CN114015704B

CN114015704B - 3-bromo-4-hydroxybenzoic acid oxidase gene cluster phbh2pcaA2B2 and application thereof

Info

Publication number: CN114015704B
Application number: CN202111331740.XA
Authority: CN
Inventors: 蒋建东; 陈凯
Original assignee: Nanjing Agricultural University
Current assignee: Nanjing Agricultural University
Priority date: 2021-11-11
Filing date: 2021-11-11
Publication date: 2023-05-26
Anticipated expiration: 2041-11-11
Also published as: CN114015704A

Abstract

The invention discloses a 3-bromo-4-hydroxybenzoic acid oxidase gene cluster phbh2pcaA2B2 and application thereof. The invention provides the 3-bromo-4-hydroxybenzoic acid oxidase gene cluster phbh2pcaA2B2 (SEQ ID NO. 1). The engineering strain constructed by the gene cluster can rapidly degrade 3-bromo-4-hydroxybenzoic acid, and the expressed monooxygenase PHBH2 (SEQ ID NO. 3) and dioxygenase PcaA2B2 (SEQ ID NO.5 and NO. 7) can sequentially convert 3-bromo-4-hydroxybenzoic acid into 3-bromo-4, 5-dihydroxybenzoic acid and 2-bromo-4-carboxyl-hexadienoic diacid. Therefore, the produced degradation microbial inoculum can be used for removing the residual 3-bromo-4-hydroxybenzoic acid in soil and water, and the expressed PHBH2 enzyme preparation can also be used for degrading and converting the 3-bromo-4-hydroxybenzoic acid in soil and water.

Description

3-bromo-4-hydroxybenzoic acid oxidase gene cluster phbh2pcaA2B2 and application thereof

Technical Field

The invention belongs to the field of application environment microorganisms, and relates to a 3-bromo-4-hydroxybenzoic acid oxidase gene cluster phbh2pcaA2B2 and application thereof.

Background

3-bromo-4-hydroxybenzoic acid is used as an important chemical intermediate and widely applied to synthesis of industrial and agricultural chemicals. In addition, 3-bromo-4-hydroxybenzoic acid is also an intermediate product in the degradation of many halogenated aromatic hydrocarbons (e.g., bromoxynil octanoate, polybrominated diphenyl ether, etc.). Because of the strong electron adsorption effect of halogen atoms, 3-bromo-4-hydroxybenzoic acid is easy to generate toxicity to living cells, and has great threat to human health and ecological environment safety. In addition, 3-bromo-4-hydroxybenzoic acid is easily soluble in water, has a high diffusion coefficient, and is easily polluted by rivers, groundwater, and the like. Therefore, the problem of environmental pollution and the problem of restoration of the polluted environment of 3-bromo-4-hydroxybenzoic acid have attracted a great deal of attention. Compared with the traditional physical and chemical restoration means such as leaching, burning and the like, the method for restoring the organic matter pollution by utilizing the microorganism is a green, efficient, low-cost and secondary pollution-free method. The diversity of metabolic pathways makes microorganisms the dominant force for the degradation of organic pollutants in the environment. Enzymes synthesized by microorganisms play a decisive role in the degradation and repair of organic pollutants. The extracted degrading enzyme can eliminate organic pollutant residue in the forefront of success abroad, and the source of the degrading enzyme can be obtained by extracting from degrading bacteria or constructing high-efficiency expression strain by adopting genetic engineering means. The degrading gene cluster of 3-bromo-4-hydroxybenzoic acid is cloned from microorganism, engineering bacteria with high-efficiency degrading capability is constructed by genetic engineering means, and high-efficiency expression strain of degrading enzyme can be constructed for producing enzyme preparation. The acquisition of the 3-bromo-4-hydroxybenzoic acid degradation gene cluster has great application potential in the field of repairing 3-bromo-4-hydroxybenzoic acid pollution. Meanwhile, the range of the action substrate of the degrading enzyme can be enlarged through genetic modification, and the method can be widely applied to degradation and detoxification of halogenated p-hydroxybenzoic acid in the environment and protect the environment.

Disclosure of Invention

The invention aims to provide a novel oxidase gene cluster phbh2pcaA2B2 involved in 3-bromo-4-hydroxybenzoic acid degradation.

Another object of the present invention is to provide a monooxygenase PHBH2 encoded by a monooxygenase gene PHBH2 and a dioxygenase PcaA2B2 encoded by a dioxygenase gene pcaA2B2.

It is a further object of the invention to provide the use of the oxidase gene cluster phbh2pcaA2B2.

The aim of the invention can be achieved by the following technical scheme:

the nucleotide sequence of the 3-bromo-4-hydroxybenzoic acid oxidase gene cluster phbh2pcaA2B2 is SEQ ID NO.1, the whole field length of the gene cluster is 2376bp, and the gene cluster mainly comprises a monooxygenase gene phbh2, a dioxygenase alpha subunit gene pcaA2 and a dioxygenase beta subunit gene pcaB 2.

The nucleotide sequence of the 3-bromo-4-hydroxybenzoic acid monooxygenase gene phbh2 is SEQ ID NO.2. The full length of the gene (from the start codon to the stop codon) is 1176bp, the G+C content is 69.47%, 391 amino acids are encoded, and the molecular weight is 43.2kDa.

The 3-bromo-4-hydroxybenzoic acid monooxygenase gene PHBH2 codes monooxygenase PHBH2, and the amino acid sequence is SEQ ID NO.3.

A dioxygenase gene pcaA2B2, the nucleotide sequence of alpha subunit gene pcaA2 is SEQ ID NO.4. The full length of the gene (from a start codon to a stop codon) is 363bp, the G+C content is 63.37%, 120 amino acids are encoded, and the molecular weight is 13.5kDa; the nucleotide sequence of the beta subunit gene pcaB2 is SEQ ID NO.6. The full length of the gene (from the start codon to the stop codon) is 840bp, the G+C content is 65.95%, 279 amino acids are encoded, and the molecular weight is 31.6kDa.

