CN114002440B - Enzyme-linked immunoassay kit for human phosphorylated vasodilator-stimulated protein and detection method thereof - Google Patents
Enzyme-linked immunoassay kit for human phosphorylated vasodilator-stimulated protein and detection method thereof Download PDFInfo
- Publication number
- CN114002440B CN114002440B CN202111638413.9A CN202111638413A CN114002440B CN 114002440 B CN114002440 B CN 114002440B CN 202111638413 A CN202111638413 A CN 202111638413A CN 114002440 B CN114002440 B CN 114002440B
- Authority
- CN
- China
- Prior art keywords
- cdr
- monoclonal antibody
- sample
- vasp
- vasodilator
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
- G01N33/6893—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N21/00—Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
- G01N21/17—Systems in which incident light is modified in accordance with the properties of the material investigated
- G01N21/25—Colour; Spectral properties, i.e. comparison of effect of material on the light at two or more different wavelengths or wavelength bands
- G01N21/31—Investigating relative effect of material at wavelengths characteristic of specific elements or molecules, e.g. atomic absorption spectrometry
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/543—Immunoassay; Biospecific binding assay; Materials therefor with an insoluble carrier for immobilising immunochemicals
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Immunology (AREA)
- Engineering & Computer Science (AREA)
- Physics & Mathematics (AREA)
- Chemical & Material Sciences (AREA)
- Urology & Nephrology (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Hematology (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Pathology (AREA)
- General Physics & Mathematics (AREA)
- General Health & Medical Sciences (AREA)
- Cell Biology (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Spectroscopy & Molecular Physics (AREA)
- Food Science & Technology (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Peptides Or Proteins (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention discloses an enzyme-linked immunoassay kit for human phosphorylated vasodilator-stimulated protein and a detection method thereof, wherein the assay kit comprises a sample pretreatment buffer solution, a sample activator containing PGE1, a sample inhibitor containing PGE1 and ADP, an ELISA plate, a VASP monoclonal antibody, a color development liquid and a stop solution; wherein the VASP monoclonal antibody is horseradish peroxidase-labeled murine monoclonal antibody, the murine monoclonal antibody heavy chain complementarity determining region comprises CDR-H1, CDR-H2 and CDR-H3 fragments, and the murine monoclonal antibody light chain complementarity determining region comprises CDR-L1, CDR-L2 and CDR-L3 fragments. The invention adopts an enzyme-linked immunosorbent assay, optimizes and improves the sequence of the monoclonal antibody, has high capture rate and good specificity of the improved monoclonal antibody, overcomes the influence of a whole blood sample on a detection result, and avoids the step of processing the sample to be detected before the previous detection.
Description
Technical Field
The invention relates to an enzyme-linked immunoassay kit for human phosphorylated vasodilator-stimulated protein and a detection method thereof, belonging to the field of molecular immunology.
Background
Human phosphorylated vasodilator-stimulated phosphoprotein (VASP) belongs to the Ena/protein family and is a platelet intracellular actin-regulating protein. It has 2 important phosphorylation sites, respectively: serine 157 and serine 239, the phosphorylation states of these two phosphorylation sites being closely related to the platelet activation function. Phosphorylation of the phosphorylation site of serine 157 can inhibit binding of fibrinogen to glycoprotein IIb/IIIa in human platelets; serine 239 phosphorylation sites are found primarily on intact human endothelial cells and platelets, which are phosphorylated in response to pharmacological and physiological vasodilators and platelet inhibitors. The vasodilator stimulating phosphoprotein is a P2Y12 receptor specific activation marker in platelets and inhibits the phosphorylation of the activation marker; in the presence of ADP receptor antagonists, increased phosphorylation of VASP products, in turn, inhibits platelet activation.
The inhibition effect of clopidogrel on platelets is mainly achieved by specifically blocking ADP from being combined with a P2Y12 receptor on a platelet membrane, and the P2Y12 receptor is inhibited, so that vasodilation stimulates phosphoprotein phosphorylation, which is expressed as platelet inhibition; dephosphorylation restores platelet activity. The phosphorylation of the vasodilator-stimulated phosphoprotein is a key link of an activation pathway of P2Y12, the quantitative analysis of the phosphorylation is a specific detection method aiming at a P2Y12 pathway, the measurement result has good stability, and the inhibition degree of clopidogrel to platelets can be specifically evaluated by quantitatively detecting the phosphorylation level of the vasodilator-stimulated phosphoprotein.
