA probe of gene is the most critical, and the design requirement of the probe is high in specificity; the whole test period is long (3-5 days); the flux is too low, one probe can only target one gene at a time, and only one gene can be detected on each tissue slide at a time.
Immunofluorescence staining is a verification experiment at a protein level, and like an RNA in-situ hybridization verification experiment, the immunofluorescence staining can verify the expression quantity result of a target gene identified by single cell transcriptome sequencing, can also observe the spatial positioning of a cell group corresponding to the target gene in a tissue, can also observe the positioning of protein in the cell, and provides clues for subsequent functional research according to different organelle positioning. Immunofluorescence staining has the disadvantages that: manufacturing a tissue slide; the method may need to purchase antibodies of multiple companies for verification experiments, the antibodies are not specific enough and are difficult to carry out experiments, a specific plant antibody library is lacked, and each plant gene may need to be made into a specific antibody; since the translation of expressed RNA and protein in cells is not absolutely linearly related, the RNA level and protein level may not be consistent, resulting in high gene expression levels, but the detection at the protein level is not ideal.
Disclosure of Invention
The invention provides a high-throughput verification method for a plant tissue unicell transcriptome sequencing result, which aims to solve the technical problems of inconvenient operation, long test period and low throughput of the conventional transcription sequencing result.
In order to solve the technical problems, the invention aims to provide a high-throughput verification method for sequencing results of plant tissue single cell transcriptome, which comprises the following steps:
s1, performing primary degradation on plant tissues by using a cellulose enzymolysis solution to keep cells in an original form to prepare a cell suspension;
s2, calculating the cell concentration in the cell suspension and detecting that the cell activity is not lower than 90%;
s3, separating different subcellular groups in the cell suspension;
s4, degrading the same subcellular population by using a cellulose enzymolysis solution to form a cell wall-removed protoplast, and centrifugally collecting a cell sediment sample;
s5, sequencing cell sediment samples of different subcellular populations by SMART-seq library construction;
and S6, taking the cDNA obtained by library construction as a template, and detecting the expression quantity of the target gene in different subcellular populations by adopting fluorescent quantitative PCR (polymerase chain reaction) to verify.
Preferably, in S1 and S4, the cellulose hydrolysate comprises the following raw material components: 3wt% of cellulase, 1.5wt% of macerozyme, 0.3wt% of pectinase, 0.25wt% of bovine serum albumin, and the balance of mannitol, gamma ethyl sodium sulfonate, ampicillin sodium and sterile water, wherein the mannitol accounts for 8w/v% of the cellulose hydrolysate, 1mM of gamma ethyl sodium sulfonate is contained in each 6mL of cellulose hydrolysate, and 0.01g of ampicillin sodium is contained in each 1L of cellulose hydrolysate.
Preferably, the macerase is macerase R-10 and the pectinase is pectinase Y-23.
Preferably, the preparation method of the cellulase comprises the following steps: mixing cellulase, macerozyme, pectinase, bovine serum albumin, mannitol and gamma ethyl sodium sulfonate, placing in a water bath kettle at 50-60 deg.C for 10-30 min, adding sterile water to desired volume, adding ampicillin sodium, and filtering to obtain cellulose hydrolysate.
Preferably, in S1, the plant tissue is a tissue of a plant of the family leguminosae or cucurbitaceae.
Preferably, in S1, the plant tissue is peanut leaf filament, and the preparation method of the peanut leaf filament comprises: taking out an embryoid in the peanut seed, placing the embryoid in a culture medium for culturing, taking down a first true leaf stretched out from the embryoid when the embryoid grows out, cutting the first true leaf into filaments, and soaking the filaments in 8wt% mannitol solution for later use.
Preferably, in S1, the conditions for the primary degradation of the plant tissue by the cellulase hydrolysate are as follows: the shaking table treatment is carried out for 0.5h to 2h at the speed of 40 r/min to 45 r/min and at the temperature of 25 ℃ to 30 ℃.