The dioxygenase alpha subunit PcaA2 coded by the dioxygenase alpha subunit gene pcaA2 has an amino acid sequence of SEQ ID NO.5; the amino acid sequence of the dioxygenase beta subunit PcaB2 coded by the dioxygenase beta subunit gene pcaB2 is SEQ ID NO.7.

Recombinant plasmid containing 3-bromo-4-hydroxybenzoate monooxygenase gene phbh2 of the present invention.

As a preferred mode of the invention, the monooxygenase gene fragment is subjected to enzyme ligation with the digested pBBR1MCS-2 to obtain a recombinant plasmid pBBR-phbh2 containing the monooxygenase gene.

As a preferred mode of the invention, the monooxygenase gene fragment is subjected to enzyme ligation with the digested pET-29a (+) to obtain a recombinant plasmid pET-phbh2 containing the monooxygenase gene.

Recombinant microorganisms comprising the recombinant plasmids of the invention.

As a preferred mode of the invention, the recombinant plasmid pBBR-phbh2 containing the monooxygenase gene which is connected by enzyme is transformed into the expression host bacterium E.coli DH5 alpha to obtain the recombinant microorganism E.coli DH5 alpha (pBBR-phbh 2).

As a preferred mode of the invention, the recombinant plasmid pET-phbh2 containing the monooxygenase gene which is connected by enzyme is transformed into an expression host bacterium E.coli BL21 (DE 3) to obtain a recombinant microorganism E.coli BL21 (pET-phbh 2).

Recombinant plasmid containing the oxygenase gene cluster phbh2pcaA2B2.

As a preferred mode of the invention, the oxygenase gene cluster fragment is subjected to enzymatic ligation with the digested pBBR1MCS-2 to obtain a recombinant plasmid pBBR-phbh2pcaA2B2.

As a preferred mode of the invention, the recombinant plasmid pBBR-phbh2pcaA2B2 containing the dioxygenase gene which is connected by enzyme is transformed into the expression host bacterium E.coli DH5 alpha to obtain the recombinant microorganism E.coli DH5 alpha (pBBR-phbh 2pcaA2B 2).

The oxidase gene cluster phbh2pcaA2B2, the recombinant plasmid containing the gene cluster and the recombinant microorganism can be applied to the removal of 3-bromo-4-hydroxybenzoic acid residues in soil and/or water.

The invention relates to a monooxygenase PHBH2 gene, a monooxygenase PHBH2 coded by the same, a recombinant plasmid containing the monooxygenase gene, and application of recombinant microorganisms in removing 3-bromo-4-hydroxybenzoic acid residues in soil and/or water.

Advantageous effects

1. The invention clones 3-bromo-4-hydroxybenzoic acid oxidase gene cluster phbh2pcaA2B2 from halogenated hydroxybenzoic acid degradation strain Pigmentighaga sp.H8 (patent strain preservation number is CCTCC NO: M2017222).

2. The monooxygenase gene phbh2 in the gene cluster is cloned into an expression vector pBBR1MCS-2 to obtain a recombinant expression plasmid pBBR-phbh2, and the recombinant expression plasmid pBBR-phbh2 is transferred into an expression strain E.coli DH5 alpha (purchased from the company of invitrogen) by a transformation method to obtain a recombinant expression strain E.coli DH5 alpha (pBBR-phbh 2).

3. According to the invention, a whole cell transformation test is carried out on a recombinant expression strain E.coli DH5 alpha (pBBR-phbh 2) containing a monooxygenase gene phbh2, and the recombinant expression strain is found to be capable of rapidly transforming 3-bromo-4-hydroxybenzoic acid into 3-bromo-4, 5-dihydroxybenzoic acid.

4. The monooxygenase gene phbh2 in the gene cluster is cloned into a high-efficiency expression vector pET29a (+) (purchased from Novegen) to obtain a recombinant expression plasmid pET-phbh2, and the recombinant expression plasmid pET-phbh2 is transferred into a high-efficiency expression strain E.coli BL21 (DE 3) (purchased from invrotgen) by a conversion method to obtain a recombinant expression strain E.coli BL21 (pET-phbh 2).

5. Recombinant expression strain E.coli BL21 (pET-phbh 2) is induced by 0.5mM IPTG for 18h, and is expressed in a large amount to carry His ₆ The tag of the monooxygenase PHBH2 was further purified by elution through a Co-Talon affinity column (available from GE company) to obtain pure monooxygenase PHBH2.

6. According to the invention, enzymatic degradation tests are carried out on a product PHBH2 expressed by a monooxygenase gene PHBH2, and the PHBH2 is found to take NADPH and FAD as cofactors, so that 3-bromo-4-hydroxybenzoic acid can be rapidly oxidized into 3-bromo-4, 5-dihydroxybenzoic acid.

7. Cloning the gene cluster phbh2pcaA2B2 into an expression vector pBBR1MCS-2 to obtain a recombinant expression plasmid pBBR-phbh2pcaA2B2, transferring the recombinant expression plasmid pBBR-phbh2pcaA2B2 into an expression strain E.coli DH5 alpha (purchased from the company of invitrogen) by a conversion method to obtain a recombinant expression strain E.coli DH5 alpha (pBBR-phbh 2pcaA2B 2).

8. According to the invention, a whole cell transformation test is carried out on a recombinant expression strain E.coli DH5 alpha (pBBR-phbh 2pcaA2B 2) containing an oxidase gene cluster phbh2pcaA2B2, and the recombinant expression strain is found to be capable of rapidly transforming 3-bromo-4-hydroxybenzoic acid into a final product 2-bromo-4-carboxyl-hexadienoic acid.

9. The engineering strain constructed by the oxidase gene cluster phbh2pcaA2B2 is fermented to prepare the degradation microbial inoculum, so that the residual 3-bromo-4-hydroxybenzoic acid in soil and water can be efficiently removed.