At present, some patents have disclosed patent applications for detection of VSAP antibodies, CN1279691A discloses a VASP antibody that specifically binds VASP phosphorylated at the 239 serine position, a monoclonal antibody produced by the hybridoma cell line DSM ACC 2330. CN108982864A discloses a VASP antibody and a VASP-P (vasodilator type stimulated phosphoprotein phosphorylated at the 239 serine position) monoclonal antibody. However, the disclosed detection methods have high preparation cost in the early stage and complex process, and are not beneficial to large-scale industrial production. Therefore, the VASP detection kit is low in production and preparation cost, convenient for large-scale production and good in detection effect.
Disclosure of Invention
Aiming at the problems in the prior art, the invention aims to obtain an enzyme-linked immunoassay kit for human phosphorylated vasodilator-stimulated protein and a detection method thereof.
In order to realize one of the above purposes, the technical scheme of the enzyme-linked immunoassay kit for human phosphorylated vasodilator-stimulated protein adopted by the invention is as follows:
the kit comprises: a sample pretreatment buffer solution, a sample activator containing PGE1, a sample inhibitor containing PGE1 and ADP, an enzyme label plate, a VASP monoclonal antibody, a developing solution, a stop solution and a calibrator; preferably, the VASP monoclonal antibody is a horseradish peroxidase-labeled murine monoclonal antibody, which comprises:
a) a murine monoclonal antibody heavy chain complementarity determining region comprising: CDR-H1, CDR-H2, CDR-H3, wherein:
CDR-H1 has the amino acid sequence of SEQ ID NO 2: VFDYMCK,
CDR-H2 has the amino acid sequence of sequence SEQ ID NO 3: LGECIHGTNYWAANKG,
CDR-H3 has the amino acid sequence of sequence SEQ ID NO 4: VSVGYDYAYEA;
b) a murine mab light chain complementarity determining region comprising: CDR-L1, CDR-L2, CDR-L3, wherein:
CDR-L1 has the amino acid sequence of sequence SEQ ID NO 5: PNTEDISTS,
CDR-L2 has the amino acid sequence of SEQ ID NO 6 KADDAS,
CDR-L3 has the amino acid sequence of sequence SEQ ID NO 7: GACSYFNVPIK.
Preferably, the VASP antibody is prepared by the following steps: the corresponding VASP linear DNA was synthesized as an RNA synthesis template, and linear RNA was synthesized. Linear RNA is inserted into a circular RNA vector and correctly circularized RNA is isolated. Intramuscular injection of the delivery agent and circular RNA into mice to produce antibodies; hybridoma cells are prepared, tested for monoclonality, and expanded cell culture is used for mass production of monoclonal antibodies.
Preferably, the ELISA plate is an ELISA plate coated by VASP monoclonal antibody.
Preferably, the VASP monoclonal antibody is a horseradish peroxidase (HRP) labeled VASP monoclonal antibody.
Preferably, the color developing solution is a TMB substrate color developing solution;
preferably, the PGE 1-containing sample activator and the PGE1+ ADP-containing sample inhibitor are diluted to 10 μ M with sample pretreatment buffers, respectively.
Preferably, the sample pretreatment buffer is 70mM Tris-HCL (pH7.6), 250mM NaCl, 0.2% Tween-20, 0.5% TritonX-100, 1.5% Proclin300, and the pH is 7.6.
Preferably, the kit further comprises a human phosphorylated vasodilator-stimulated phosphoprotein calibrator.
More preferably, the human phosphorylated vasodilator-stimulating phosphoprotein calibrator is 20mM Tris buffer containing 20% fetal bovine serum and has a working concentration of 400 ng/L.