Preferably, in S4, the conditions for degrading the same subcellular population by the cellulase hydrolysate are as follows: treating for 1-3 h by a shaking table at a speed of 40-45 r/min and at a temperature of 25-30 ℃.
Preferably, in the S2, the cell activity of the cell suspension is detected by trypan blue staining, and the volume ratio of the cell suspension to 0.4wt% trypan blue mother liquor is 9:1 mixing, observing under microscope and calculating cell activity.
Preferably, in S3, the cell suspension after trypan blue staining in step S2 is used as a peanut leaf sample, a micropipette is used to separate and remove dead cells in the peanut leaf sample, and then cells of different subcellular groups are separated.
Compared with the prior art, the embodiment of the invention has the following beneficial effects:
1. because the leaf tissue is composed of countless single cells, the detection can not be directly carried out by the fluorescence quantitative PCR at the single cell or subcellular level, the method adopts the cellulose enzymolysis liquid to degrade the cells in advance so as to separate different subcellular population cells, and then after the cells are degraded by the cellulose enzymolysis liquid again to form protoplasts, the cDNA of the same subcellular population can be extracted by using the SMART-seq library construction, and the cDNA is used as a template to carry out the fluorescence quantitative PCR detection on the expression of a target gene. The method is different from the prior gene expression verification technology on the plant tissue level, the high-throughput verification of the gene expression is carried out on the single cell and sub-cell level, the expression levels of a plurality of target genes can be verified simultaneously, the test period is short, the test cost is reduced, and the verification operation is simple, convenient, efficient and quick.
Drawings
FIG. 1: the experimental flow diagram of the high-throughput verification method for the sequencing result of the plant tissue unicell transcriptome in the step 6-9 is shown in the embodiment of the invention;
FIG. 2: the gene expression quantity result generated by sequencing the single cells of the peanut leaves in the embodiment of the invention;
FIG. 3: the invention provides a high-throughput verification method for a plant tissue single cell transcriptome sequencing result, which is a fluorescence quantitative PCR detection result after SMART-seq library construction in step 9.
Detailed Description
The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.
Example one
A high-throughput verification method for sequencing results of plant tissue unicellular transcriptome is disclosed, the plant tissue can be leguminous or cucurbitaceae plant tissue, such as leaf tissue of plants like peanut, soybean, pea, kidney bean, pumpkin, white gourd, Hami melon, cucumber, etc., in this embodiment, the peanut leaf tissue is selected as a detection sample, and the method comprises the following verification steps:
1. preparing peanut leaf slice materials:
1.1, sterilizing peanut seeds by adopting a 70wt% ethanol solution, cleaning the peanut seeds for more than three times by using sterile water, removing cotyledons of the peanut seeds, and taking out embryoids;
1.2, placing the embryoid in 1/2MS agarose culture medium, culturing for a week, until the embryoid grows out a first true leaf, taking down the first true leaf stretched out by the peanut embryoid with a sharp blade, cutting into filaments with about 1-2 mm, mixing about 5 peanut leaves as a test, and soaking all the filaments of the peanut leaves in 8wt% mannitol solution for later use.
2. Preparing 30mL of cellulose hydrolysate:
2.1, mixing 3wt% of cellulase, 1.5wt% of macerozyme R-10, 0.3wt% of pectinase Y-23, 0.25wt% of bovine serum albumin, 8w/v% of mannitol and 5mM of gamma ethyl sodium sulfonate, wherein Ca2+ and Mg2+ are not added in all solutions, then placing the solutions in a water bath kettle at 50-60 ℃, preferably 55 ℃, for 10-30 min, preferably 10min, cooling to room temperature, and fixing the volume to 30mL by using sterile water;
2.2, then 30 microliter of ampicillin sodium with the concentration of 0.01g/mL is added, the cellulose enzymolysis solution is absorbed by a syringe, a filter-sterilized 0.45 mu m filter head is loaded, and the cellulose enzymolysis solution after filter sterilization is reserved.