10. The engineering strain constructed by utilizing the monooxygenase gene PHBH2 can efficiently express PHBH2, and the produced enzyme preparation can be used for removing residual 3-bromo-4-hydroxybenzoic acid in soil and water.

Drawings

FIG. 1 shows the degradation curve of the recombinant strain E.coli DH 5. Alpha. (pBBR-phbh 2) of the invention against 3-bromo-4-hydroxybenzoic acid.

FIG. 2 is a mass spectrum detection diagram of the metabolic product of the recombinant strain E.coli DH5 alpha (pBBR-phbh 2) of the invention for degrading 3-bromo-4-hydroxybenzoic acid.

FIG. 3 shows the degradation curve of the recombinant strain E.coli DH 5. Alpha. (pBBR-phbh 2pcaA2B 2) of the invention against 3-bromo-4-hydroxybenzoic acid.

FIG. 4 is a mass spectrum detection diagram of the final product of 3-bromo-4-hydroxybenzoic acid degradation by recombinant strain E.coli DH 5. Alpha (pBBR-phbh 2pcaA2B 2) of the present invention.

FIG. 5 shows the metabolic mechanism of 3-bromo-4-hydroxybenzoic acid by the monooxygenase and dioxygenase encoded by the oxidase gene cluster phbh2pcaA2B2 of the present invention.

FIG. 6 is a SDS-PAGE electrophoresis of the expression and purification of the monooxygenase PHBH2 of the present invention.

FIG. 7 is a graph showing the results of examining the optimum reaction temperature and the optimum reaction pH of the monooxygenase PHBH2 of the present invention.

Biological material preservation information

H8, classified and named as Pigmentighaga sp.H8, is preserved in China center for type culture collection, and has a strain preservation number of CCTCC NO: m2017222, the preservation date is 28 days of 2017, 04 months, and the preservation address is the university of Wuhan in China.

The specific embodiment is as follows:

example 13 cloning of the bromo-4-hydroxybenzoate oxidase Gene cluster phbh2pcaA2B2

1.1 extraction of genomic Total DNA from Strain H8

After the strain H8 is largely cultured, the high-purity large-fragment genome total DNA is extracted by adopting a CTAB method, is dissolved in TE (pH 8.0) and is preserved at-20 ℃, and the specific method is referred to the fine programming molecular biology experimental guideline of F.Osbur et al.

1.2 genome sequencing and Gene acquisition of interest

The qualified Picgmentighaga sp.H8 genome DNA was sent to Shanghai Ling En biotechnology Co.Ltd, and the complete bacterial genome sequencing was performed using the Illumina Hiseq 2500 platform in combination with the PacBio RS single molecule sequencing platform. Genomic sequencing results showed that the strain H8 genome sketch was 5.99Mb in size, predictive of a total of 5600 Open Reading Frames (ORFs). The oxidase gene cluster phbh2pcaA2B2 for degrading 3-bromo-4-hydroxybenzoic acid is obtained from genome by using comparative genomics and comparative proteomics methods, and the nucleotide sequence of the oxidase gene cluster phbh2pcaA2B2 is shown as SEQ ID NO.1.

1.3 functional verification of the monooxygenase Gene phbh2

1.3.1 PCR amplification of the monooxygenase Gene phbh2

Primer sequence:

phbh2-f1：CTGGGTACCTGATCACGCTGGAGGAGC(KpnI)(SEQ ID NO.8)；

phbh2-r1：TCCAGATCTCTAGGCCTCGATCGGCAACC(BglII)(SEQ ID NO.9)。

the monooxygenase gene phbh2 was amplified using primers phbh2-f1 and phbh2-r1, and the PCR amplification system was as follows:

PCR amplification procedure:

denaturation at a.98℃for 2min

Denaturation at 98℃for 15s, annealing at 60℃for 15s, elongation at 68℃for 80s, 30 cycles

c, extending for 5min at the temperature of 68 ℃,

d.10℃5min。

1.3.2 cleavage, ligation and conversion

The phbh2 gene obtained by PCR amplification was subjected to stepwise digestion with KpnI and BglII, the vector pBBR1MCS-2 was subjected to stepwise digestion with KpnI and BamHI, and the digested product was recovered with a DNA purification kit.

The phbh2 gene fragment subjected to KpnI/BglII double digestion is enzymatically connected to a pBBR1MCS-2 vector according to the following reaction system to construct a recombinant plasmid pBBR-phbh2.

Incubate at 16℃for 12 hours.

The constructed pBBR-phbh2 was transformed into 100. Mu.L competent cells of the expression host strain E.coli DH 5. Alpha. By the specific method described in "Fine programming molecular biology laboratory Manual" P23 by F.Osbur et al. The recombinant strain E.coli DH 5. Alpha. (pBBR-phbh 2) was obtained by plating on LB plates containing 50mg/L kanamycin, and culturing for 18 hours, and then picking up positive clones.

1.3.3 degradation of 3-bromo-4-hydroxybenzoic acid by recombinant Strain E.coli DH 5. Alpha (pBBR-phbh 2)

Recombinant strain E.coli DH 5. Alpha (pBBR-phbh 2) and control strain E.coli DH 5. Alpha (pBBR 1 MCS-2) were each cultured in LB medium containing 50mg/L kanamycin for 12h. The cells were collected by centrifugation at 6000rpm, centrifuged with a sterile basic salt solution, washed 2 times, and resuspended with the basic salt solution. According to OD ₆₀₀ For an initial inoculum size of 1, recombinant strain E.coli DH 5. Alpha. (pBBR-phbh 2) and control strain E.coli DH 5. Alpha. (pBBR 1 MCS-2) were inoculated into a basic salt solution containing 0.2mM 3-bromo-4-hydroxybenzoic acid, and whole cell transformation experiments were performed in a shaker at 30 ℃. The recombinant strain E.coli DH 5. Alpha. (pBBR-phbh 2) was found to degrade 0.2mM 3-bromo-4-hydroxybenzoic acid almost completely within 4h, whereas the control strain E.coli DH 5. Alpha. (pBBR 1 MCS-2) which did not carry the phbh2 gene did not degrade 3-bromo-4-hydroxybenzoic acid (FIG. 1), indicating that the protein encoded by the monooxygenase gene phbh2 is a key enzyme catalyzing the initial degradation of 3-bromo-4-hydroxybenzoic acid. The degradation products were identified by UPLC-MS as 3-bromo-4, 5-dihydroxybenzoic acid (FIG. 2).