The invention also discloses a detection method using the kit. The method comprises the following steps:
(1) sample pretreatment: after the activator dry powder and the sample inhibitor dry powder are respectively dissolved by the sample pretreatment agent, respectively taking 10 mu l of the activator dry powder and the sample inhibitor dry powder, adding the same volume of a sample to be tested or a calibrator, uniformly mixing, and incubating for 10min at room temperature;
(2) respectively adding the activated sample, the inhibited sample, the activated calibrator and the inhibited calibrator incubated in the step (1) into corresponding micropores of an ELISA plate, and incubating;
(3) adding a VASP monoclonal antibody marked by HRP enzyme into the corresponding micropores in the step (2), and incubating in a dark place;
(4) washing and drying, adding a color development solution into each hole, and incubating in a dark place;
(5) adding a stop solution into each hole, measuring the absorbance of the stop solution at 450nm, respectively obtaining an activated absorbance value C for activation, and an inhibited absorbance value C for inhibition, wherein the activated calibrator and the inhibited calibrator have the same absorbance values and are both C for calibration;
(6) the platelet response index was calculated. The calculation formula of the platelet response index is as follows:
platelet response index PRI ═ [ (C activation-C inhibition)/(C activation-C calibration) ] × 100%.
The third purpose of the invention is to disclose an application of the human phosphorylated vasodilator-stimulated phosphoprotein ELISA kit, wherein the kit is used for evaluating the administration effect of antiplatelet drugs. Antiplatelet agents such as clopidogrel.
The human phosphorylated vasodilator-stimulated phosphoprotein (VASP) detection kit adopts an enzyme-linked immunosorbent assay to determine the content of the human phosphorylated vasodilator-stimulated phosphoprotein in a human body sample, optimizes and improves the sequence of a monoclonal antibody, has high capture rate and good specificity of the improved monoclonal antibody, overcomes the influence of a whole blood sample on a detection result, and avoids the step of processing the sample to be detected before the previous detection. Compared with the current mainstream VASP detection technology, the flow cytometry detection method has the advantages of simple requirement on operators and low instrument cost. Compared with immunoassay such as ELISA, the method has high capture rate and high sensitivity. The method has the advantages of simple detection steps, low equipment requirement, stable and repeatable results and good popularization value.
Drawings
FIG. 1 is a C-activation linear relationship provided by the present invention;
fig. 2 is a linear relationship of C suppression provided by the present invention.
Detailed Description
The enzyme linked immunosorbent assay kit for human phosphorylated vasodilator-stimulated protein and the detection method thereof provided by the invention are further described in detail and completely by combining the following embodiments. The following examples are illustrative only and are not to be construed as limiting the invention.
The experimental procedures in the following examples are conventional unless otherwise specified. The experimental materials used in the following examples were all commercially available unless otherwise specified.
Example 1 preparation of kit
The kit provided by the invention is matched with an enzyme-linked immunosorbent assay (ELISA) method and is used for determining the content of human phosphorylated vasodilator-stimulated phosphoprotein in a human body sample. The technical principle of the reaction is as follows: and (3) determining the VASP-P level in the serum of the sample to be detected by adopting a double-antibody sandwich method. Coating a microporous plate with a VASP monoclonal antibody to prepare a solid phase antibody, dividing a sample into two equal parts, respectively treating the two equal parts by using an activating agent and a sample inhibitor, adding a VASP standard solution or a sample solution after sample treatment into the micropores coated with the monoclonal antibody, adding an HRP-labeled phosphorylated VASP antibody for combination to form an antibody-antigen-enzyme-labeled antibody compound, washing and adding a substrate TMB for color development; TMB is converted to blue by the catalysis of HRP enzyme and to the final yellow by the action of acid. The absorbance (OD value) was measured at a wavelength of 450nm with a microplate reader, and the Platelet Reactivity Index (PRI) of the sample solution was calculated by the formula.
The kit comprises a sample pretreatment buffer solution, a sample activator containing PGE1, a sample inhibitor containing PGE1 and ADP, an enzyme label plate, a VASP monoclonal antibody, a color development solution, a stop solution and a calibrator.
(1) Preparation of a sample pretreatment buffer solution:
14.61g of sodium chloride, 11.03g of tris (hydroxymethyl) aminomethane hydrochloride and 1.50g of Proclin300 are weighed in sequence, 2ml of Tween 20 and 5ml of Triton X-100 are weighed in 500ml of deionized water, fully stirred and dissolved, the volume is determined to be 1L, and the pH is adjusted to 7.60 +/-0.10.