3. The cellulase enzymolysis method primarily degrades cell walls, and the cells keep the original shape:
3.1, taking out the peanut leaf filaments soaked in the 8wt% mannitol solution in the step 1, filtering the peanut leaf filaments by using a 40-micron cell sieve, and washing the peanut leaf filaments by using the 8wt% mannitol solution for more than three times to remove cell debris;
3.2, putting the washed fine peanut leaf threads into 15mL of the cellulose enzymolysis liquid obtained in the step 2, and placing the solution in a shaking table for treatment for 30min, wherein the temperature is controlled at 28 ℃ and the speed is 45 revolutions per minute.
4. Calculating the concentration of the cell suspension:
the cell suspension treated in step 3 is removed, and 5mL to 10mL, preferably 5mL in this example,filtering the supernatant with a 40 μm cell sieve, placing 20 μ L of the filtered supernatant on a glass slide, counting the number of peanut leaf cells under microscope using a hemocytometer, and diluting the supernatant to a density of about 0.5-1 × 10 for easy micromanipulation based on the counting result5one/mL.
5. Cell viability was observed by trypan blue staining:
5.1, weighing 4g of trypan blue, adding a small amount of distilled water for grinding, adding double distilled water to 100mL, filtering by using filter paper to prepare 4wt% of trypan blue mother liquor, and storing at 4 ℃;
5.2, when in use, diluting the mass fraction of 4wt% trypan blue mother liquor to 0.4wt% by PBS, taking 1ml of cell suspension obtained in the step 3 and 0.4% trypan blue solution, mixing uniformly according to the volume ratio of 9:1, dyeing for 1min, observing under a 10 microliter microscope, dyeing dead cells into obvious blue, and calculating the activity of the cells, wherein the number of the living cells reaches more than 90%, and carrying out subsequent tests.
6. Separating peanut leaf cells by using a micropipette:
6.1, preparing a micropipette: the heated glass capillary tube is thinned by using a micro-injection needle drawing instrument, the capillary tube is elongated by respectively setting different temperature parameters twice by adopting a two-step method, the inner diameter of the prepared micropipette is about 100 mu m, and the micropipette is connected with a mouth pipette for standby;
6.2, pouring 1ml of cell suspension mixed with trypan blue staining agent prepared in the step 5 into a 35mm culture dish, under an inverted microscope, finding the needle point of the micro-suction tube under a 10-fold objective field of view according to the difference of cell morphology, moving the needle point to be close to the cells with the target morphology, applying negative pressure to the light suction port suction tube, slowly moving the target cells to the inside of the needle point of the micro-suction tube, putting the micro-suction tube into a 2ml centrifugal tube containing 1ml of cellulose enzymolysis liquid again, and releasing the cells through positive pressure. According to the morphology of plant leaf cells, different sub-cell populations not stained by trypan blue, such as the sponge tissue cells of mesophyll (oval), the mesophyll fence tissue cells (long rod), the epidermal cells (irregular shape), about 200 cells per cell population, can be picked up under a microscope by direct observation.
7. The cellulose enzymolysis liquid decomposes the cell wall of the same subcellular group for the second time, so that the cell becomes a protoplast without the cell wall:
7.1, each subcellular group contains about 200 cells, the same subcellular group is added into 1.5mL of cellulose enzymolysis liquid and is placed in a shaking table for 1.5 hours, the temperature is controlled at 28 ℃, and the speed is 45 r/min;
7.2, after the treatment time is over, freezing and centrifuging for 5min by taking 350g of centrifugal force as a standard, removing the cellulase hydrolysate of the supernatant, and reserving the residual cell sediment for later use.
8. SMART-seq library construction:
and (3) processing the cell sediment obtained in the step (7) by using a SMART-Seq HT Kit library building Kit, inverting the RNA of the subcellular population into a first single-stranded cDNA, and continuously amplifying for 15 reactions by using PCR and random primers and reverse-transcribed cDNA as a template to ensure that the final concentration is about 100 ng/mu l.