1.4 functional verification of the dioxygenase Gene pcaA2B2

1.4.1 PCR amplification of the Gene cluster phbh2pcaA2B2

Primer sequence:

Pca-phbh2-f：CTAGGTACCGTTTTCCCTCTACCCAAGGA(KpnI)(SEQ ID NO.10)；

Pca-phbh2-r：CATAAGCTTCTAGGCCTCGATCGGCAACC(HindIII)(SEQ ID NO.11)。

the gene cluster phbh2pcaA2B2 fragment was amplified using primers Pca-phbh2-f and Pca-phbh2-r, and the PCR amplification system was as follows:

PCR amplification procedure:

denaturation at a.98℃for 2min

Denaturation at 98℃for 15s, annealing at 60℃for 15s, elongation at 68℃for 140s, 30 cycles

c, extending for 8min at the temperature of 68 ℃,

d.10℃5min。

1.4.2 cleavage, ligation and conversion

The phbh2pcaA2B2 gene cluster fragment obtained by PCR amplification and vector pBBR1MCS-2 are respectively subjected to stepwise enzyme digestion by using KpnI and HindIII, and the enzyme digestion products are recovered by using a DNA purification kit.

The phbh2pcaA2B2 fragment after double cleavage with KpnI/HindIII was ligated into the pBBR1MCS-2 vector likewise subjected to double cleavage with KpnI/HindIII to construct the recombinant plasmid pBBR-phbh2pcaA2B2 according to the following reaction system.

Incubate at 16℃for 12 hours.

The constructed pBBR-phbh2pcaA2B2 was transformed into 100. Mu.L competent cells expressing the host strain E.coli DH 5. Alpha. By the specific method described in the "Fine programming molecular biology laboratory Manual" P23 by F.osbert et al. The recombinant strain E.coli DH 5. Alpha. (pBBR-phbh 2pcaA2B 2) was obtained by plating on LB plates containing 50mg/L kanamycin, culturing for 18 hours, and picking up positive clones.

1.4.3 degradation of 3-bromo-4-hydroxybenzoic acid by recombinant Strain E.coli DH 5. Alpha (pBBR-phbh 2pcaA2B 2)

Recombinant strain E.coli DH 5. Alpha (pBBR-phbh 2pcaA2B 2) and control strain E.coli DH 5. Alpha (pBBR 1 MCS-2) were each cultured in LB medium containing 50mg/L kanamycin for 12h. The cells were collected by centrifugation at 6000rpm, centrifuged with a sterile basic salt solution, washed 2 times, and resuspended with the basic salt solution. According to OD ₆₀₀ For an initial inoculum size of 1, recombinant strain E.coli DH 5. Alpha. (pBBR-phbh 2pcaA2B 2) and control strain E.coli DH 5. Alpha. (pBBR 1 MCS-2) were inoculated into a basic salt solution containing 0.2mM 3-bromo-4-hydroxybenzoic acid, and whole cell transformation experiments were carried out in a shaker at 30 ℃. This recombinant strain E.coli DH 5. Alpha. (pBBR-phbh 2pcaA2B 2) was found to degrade 0.2mM of 3-bromo-4-hydroxybenzoic acid completely within 4 hours (FIG. 3). The degradation end product was identified by UPLC-MS as 2-bromo-4-carboxy-hexadienoic acid (FIG. 4). From this is inferredThe oxidase gene cluster phbh2pcaA2B2 functions, namely: the protein PHBH2 coded by the monooxygenase gene catalyzes the 3-bromo-4-hydroxybenzoic acid to initiate degradation reaction, and converts the 3-bromo-4, 5-dihydroxybenzoic acid into 3-bromo-4, 5-dihydroxybenzoic acid; the protein pcaA2B2 encoded by the dioxygenase gene pcaA2B2 then further degrades 3-bromo-4, 5-dihydroxybenzoic acid into 2-bromo-4-carboxy-hexadienoic acid (fig. 5).

Example 23 efficient expression of the bromo-4-hydroxybenzoate monooxygenase Gene phbh2 and PCR amplification of the enzyme purified 2.1 monooxygenase Gene phbh2

Primer sequence:

phbh2-f2：CAACATATGAGCGAGCGTACCCAGGT(NdeI)(SEQ ID NO.12)；phbh2-r2：

AATAAGCTTCTAGTGGTGGTGGTGGTGGTGGGCCTCGATCGGCAACCCGG(HindIII)(SEQ ID NO.13)。

primers phbh2-f2 and phbh2-r2 were used to amplify monooxygenase gene phbh2 (nucleotide sequence GTGGTGGTGGTGGTGGTG encoding His tag at 3' end), and the PCR amplification system was as follows:

PCR amplification procedure:

denaturation at a.98℃for 2min

c, extending for 5min at the temperature of 68 ℃,

d.10℃5min。

2.2 enzyme digestion and enzyme ligation

The phbh2 gene obtained by PCR amplification and the vector pET29a (+) were digested stepwise with NdeI and HindIII, respectively, and the digested products were recovered using a DNA purification kit.

The phbh2 gene fragment after NdeI/HindIII double cleavage was enzymatically ligated to the same digested pET29a (+) vector according to the following reaction system to construct a recombinant plasmid pET-phbh2.