(2) VASP monoclonal antibody preparation
a. The method adopts a circular RNA carrier, and the structure of the carrier comprises a circular RNA translation initiation region, a protein positioning guide region, a protein translation RNA segment insertion point and a structure enhancement region;
b. synthesizing a corresponding VASP linear DNA template, wherein the sequence of the DNA template is shown in a sequence table SEQ ID NO. 1:
the partial gene sequence (SEQ ID NO. 1) of human VASP is specifically ATGAGCGAGACGGTCATCTGTTCCAGCCGGGCCACTGTGATGCTTTATGATGATGGCAACAAGCGATGGCTCCCTGCTGGCACGGGTCCCCAGGCCTTCAGCCGCGTCCAGATCTACCACAACCCCACGGCCAATTCCTTTCGCGTCGTGGGCCGGAAGATGCAGCCCGACCAGCAG
c. Taking the synthesized double-stranded DNA as an RNA synthesis template, synthesizing a large amount of linear RNA in vitro by adopting a T7 high-yield RNA synthesis kit, removing the template DNA, and purifying to obtain linear RNA;
d. then linear RNA is inserted into an RNA vector, and correctly cyclized RNA is separated;
e. the delivery agent and circular RNA were injected intramuscularly in mice;
f. detecting whether the antibody is generated or not 15 days after the administration;
g. cell fusion: the mice are sacrificed, the spleen is taken out through aseptic operation, and spleen cell suspension is prepared; spleen cells and myeloma cells were mixed according to 1: 10, and adding polyethylene glycol, and fusing the cells to form hybridoma cells;
h. monoclonal testing: after 10-14 days, when cell clone is visible to naked eyes and part of the culture medium of the wells begins to turn yellow, all the wells are detected by enzyme linked immunosorbent assay, after 3 days, ELISA detection is carried out on the positive clone identified by the first ELISA, after 3 days, ELISA detection is carried out on the positive clone identified by the second ELISA, and the positive cells are subjected to amplification cell culture for mass production of monoclonal antibodies.
In the murine monoclonal antibody, the murine monoclonal antibody heavy chain complementarity determining regions comprise: CDR-H1, CDR-H2, CDR-H3,
CDR-H1 has the amino acid sequence of VFDYMCK shown as SEQ ID NO 2 of the sequence table,
CDR-H2 has an amino acid sequence of LGECIHGTNYWAANKG shown in SEQ ID NO 3 of the sequence table,
CDR-H3 has an amino acid sequence of VSVGYDYAYEA shown in SEQ ID NO 4 of the sequence table;
the murine mab light chain complementarity determining region comprises: CDR-L1, CDR-L2, CDR-L3,
CDR-L1 has an amino acid sequence of PNTEDISTS shown in SEQ ID NO 5 of the sequence table,
CDR-L2 has an amino acid sequence of KADDAS shown in SEQ ID NO 6 of the sequence Listing,
CDR-L3 has an amino acid sequence of GACSYFNVPIK as shown in SEQ ID NO 7 of the sequence Listing.
(3) Preparing an enzyme label plate:
A) diluting VASP monoclonal antibody to 0.04 mu g/ml antibody diluent by using 0.5mol/L PBS buffer solution;
B) adding 100 mu L of antibody diluent into an enzyme label plate, coating for 3h, washing with deionized water containing 4% Tween-20, and patting to dry;
C) adding a blocking solution containing BSA into the ELISA plate, blocking for 2h, pouring out the liquid in the hole, and drying in vacuum.
(4) The preparation method of the human phosphorylated vasodilator stimulating phosphoprotein calibrator comprises the following steps:
a. preparing a calibrator buffer solution: sequentially weighing 2.42g of tris (hydroxymethyl) aminomethane, 18.00g of sodium chloride, 201.00 g of tween, 200mL of fetal bovine serum and 1.00g of Proclin 3001, and dissolving in 1L of deionized water by stirring fully, and adjusting the pH to 7.40 +/-0.10;
b. human phosphorylated VASP antigen was diluted to a working concentration of 400ng/L with calibrator buffer.
Example 2 test method of kit
(1) Taking out the kit from the refrigerator, and balancing to room temperature (18-25 ℃);
(2) sampling the activator dry powder and the sample inhibitor dry powder, and respectively adding 1ml of sample pretreatment agent for dissolution;
(3) respectively taking 10 mul of sample activator and sample inhibitor and reaction holes;
(4) respectively adding 10 μ l of sample to be detected (whole blood) or calibrator into corresponding micropores of the ELISA plate, mixing, and incubating at room temperature for 10 min;
(5) adding the mixture into corresponding micropores of an enzyme label plate, incubating and carrying out the first-step reaction;
(6) adding a VASP monoclonal antibody marked by HRP enzyme, incubating in a dark place, and carrying out a second step of reaction;
(7) washing, drying, adding a color development solution, and incubating in a dark place;
(8) adding stop solution to the solution at 450nm to measure the absorbance;
(9) and (3) calculating: platelet Response Index (PRI) ═ [ (C activation-C inhibition)/(C activation-C calibration) ] × 100%.