9. Detecting the expression level of the target gene in different subcellular populations by fluorescent quantitative PCR:
taking cDNA of different subcellular populations obtained by establishing a library as a template, performing a fluorescent quantitative PCR reaction system of 20 mu L by adopting an ABI StepOne Plus system and SYBR Premix ExTaq (TaKaRa, Chinese Dalian) and performing PCR reaction by using 2-ΔΔThe ct method is used to calculate the relative expression level of the target gene in each subcellular population, and RBCS (RBCS-F: AAGTAGACTACCTTCTAAGG, RBCS-R: TCCTTGATGACCTGACCTGA) is used as the reference gene, in this embodiment, AHL23, DREB1D, ERF4, GOS3, NAC002, SAP3, UAF30 and ERF15 are selected as the target gene, the primer sequence of the target gene is shown in Table 1, each sample is subjected to three repetitions, the data are shown by the mean value + -standard deviation, and the result is shown in FIG. 3.
TABLE 1 primer sequences for target genes in fluorescent quantitative PCR
| Name of Gene | Forward primer | Reverse primer |
| AHL23 | ATCCAAGAACAAGCCCAAGC | ACCTGCCGTGGAGCGTGACT |
| DREB1D | ACCTATCAATAGCAAGAGTG | TCTATATAGGTTTCACTTGGTG |
| ERF4 | AGAGCAGCACCGTCGAATCTT | GCGTCGAGGTACAGAGCCTGCT |
| GOS3 | AGCTTGACAACTGTCCAGG | AGCCTGAACTAGGAAGGTAGAC |
| NAC002 | GTGACGACAGATTATATGTACT | ACCGTTCGTGAGTGTGGCATC |
| SAP3 | CCACGCAGAACCTCTGCTCCA | GAAGATGACGAATCGATCGCT |
| UAF30 | AGGAAGCCTCTTCAGGTCTG | TCTGCTTGAGAGCCTGGGTT |
| ERF15 | TTCTATGCTGCTGAGGATGAT | ATGTCTTGTGTCCAGTTTCTTCT |
| RBCS | AAGTAGACTACCTTCTAAGG | TCCTTGATGACCTGACCTGA |
The above-mentioned embodiments are provided to further explain the objects, technical solutions and advantages of the present invention in detail, and it should be understood that the above-mentioned embodiments are only examples of the present invention and are not intended to limit the scope of the present invention. It should be understood that any modifications, equivalents, improvements and the like, which come within the spirit and principle of the invention, may occur to those skilled in the art and are intended to be included within the scope of the invention.
Claims (10)
1. A high-throughput verification method for sequencing results of plant tissue single cell transcriptome is characterized by comprising the following steps:
s1, performing primary degradation on plant tissues by using a cellulose enzymolysis solution to keep cells in an original form to prepare a cell suspension;
s2, calculating the cell concentration in the cell suspension and detecting that the cell activity is not lower than 90%;
s3, separating different subcellular groups in the cell suspension;
s4, degrading the same subcellular population by using a cellulose enzymolysis solution to form a cell wall-removed protoplast, and centrifugally collecting a cell sediment sample;
s5, sequencing cell sediment samples of different subcellular populations by SMART-seq library construction;
and S6, taking the cDNA obtained by library construction as a template, and detecting the expression quantity of the target gene in different subcellular populations by adopting fluorescent quantitative PCR (polymerase chain reaction) to verify.
2. The method for high throughput validation of sequencing results of plant tissue single cell transcriptome of claim 1, wherein in said S1 and S4, said cellulase hydrolysate comprises the following raw material components: 3wt% of cellulase, 1.5wt% of macerozyme, 0.3wt% of pectinase, 0.25wt% of bovine serum albumin, and the balance of mannitol, gamma ethyl sodium sulfonate, ampicillin sodium and sterile water, wherein the mannitol accounts for 8w/v% of the cellulose hydrolysate, 1mM of gamma ethyl sodium sulfonate is contained in each 6mL of cellulose hydrolysate, and 0.01g of ampicillin sodium is contained in each 1L of cellulose hydrolysate.