Incubate at 16℃for 12 hours.

2.3 conversion

The constructed pET-phbh2 is transformed into 100 mu L competent cells of an expression host strain E.coli BL21 (DE 3), and the specific method is referred to P23 of the fine programming molecular biology experimental guideline of F.Oseber et al. The positive clones were picked up after plating on LB plates containing 50mg/L kanamycin and culturing for 18 h.

Expression and purification of 2.4PHBH2

The recombinant expression strain E.coli BL21 (pET-phbh 2) is inoculated into 100mL LB culture medium and cultured at 37 ℃ until OD ₆₀₀ About 0.6, and culturing at 16℃for 18 hours by adding 0.5mM IPTG, and collecting the cells by centrifugation. The cells were washed twice with Phosphate Buffer (PBS), sonicated, and centrifuged at 15000g for 20min to obtain the supernatant. The supernatant was further subjected to elution purification by Co-Talon affinity chromatography column (purchased from GE company) to obtain pure His-tagged PHBH2, and its purity was checked by SDS-PAGE electrophoresis (FIG. 6).

2.5 enzymatic Properties of the monooxygenase PHBH2

PHBH2 converts 3-bromo-4-hydroxybenzoic acid using the following standard enzymatic reaction system: 1ml of 20mM Tris-HCl buffer (pH 8.0) containing 0.2mM 3-bromo-4-hydroxybenzoic acid, 0.3mM NADPH,0.02mM FAD,0.05. Mu.M PHBH2. The reaction was carried out at 35℃for 10min. Heating in boiling water bath for 3min, centrifuging at 15000g for 20min, and collecting supernatant. Taking 400 mu l of supernatant, adding 600 mu l of methanol, uniformly mixing, filtering by using an organic phase filter, quantitatively detecting the residual concentration of 3-bromo-4-hydroxybenzoic acid by using high performance liquid chromatography, and calculating the degradation rate.

To examine the effect of cofactors on PHBH2 enzyme activity, a standard enzymatic reaction system without cofactors was used as a blank control, and different combinations of NADH, FMN, NADPH and FAD (NADH and NADPH concentrations used were 0.3mM, and FAD and FMN concentrations were 0.02 mM) were added, respectively, to determine the relative enzyme activity of PHBH2 under different cofactor conditions. The results showed that PHBH2 enzyme activity was highest (set to 100%) when NADPH and FAD were both present; when NADPH and FMN are present at the same time, PHBH2 relative enzyme activity is 12.4%; when only NADPH or NADH is added, the relative enzyme activities of PHBH2 are only 11.6% and 1.6% respectively; PHBH2 had no enzyme activity when only FAD or FMN was added. These results indicate that NADPH and FAD are the optimal cofactors for PHBH2, and that NADPH is required as an electron donor and H donor for PHBH2 to catalyze the reaction of 3-bromo-4-hydroxybenzoic acid.

Using the standard enzymatic reaction system, the reaction of catalyzing 3-bromo-4-hydroxybenzoic acid by PHBH2 is carried out at different temperatures (10-50 ℃), and the optimum reaction temperature of PHBH2 is examined. After the enzymatic reaction is finished, the reaction is stopped by placing the mixture in boiling water for 3min, centrifuging the mixture for 10min at 12000rpm, filtering the supernatant by a water-phase filter membrane with the diameter of 0.22 mu m, detecting the HPLC, measuring the degradation rate of PHBH2 on 3-bromo-4-hydroxybenzoic acid at different temperatures, and calculating relative enzyme activity by taking the degradation efficiency at the optimal temperature as 100%. Experimental results show that PHBH2 has certain activity on 3-bromo-4-hydroxybenzoic acid within the temperature range of 10-45 ℃; when the temperature is 20-40 ℃, the relative enzyme activity is more than 60%, and the optimal reaction temperature is 35 ℃; when the temperature is 10 ℃, the relative enzyme activity can still reach about 40%; when the temperature reached 50 ℃, PHBH2 lost enzyme activity (fig. 7A).

The buffer solution in the standard enzymatic reaction system is replaced by the following four buffers with different pH value ranges: citric acid-sodium citrate buffer (pH 4.0-6.0), phosphate buffer (pH 5.0-8.0), tris-HCl buffer (pH 7.0-8.5) and glycine-sodium hydroxide buffer (pH 8.5-10.0), one gradient per 0.5 pH. PHBH2 was subjected to enzymatic reaction of 3-bromo-4-hydroxybenzoic acid in the above buffers of different pH values at 35℃and then placed in boiling water for 3min to terminate the reaction. Centrifuging at 12000rpm for 10min, filtering the supernatant with 0.22 μm water phase filter membrane, detecting by HPLC, determining degradation rate of PHBH2 to 3-bromo-4-hydroxybenzoic acid under different pH conditions, setting the degradation rate of optimum pH as 100%, and calculating relative enzyme activity. Experimental results show that the pH of the PHBH2 is 8.0; when the pH is 7.5-8.5, the relative vitality of PHBH2 is maintained above 60%; when pH >10 or <6, almost no enzymatic activity of PHBH2 was detected (fig. 7B).