Example 3 Performance test of the kit
(1) Clinical sample verification by using the kit
The kit of the present application was used to test 183 samples together with the marketed kit (CY-QUANTVASP/P2Y12, BIOCYTEX), the data of which are shown in the following table:
sample coincidence rate with Stago company VASP kit detection sample
Negative coincidence rate: 84/88= 95.45%;
positive compliance rate: 95/95= 100%;
the total coincidence rate is as follows: 179/183= 97.81%.
From the above results, it can be seen that: the enzyme-linked immunoassay kit for human phosphorylated vasodilator-stimulated phosphoprotein has good applicability and advancement.
(2) Linear testing of the kit
Drawing a standard curve after detecting the protein calibrator, wherein the standard curve is shown in fig. 1 and 2, and the formula y (activation) =1.1754x + 14.81 of the standard curve, and R2 = 0.9982 of the standard curve; y (suppression) = 1.1069x + 38.905, R2 = 0.9976. Meanwhile, the linear condition of the detection results is evaluated, and the detection results are shown in the following table:
the result shows that the detection result of the VASP enzyme-linked immunoassay kit is not obtained accidentally, has a certain clinical reference value, and can be used for evaluating the administration effect of antiplatelet drugs such as clopidogrel.
Finally, it must be said here that: the above embodiments are only used for further detailed description of the technical solutions of the present invention, and should not be understood as limiting the scope of the present invention, and the insubstantial modifications and adaptations made by those skilled in the art according to the above descriptions of the present invention are within the scope of the present invention.
Sequence listing
<110> Hunan Firstate precision medical science and technology Limited
<120> enzyme-linked immunoassay kit for human phosphorylated vasodilator-stimulated protein and detection method thereof
<160> 7
<170> SIPOSequenceListing 1.0
<210> 1
<211> 177
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> unsure
<222> (1)..(177)
<400> 1
atgagcgaga cggtcatctg ttccagccgg gccactgtga tgctttatga tgatggcaac 60
aagcgatggc tccctgctgg cacgggtccc caggccttca gccgcgtcca gatctaccac 120
aaccccacgg ccaattcctt tcgcgtcgtg ggccggaaga tgcagcccga ccagcag 177
<210> 2
<211> 7
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> UNSURE
<222> (1)..(7)
<400> 2
Val Phe Asp Tyr Met Cys Lys
1 5
<210> 3
<211> 16
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> UNSURE
<222> (1)..(16)
<400> 3
Leu Gly Glu Cys Ile His Gly Thr Asn Tyr Trp Ala Ala Asn Lys Gly
1 5 10 15
<210> 4
<211> 11
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> UNSURE
<222> (1)..(11)
<400> 4
Val Ser Val Gly Tyr Asp Tyr Ala Tyr Glu Ala
1 5 10
<210> 5
<211> 9
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> UNSURE
<222> (1)..(9)
<400> 5
Pro Asn Thr Glu Asp Ile Ser Thr Ser
1 5
<210> 6
<211> 6
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> UNSURE
<222> (1)..(6)
<400> 6
Lys Ala Asp Asp Ala Ser
1 5
<210> 7
<211> 11
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> UNSURE
<222> (1)..(11)
<400> 7
Gly Ala Cys Ser Tyr Phe Asn Val Pro Ile Lys
1 5 10
Claims (8)
1. An enzyme-linked immunoassay kit for human phosphorylated vasodilator-stimulated protein, which is characterized by comprising a sample pretreatment buffer solution, a sample activator containing PGE1, a sample inhibitor containing PGE1 and ADP, an enzyme label plate, a VASP monoclonal antibody, a color development solution and a stop solution; the VASP monoclonal antibody is a horseradish peroxidase-labeled murine monoclonal antibody, a murine monoclonal antibody heavy chain complementary determining region comprises CDR-H1, CDR-H2 and CDR-H3 fragments, a murine monoclonal antibody light chain complementary determining region comprises CDR-L1, CDR-L2 and CDR-L3 fragments, CDR-H1 is an amino acid sequence shown in a sequence table SEQ ID No.2, CDR-H2 is an amino acid sequence shown in a sequence table SEQ ID No.3, CDR-H3 is an amino acid sequence shown in a sequence table SEQ ID No.4, CDR-L1 is an amino acid sequence shown in a sequence table SEQ ID No.5, CDR-L2 is an amino acid sequence shown in a sequence table SEQ ID No.6, and CDR-L3 is an amino acid sequence shown in a sequence table SEQ ID No. 7.