3. The method for high throughput validation of sequencing results of a plant tissue single cell transcriptome of claim 2, wherein said macease is macerase R-10 and said pectinase is pectinase Y-23.
4. The method for high throughput validation of sequencing results of plant tissue single cell transcriptome of claim 2, wherein said cellulase is prepared by: mixing cellulase, macerozyme, pectinase, bovine serum albumin, mannitol and gamma ethyl sodium sulfonate, placing in a water bath kettle at 50-60 deg.C for 10-30 min, adding sterile water to desired volume, adding ampicillin sodium, and filtering to obtain cellulose hydrolysate.
5. The method for high throughput validation of sequencing results of a plant tissue single cell transcriptome of claim 1, wherein in said S1, said plant tissue is a tissue of a plant of the family Leguminosae or Cucurbitaceae.
6. The method for high throughput validation of sequencing results of plant tissue single cell transcriptome of claim 1, wherein in said S1, said plant tissue is peanut leaf filament prepared by: taking out an embryoid in the peanut seed, placing the embryoid in a culture medium for culturing, taking down a first true leaf stretched out from the embryoid when the embryoid grows out, cutting the first true leaf into filaments, and soaking the filaments in 8wt% mannitol solution for later use.
7. The method for high throughput validation of sequencing results of a plant tissue single cell transcriptome of claim 1, wherein: in S1, the conditions for primary degradation of plant tissue by the cellulase hydrolysate are as follows: the shaking table treatment is carried out for 0.5h to 2h at the speed of 40 r/min to 45 r/min and at the temperature of 25 ℃ to 30 ℃.
8. The method for high throughput validation of sequencing results of plant tissue single cell transcriptome of claim 1, wherein in said S4, said cellulase hydrolysate degrades the same subcellular population under the following conditions: treating for 1-3 h by a shaking table at a speed of 40-45 r/min and at a temperature of 25-30 ℃.
9. The method for high throughput verification of sequencing results of plant tissue single cell transcriptome of claim 1, wherein in said S2, cell activity in cell suspension is detected by trypan blue staining, and the volume ratio of cell suspension to 0.4wt% trypan blue stock solution is 9:1 mixing, observing under microscope and calculating cell activity.
10. The method for high throughput validation of sequencing results of plant tissue single cell transcriptome of claim 7, wherein in said S3, a cell suspension after trypan blue staining in step S2 is used as a peanut leaf sample, a micropipette is used to separate and remove dead cells in said peanut leaf sample, and then cells of different sub-cell groups are separated.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111211503.XA CN114015750A (en) | 2021-10-18 | 2021-10-18 | High-throughput verification method for plant tissue single cell transcriptome sequencing result |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111211503.XA CN114015750A (en) | 2021-10-18 | 2021-10-18 | High-throughput verification method for plant tissue single cell transcriptome sequencing result |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN114015750A true CN114015750A (en) | 2022-02-08 |
Family
ID=80056700
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111211503.XA Pending CN114015750A (en) | 2021-10-18 | 2021-10-18 | High-throughput verification method for plant tissue single cell transcriptome sequencing result |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114015750A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114457020A (en) * | 2022-02-28 | 2022-05-10 | 上海交通大学医学院 | Single cell sorting method and application thereof |
| CN114807008A (en) * | 2022-06-20 | 2022-07-29 | 安阳工学院 | Preparation method and application of tomato leaf protoplast single cell suspension |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111718887A (en) * | 2020-06-17 | 2020-09-29 | 广东省农业科学院作物研究所 | Method for separating protoplasts of different tissues and organs of peanuts and application of method |