Sequence listing

<110> Nanjing agricultural university

<120> 3-bromo-4-hydroxybenzoic acid oxidase gene cluster phbh2pcaA2B2 and application thereof

<160> 13

<170> SIPOSequenceListing 1.0

<210> 1

<211> 2376

<212> DNA

<213> Pigmentiphaga sp. H8

<400> 1

atgacacttc cccaacgcga ccggacacgg ccgatcgccg attcgcacgt cttcgacctg 60

cgtctttcat ggaagggata ccgcatcaac aagctctgca actcgcttag cgaggccgcc 120

aaccgcgatg cctaccgggc ggacgaagag gcctacatga cccgcttcgg cctgtccgac 180

gaacagaagg cgctgatacg cgcgcgcgat ttcaccggcc tgctcgacgc cggcgccaac 240

atctacttcc tgctcaagct gggcgtggtc accggcaacg gcctttacgt catgggcgcg 300

cgtatgcgcg gagaaagcta cgaggccttc ctggccaccc gcaacgacaa gggagcggtc 360

tgacatggga cgcatcatcg caggcatagg tacttctcac gtgccctcca tcggcgcggc 420

ctacgaccgc ggcaagcagg ccacgccggc ctggcgcccc ttgttcgacg cctatgtccc 480

ggtgcgcgag tggctggagg agctcaagcc cgacgtggcc atcatggtct acaacgacca 540

cggcgccgat ttcttcttcg acaaatatcc gaccttcgcc gtgggcgcgg ccgaccgcta 600

cgacatcgcc gacgaaggct tcggcgtacg cccgctgccg cccatagacg gccacctgga 660

attctcgcag cacctgtgcg aatcgctggt ctacgacgag ttcgacctga cggtctgcca 720

ggaaatgcgg gtcgaacacg gattcctcgt gcccatgcac ctgtgcttcg accatacgcc 780

cggatggaac gtcgcggccg tgcccttcgc cgtcaacgtg ctgcaacatc ctctgcccac 840

cgcgcgccga tgctaccggc tgggccaggc catacggcgg gccgtcgaat cctacccggc 900

cgatctgcgc gtcgtcatcc tgggcaccgg cggcatgtcc catcagttga ccggccccca 960

cttcggcaag atggaccagg actgggacca ggacttcctg gaccgcatcg aacgcgaccc 1020

cgacagcctg tgcgagctca cccaccagac gctgatggaa cgctacggcg cagagggtat 1080

cgagctgatc atgtggctgg tcatgcgcgg cgcgctgtcg aaccgggcgc ggcgcgtcca 1140

ccgccactac tacgccccca tgaccaccgg catgggcctg atcacgctgg aggagccggt 1200

atgagcgagc gtacccaggt cggcatcgtc ggggcgggcc ccgccggact gctgctttcc 1260

cacctgctgc accgggaagg catcgaatcc atcgtgttcg acaaccgcag ccgcgaacac 1320

gtgcagcagc gcctgcgggc cggggtgctg gaacaaggca cggtcgatct gctggccgag 1380

gtcggactgg gcgaacgcat gcggcgcctg ggcatgccgc agaccagcct cgacttccgc 1440

tacgcccggg cctcgcaccg catagacttc gcgcaggaaa tcggccgcac ggtcatggtc 1500

tatccccagc atgaagtggt gcacgacctg atcgaggcac ggctggccgc cggcggcgac 1560

ctgcgcttcg acaccccggt caccgccatc cgggacctgg aaggcccctc gcccaccatc 1620

ctggccggcc cggaaggcag gccggtgcgc tgcgacttca tcgcgggctg cgacggcttc 1680

cacggcatct gccgcgacgc catcccagcg tcggtgatga agacctacga ccgcgtctat 1740

cccttcggct ggctgggcat cctggccgag gtcccaccgg ccgcgcccga cgtcacctgg 1800

ggctgccacg agaccggctt cgccatgctg agcttccgct cccccacgcg cagccgcctc 1860

tacctgcaat gcgaaccgga cgacgatccg gacaactggt ccgacgaccg catctggagc 1920

gcgctgcacg aacgcctgga cgttcccggc atgccgccgc tgatcgaagg ccccatcgtg 1980

cagaagggcg tgaccgccat gcgcagcttc caggtcgagc cgctgcgcca tggcgccctg 2040

ttcctggccg gcgatgccgc gcacatcgtc ccgcccaccg gcgccaaggg gctgaactcc 2100

gccgtggcag acatacgcgt gctcggccgc gcgctggcag cgtattaccg ccagggctcc 2160

acccggctcc tggacagcta ttcggaaacc tgcctgcggc gcatgtggct ggtgcaccgg 2220

ttctcggccg gactgtgcac catggtgcat agcttcccgg ggcagagcga cttcgcccgg 2280

cgcctgcaac gggccgacct ggactacatg acgggatccg agccgggccg gcaggccttc 2340

tcggagaact tcaccgggtt gccgatcgag gcctag 2376

<210> 2

<211> 1176

<212> DNA

<213> Pigmentiphaga sp. H8

<400> 2

atgagcgagc gtacccaggt cggcatcgtc ggggcgggcc ccgccggact gctgctttcc 60

cacctgctgc accgggaagg catcgaatcc atcgtgttcg acaaccgcag ccgcgaacac 120

gtgcagcagc gcctgcgggc cggggtgctg gaacaaggca cggtcgatct gctggccgag 180

gtcggactgg gcgaacgcat gcggcgcctg ggcatgccgc agaccagcct cgacttccgc 240

tacgcccggg cctcgcaccg catagacttc gcgcaggaaa tcggccgcac ggtcatggtc 300

tatccccagc atgaagtggt gcacgacctg atcgaggcac ggctggccgc cggcggcgac 360

ctgcgcttcg acaccccggt caccgccatc cgggacctgg aaggcccctc gcccaccatc 420

ctggccggcc cggaaggcag gccggtgcgc tgcgacttca tcgcgggctg cgacggcttc 480

cacggcatct gccgcgacgc catcccagcg tcggtgatga agacctacga ccgcgtctat 540

cccttcggct ggctgggcat cctggccgag gtcccaccgg ccgcgcccga cgtcacctgg 600

ggctgccacg agaccggctt cgccatgctg agcttccgct cccccacgcg cagccgcctc 660