2. The ELISA kit for human phosphorylated vasodilator-stimulated protein of claim 1, wherein the ELISA plate is coated with VASP monoclonal antibody.
3. The ELISA kit of claim 1 wherein the pre-treatment buffer is 70mM Tris-HCl, 250mM NaCl, 0.2% Tween-20, 0.5% TritonX-100 and 1.5% Proclin300, and the pH of the pre-treatment buffer is 7.6.
4. The ELISA kit for human phosphorylated vasodilator-stimulated protein of claim 1, wherein the kit further comprises a human phosphorylated vasodilator-stimulated phosphoprotein calibrator.
5. The ELISA kit of claim 4 wherein the human phosphorylated vasodilator-stimulating protein calibrator is 20mM Tris buffer containing 20% fetal bovine serum.
6. A detection method adopting the enzyme-linked immunoassay kit for human phosphorylated vasodilator-stimulated protein according to any one of claims 1 to 5, characterized in that the detection method comprises the following steps:
(1) sample pretreatment: after the activator dry powder and the sample inhibitor dry powder are sampled and dissolved by the sample pretreatment agent respectively, 10 mul of the dissolved sample activator and 10 mul of the sample inhibitor are taken respectively, and the equal volume of the sample to be tested or the calibrator is added, mixed evenly and incubated for 10min at room temperature;
(2) respectively adding the activated sample, the inhibited sample, the activated calibrator and the inhibited calibrator incubated in the step (1) into corresponding micropores of an ELISA plate, and incubating;
(3) adding a VASP monoclonal antibody marked by HRP enzyme into the corresponding micropores in the step (2), and incubating in a dark place;
(4) washing and drying, adding a color development solution into each hole, and incubating in a dark place;
(5) adding a stop solution into each hole, measuring the absorbance of the stop solution at 450nm, respectively obtaining an activated absorbance value C for activation, and an inhibited absorbance value C for inhibition, wherein the activated calibrator and the inhibited calibrator have the same absorbance values and are both C for calibration;
(6) the platelet response index was calculated.
7. The test method according to claim 6, wherein the platelet reactivity index is calculated by the formula:
platelet response index PRI ═ [ (C activation-C inhibition)/(C activation-C calibration) ] × 100%.
8. The assay of claim 7, wherein the VASP monoclonal antibody is prepared by the steps of: synthesizing corresponding VASP linear DNA as an RNA synthesis template to synthesize linear RNA; inserting linear RNA into a circular RNA vector and isolating correctly circularized RNA; intramuscular injection of the delivery agent and circular RNA into mice to produce antibodies; hybridoma cells are prepared, tested for monoclonality, and expanded cell culture is used for mass production of monoclonal antibodies.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111638413.9A CN114002440B (en) | 2021-12-30 | 2021-12-30 | Enzyme-linked immunoassay kit for human phosphorylated vasodilator-stimulated protein and detection method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111638413.9A CN114002440B (en) | 2021-12-30 | 2021-12-30 | Enzyme-linked immunoassay kit for human phosphorylated vasodilator-stimulated protein and detection method thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114002440A CN114002440A (en) | 2022-02-01 |
| CN114002440B true CN114002440B (en) | 2022-04-01 |
Family
ID=79932472
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111638413.9A Active CN114002440B (en) | 2021-12-30 | 2021-12-30 | Enzyme-linked immunoassay kit for human phosphorylated vasodilator-stimulated protein and detection method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114002440B (en) |
Family Cites Families (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| DE29824896U1 (en) * | 1997-11-07 | 2003-04-10 | Vasopharm Biotech Gmbh | Antibodies against phosphorylated VASP (vasodilator-stimulated phosphoprotein) and hybridoma cells for their production |