| CN112680399A (en) * | 2020-12-29 | 2021-04-20 | 广州基迪奥生物科技有限公司 | Preparation method and application of plant protoplast single cell suspension |
-
2021
- 2021-10-18 CN CN202111211503.XA patent/CN114015750A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111718887A (en) * | 2020-06-17 | 2020-09-29 | 广东省农业科学院作物研究所 | Method for separating protoplasts of different tissues and organs of peanuts and application of method |
| CN112680399A (en) * | 2020-12-29 | 2021-04-20 | 广州基迪奥生物科技有限公司 | Preparation method and application of plant protoplast single cell suspension |
Non-Patent Citations (2)
| Title |
|---|
| HAO LIU等: "Single-cell RNA-seq describes the transcriptome landscape and identifies critical transcription factors in the leaf blade of the allotetraploid peanut (Arachis hypogaea L.)", 《PLANT BIOTECHNOLOGY JOURNAL》 * |
| 李益等: "植物单细胞转录组测序研究进展", 《生物技术通报》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114457020A (en) * | 2022-02-28 | 2022-05-10 | 上海交通大学医学院 | Single cell sorting method and application thereof |
| CN114807008A (en) * | 2022-06-20 | 2022-07-29 | 安阳工学院 | Preparation method and application of tomato leaf protoplast single cell suspension |
| CN114807008B (en) * | 2022-06-20 | 2023-09-29 | 安阳工学院 | Preparation method and application of tomato leaf protoplast single-cell suspension |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN114015750A (en) | High-throughput verification method for plant tissue single cell transcriptome sequencing result | |
| Fukui | Plant chromosomes at mitosis | |
| CN1294262C (en) | Method for collecting and using nuclear mRNA | |
| CN110218700A (en) | It is a kind of to prepare the single celled method of animal mature neuron | |
| CN113293196A (en) | Single cell nucleus extraction method suitable for frozen tissue | |
| CN109596502B (en) | Method for rapidly identifying sweet potato genome size and application thereof | |
| Camloh et al. | Jasmonic acid promotes division of fern protoplasts, elongation of rhizoids and early development of gametophytes | |
| CN113897330A (en) | Enzymolysis method for quickly removing cell walls of poplar or eucalyptus and application | |
| CN114807008B (en) | Preparation method and application of tomato leaf protoplast single-cell suspension | |
| CN106376501A (en) | Method for producing loach tetraploid | |
| CN113717922B (en) | Kit containing transcription inhibitor and suitable for separating arabidopsis thaliana leaf tissue protoplast and application thereof | |
| CN113736667A (en) | Oversized protoplast of macrofungi with long petioles and preparation method thereof | |
| Karp | Cytological techniques | |
| Davidovich et al. | Sexual reproduction and mating system of the diatom Tabularia tabulata (C. Agardh) Snoeijs (Bacillariophyta) | |
| CN108624547B (en) | Method for separating monocotyledon guard cells | |
| CN106644636A (en) | Microdissection technology of tobacco chromosomes | |
| CN113249296A (en) | Method for separating and purifying fresh tissue protoplast of tea tree | |
| CN109576348B (en) | Processing method for chromosome slide of root tip chromosome fluorescence in situ hybridization of hyacinth plants | |
| CN113325201B (en) | Method suitable for atomic force microscope observation of cell skeletons of perennial fruit trees | |
| CN111518745A (en) | Preparation method and detection method of human parathyroid single cell suspension | |
| CN112393957A (en) | Simple preparation method of fish chromosome karyotype | |
| Veuskens et al. | Flow cytometry and sorting of plant chromosomes | |
| CN110747268A (en) | Application of serum exosome ssc-miR-17-5p as molecular marker for early pregnancy diagnosis of sow | |
| CN108383899A (en) | A kind of WRKY transcription factors of regulation and control gold the operatic circle top hardening | |
| CN214952520U (en) | Circulating tumor cell hematoxylin-eosin staining device and hematoxylin-eosin staining and trace nucleic acid extracting and concentrating device |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20220208 |