tacctgcaat gcgaaccgga cgacgatccg gacaactggt ccgacgaccg catctggagc 720

gcgctgcacg aacgcctgga cgttcccggc atgccgccgc tgatcgaagg ccccatcgtg 780

cagaagggcg tgaccgccat gcgcagcttc caggtcgagc cgctgcgcca tggcgccctg 840

ttcctggccg gcgatgccgc gcacatcgtc ccgcccaccg gcgccaaggg gctgaactcc 900

gccgtggcag acatacgcgt gctcggccgc gcgctggcag cgtattaccg ccagggctcc 960

acccggctcc tggacagcta ttcggaaacc tgcctgcggc gcatgtggct ggtgcaccgg 1020

ttctcggccg gactgtgcac catggtgcat agcttcccgg ggcagagcga cttcgcccgg 1080

cgcctgcaac gggccgacct ggactacatg acgggatccg agccgggccg gcaggccttc 1140

tcggagaact tcaccgggtt gccgatcgag gcctag 1176

<210> 3

<211> 391

<212> PRT

<213> Pigmentiphaga sp. H8

<400> 3

Met Ser Glu Arg Thr Gln Val Gly Ile Val Gly Ala Gly Pro Ala Gly

1 5 10 15

Leu Leu Leu Ser His Leu Leu His Arg Glu Gly Ile Glu Ser Ile Val

20 25 30

Phe Asp Asn Arg Ser Arg Glu His Val Gln Gln Arg Leu Arg Ala Gly

35 40 45

Val Leu Glu Gln Gly Thr Val Asp Leu Leu Ala Glu Val Gly Leu Gly

50 55 60

Glu Arg Met Arg Arg Leu Gly Met Pro Gln Thr Ser Leu Asp Phe Arg

65 70 75 80

Tyr Ala Arg Ala Ser His Arg Ile Asp Phe Ala Gln Glu Ile Gly Arg

85 90 95

Thr Val Met Val Tyr Pro Gln His Glu Val Val His Asp Leu Ile Glu

100 105 110

Ala Arg Leu Ala Ala Gly Gly Asp Leu Arg Phe Asp Thr Pro Val Thr

115 120 125

Ala Ile Arg Asp Leu Glu Gly Pro Ser Pro Thr Ile Leu Ala Gly Pro

130 135 140

Glu Gly Arg Pro Val Arg Cys Asp Phe Ile Ala Gly Cys Asp Gly Phe

145 150 155 160

His Gly Ile Cys Arg Asp Ala Ile Pro Ala Ser Val Met Lys Thr Tyr

165 170 175

Asp Arg Val Tyr Pro Phe Gly Trp Leu Gly Ile Leu Ala Glu Val Pro

180 185 190

Pro Ala Ala Pro Asp Val Thr Trp Gly Cys His Glu Thr Gly Phe Ala

195 200 205

Met Leu Ser Phe Arg Ser Pro Thr Arg Ser Arg Leu Tyr Leu Gln Cys

210 215 220

Glu Pro Asp Asp Asp Pro Asp Asn Trp Ser Asp Asp Arg Ile Trp Ser

225 230 235 240

Ala Leu His Glu Arg Leu Asp Val Pro Gly Met Pro Pro Leu Ile Glu

245 250 255

Gly Pro Ile Val Gln Lys Gly Val Thr Ala Met Arg Ser Phe Gln Val

260 265 270

Glu Pro Leu Arg His Gly Ala Leu Phe Leu Ala Gly Asp Ala Ala His

275 280 285

Ile Val Pro Pro Thr Gly Ala Lys Gly Leu Asn Ser Ala Val Ala Asp

290 295 300

Ile Arg Val Leu Gly Arg Ala Leu Ala Ala Tyr Tyr Arg Gln Gly Ser

305 310 315 320

Thr Arg Leu Leu Asp Ser Tyr Ser Glu Thr Cys Leu Arg Arg Met Trp

325 330 335

Leu Val His Arg Phe Ser Ala Gly Leu Cys Thr Met Val His Ser Phe

340 345 350

Pro Gly Gln Ser Asp Phe Ala Arg Arg Leu Gln Arg Ala Asp Leu Asp

355 360 365

Tyr Met Thr Gly Ser Glu Pro Gly Arg Gln Ala Phe Ser Glu Asn Phe

370 375 380

Thr Gly Leu Pro Ile Glu Ala

385 390

<210> 4

<211> 363

<212> DNA

<213> Pigmentiphaga sp. H8

<400> 4

atgacacttc cccaacgcga ccggacacgg ccgatcgccg attcgcacgt cttcgacctg 60

cgtctttcat ggaagggata ccgcatcaac aagctctgca actcgcttag cgaggccgcc 120

aaccgcgatg cctaccgggc ggacgaagag gcctacatga cccgcttcgg cctgtccgac 180

gaacagaagg cgctgatacg cgcgcgcgat ttcaccggcc tgctcgacgc cggcgccaac 240

atctacttcc tgctcaagct gggcgtggtc accggcaacg gcctttacgt catgggcgcg 300

cgtatgcgcg gagaaagcta cgaggccttc ctggccaccc gcaacgacaa gggagcggtc 360

tga 363

<210> 5

<211> 120

<212> PRT

<213> Pigmentiphaga sp. H8

<400> 5

Met Thr Leu Pro Gln Arg Asp Arg Thr Arg Pro Ile Ala Asp Ser His

1 5 10 15

Val Phe Asp Leu Arg Leu Ser Trp Lys Gly Tyr Arg Ile Asn Lys Leu

20 25 30

Cys Asn Ser Leu Ser Glu Ala Ala Asn Arg Asp Ala Tyr Arg Ala Asp

35 40 45

Glu Glu Ala Tyr Met Thr Arg Phe Gly Leu Ser Asp Glu Gln Lys Ala

50 55 60

Leu Ile Arg Ala Arg Asp Phe Thr Gly Leu Leu Asp Ala Gly Ala Asn

65 70 75 80

Ile Tyr Phe Leu Leu Lys Leu Gly Val Val Thr Gly Asn Gly Leu Tyr

85 90 95

Val Met Gly Ala Arg Met Arg Gly Glu Ser Tyr Glu Ala Phe Leu Ala

100 105 110

Thr Arg Asn Asp Lys Gly Ala Val

115 120

<210> 6

<211> 840

<212> DNA

<213> Pigmentiphaga sp. H8

<400> 6

atgggacgca tcatcgcagg cataggtact tctcacgtgc cctccatcgg cgcggcctac 60

gaccgcggca agcaggccac gccggcctgg cgccccttgt tcgacgccta tgtcccggtg 120

cgcgagtggc tggaggagct caagcccgac gtggccatca tggtctacaa cgaccacggc 180

gccgatttct tcttcgacaa atatccgacc ttcgccgtgg gcgcggccga ccgctacgac 240

atcgccgacg aaggcttcgg cgtacgcccg ctgccgccca tagacggcca cctggaattc 300

tcgcagcacc tgtgcgaatc gctggtctac gacgagttcg acctgacggt ctgccaggaa 360

atgcgggtcg aacacggatt cctcgtgccc atgcacctgt gcttcgacca tacgcccgga 420

tggaacgtcg cggccgtgcc cttcgccgtc aacgtgctgc aacatcctct gcccaccgcg 480

cgccgatgct accggctggg ccaggccata cggcgggccg tcgaatccta cccggccgat 540

ctgcgcgtcg tcatcctggg caccggcggc atgtcccatc agttgaccgg cccccacttc 600

ggcaagatgg accaggactg ggaccaggac ttcctggacc gcatcgaacg cgaccccgac 660

agcctgtgcg agctcaccca ccagacgctg atggaacgct acggcgcaga gggtatcgag 720

ctgatcatgt ggctggtcat gcgcggcgcg ctgtcgaacc gggcgcggcg cgtccaccgc 780

cactactacg cccccatgac caccggcatg ggcctgatca cgctggagga gccggtatga 840

<210> 7

<211> 279

<212> PRT

<213> Pigmentiphaga sp. H8

<400> 7

Met Gly Arg Ile Ile Ala Gly Ile Gly Thr Ser His Val Pro Ser Ile

1 5 10 15

Gly Ala Ala Tyr Asp Arg Gly Lys Gln Ala Thr Pro Ala Trp Arg Pro

20 25 30

Leu Phe Asp Ala Tyr Val Pro Val Arg Glu Trp Leu Glu Glu Leu Lys

35 40 45

Pro Asp Val Ala Ile Met Val Tyr Asn Asp His Gly Ala Asp Phe Phe

50 55 60

Phe Asp Lys Tyr Pro Thr Phe Ala Val Gly Ala Ala Asp Arg Tyr Asp

65 70 75 80

Ile Ala Asp Glu Gly Phe Gly Val Arg Pro Leu Pro Pro Ile Asp Gly

85 90 95

His Leu Glu Phe Ser Gln His Leu Cys Glu Ser Leu Val Tyr Asp Glu

100 105 110

Phe Asp Leu Thr Val Cys Gln Glu Met Arg Val Glu His Gly Phe Leu

115 120 125

Val Pro Met His Leu Cys Phe Asp His Thr Pro Gly Trp Asn Val Ala

130 135 140

Ala Val Pro Phe Ala Val Asn Val Leu Gln His Pro Leu Pro Thr Ala

145 150 155 160

Arg Arg Cys Tyr Arg Leu Gly Gln Ala Ile Arg Arg Ala Val Glu Ser

165 170 175

Tyr Pro Ala Asp Leu Arg Val Val Ile Leu Gly Thr Gly Gly Met Ser

180 185 190

His Gln Leu Thr Gly Pro His Phe Gly Lys Met Asp Gln Asp Trp Asp

195 200 205

Gln Asp Phe Leu Asp Arg Ile Glu Arg Asp Pro Asp Ser Leu Cys Glu

210 215 220

Leu Thr His Gln Thr Leu Met Glu Arg Tyr Gly Ala Glu Gly Ile Glu

225 230 235 240

Leu Ile Met Trp Leu Val Met Arg Gly Ala Leu Ser Asn Arg Ala Arg

245 250 255

Arg Val His Arg His Tyr Tyr Ala Pro Met Thr Thr Gly Met Gly Leu

260 265 270

Ile Thr Leu Glu Glu Pro Val

275

<210> 8

<211> 27

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 8

ctgggtacct gatcacgctg gaggagc 27

<210> 9

<211> 29

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 9

tccagatctc taggcctcga tcggcaacc 29

<210> 10

<211> 29

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 10

ctaggtaccg ttttccctct acccaagga 29

<210> 11

<211> 29

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 11

cataagcttc taggcctcga tcggcaacc 29

<210> 12

<211> 26

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 12

caacatatga gcgagcgtac ccaggt 26

<210> 13

<211> 50

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 13

aataagcttc tagtggtggt ggtggtggtg ggcctcgatc ggcaacccgg 50

Claims

1. 3-bromo-4-hydroxybenzoic acid oxidase gene clusterphbh2pcaA2B2The application of the method for removing 3-bromo-4-hydroxybenzoic acid residues in soil or water is characterized in that the nucleotide sequence is SEQ ID NO.1.

2. A gene cluster comprising 3-bromo-4-hydroxybenzoic acid oxidase as claimed in claim 1phbh2pcaA2B2The recombinant plasmid of the strain is applied to the removal of 3-bromo-4-hydroxybenzoic acid residues in soil or water.

3. The use according to claim 2, wherein the recombinant plasmid is obtained from the 3-bromo-4-hydroxybenzoate oxidase gene cluster as defined in claim 1phbh2pcaA2B2And carrying out enzyme ligation with the digested pBBR1MCS-2 to obtain a recombinant plasmid pBBR-phbh2pcaA2B2.

4. Use of a recombinant microorganism comprising the recombinant plasmid of claim 2 for removing 3-bromo-4-hydroxybenzoic acid residues in soil or water.