| JP5031140B2 (en) * | 1997-11-07 | 2012-09-19 | バイオサイテックス | Antibody against phosphorylated VASP (vasodilator-stimulated phosphoprotein), hybridoma cell for its preparation and use thereof |
| FR2946756A1 (en) * | 2009-06-12 | 2010-12-17 | Biocytex | TOTAL BLOOD ASSAY OF AN INTRACELLULAR BIOMARKER BELONGING TO A CELL SIGNALING PATH - USE TO MEASURE THE ACTIVATION OF A DETERMINED CELLULAR POPULATION |
| CN108982861A (en) * | 2018-07-26 | 2018-12-11 | 北京普恩光德生物科技开发有限公司 | A kind of blood vessel dilatation type stimulation phosphoprotein detection kit |
| CN112730826A (en) * | 2020-12-23 | 2021-04-30 | 中南大学湘雅三医院 | Human phosphorylated vasodilator-stimulated phosphoprotein magnetic particle chemiluminescence immune quantitative detection kit, and detection method and application thereof |
| CN113238062B (en) * | 2021-07-13 | 2021-09-28 | 湖南菲思特精准医疗科技有限公司 | Homogeneous immunoassay kit for human phosphorylated vasodilator stimulated phosphoprotein light-induced chemiluminescence and detection method thereof |
-
2021
- 2021-12-30 CN CN202111638413.9A patent/CN114002440B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN114002440A (en) | 2022-02-01 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN112394179B (en) | FMC63 CAR-T cell immunogenicity ELISA detection kit | |
| CN110167967A (en) | For the idiotype antibody and application thereof of anti-PD-L1 antibody | |
| KR20180055823A (en) | Method of measuring PIVKA-II, and method of producing PIVKA-II immunoassay reagent or kit | |
| WO2016011852A1 (en) | Bladder tumor-associated antigen detection kit | |
| KR101976297B1 (en) | Antigen polypeptide for detecting plasma immunological marker-vegfr1 autoantibody and use | |
| CN114181308A (en) | Procalcitonin antibody and application thereof | |
| CN114002440B (en) | Enzyme-linked immunoassay kit for human phosphorylated vasodilator-stimulated protein and detection method thereof | |
| CN111273015B (en) | Enzyme linked immunosorbent assay kit for detecting Gymnodinium breve toxin and preparation and application thereof | |
| CN113238062A (en) | Homogeneous immunoassay kit for human phosphorylated vasodilator stimulated phosphoprotein light-induced chemiluminescence and detection method thereof | |
| CN114755420B (en) | Carbapenemase combined detection kit | |
| CN109154616B (en) | Method for serological detection of viral antigens | |
| CN109541221A (en) | A kind of c-Met specific antibody, composition and kit | |
| CN112300285B (en) | Enzyme-linked immunoassay method for quantitatively detecting content of anti-human interleukin 17 monoclonal antibody in serum | |
| WO1994004700A1 (en) | Monoclonal antibody recognizing fk506-binding protein, method of assaying fk506-binding protein level, and kit thereof | |
| CN111273041A (en) | Enzyme linked immunosorbent assay kit for detecting phalloidin, and preparation and application thereof | |
| CN111443202A (en) | Enzyme linked immunosorbent assay kit for detecting anticoagulant rodenticide and preparation and application thereof | |
| US20020106705A1 (en) | Detection method for monitoring beta tubulin isotype specific modification | |
| EP1765867B1 (en) | Monoclonal antibodies to hiv-1 vpr and methods of using same | |
| CN115057871B (en) | Rifampicin hapten derivative, rifampicin complete antigen, rifampicin antibody and application | |
| CN117285637B (en) | Anti-idiotype antibody and application thereof | |
| CN111308100B (en) | ELISA kit for detecting beta-amatoxin and preparation and application thereof | |
| CN112646040B (en) | Protein specifically binding to human IgG4 and application thereof | |
| CN117264072B (en) | anti-SN 38 monoclonal antibody and application thereof | |
| CN117003882B (en) | Hybridoma cell strain combination and antibody combination for detecting golimumab and application of hybridoma cell strain combination and antibody combination | |
| JPH04135484A (en) | Monoclonal antibody of 8-hydroxy-2'-deoxyguanosine and preparation thereof and hybrid cell producing monoclonal antibody |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |