CN113999918B - Colorectal cancer distal metastasis specific long-chain non-coding RNA marker LINC01871 and detection kit thereof - Google Patents
Colorectal cancer distal metastasis specific long-chain non-coding RNA marker LINC01871 and detection kit thereof Download PDFInfo
- Publication number
- CN113999918B CN113999918B CN202111657296.0A CN202111657296A CN113999918B CN 113999918 B CN113999918 B CN 113999918B CN 202111657296 A CN202111657296 A CN 202111657296A CN 113999918 B CN113999918 B CN 113999918B
- Authority
- CN
- China
- Prior art keywords
- linc01871
- colorectal cancer
- metastasis
- patient
- detected
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/118—Prognosis of disease development
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA
Abstract
The invention discloses a colorectal cancer distal metastasis specific long-chain non-coding RNA marker LINC01871 and a detection kit thereof. According to the invention, a long-chain non-coding RNA marker LINC01871 related to colon cancer distal metastasis is obtained by screening through a TCGA database, then a specific detection primer is designed, and LINC01871 expression quantity detection is carried out by taking cancer focus tissue samples of 46 cases of Chinese colon cancer patients as samples to be detected. The results show that: in 46 cases of Chinese colon cancer patients, the relative expression quantity of LINC01871 in cancer focus tissues of a colon cancer distant metastasis patient is remarkably lower than that of a colon cancer non-metastasis patient. The LINC01871 found by the invention has a certain application prospect in the aspects of screening, diagnosing and risk predicting of colon cancer distal metastasis and colorectal cancer prognosis evaluation as a brand-new lncRNA molecular marker.
Description
Technical Field
The invention relates to the technical field of biology, in particular to a colorectal cancer distal metastasis specific long-chain non-coding RNA marker LINC01871 and a detection kit thereof.
Background
Colorectal Cancer (CRC), also known as "Colorectal Cancer," refers to cancers of large intestinal epithelial origin, including colon and rectal cancers, with the second incidence of gastrointestinal tumors to gastric Cancer. In China, the prevalence rate of colorectal cancer is as high as 46.8/10 ten thousand, and the colorectal cancer becomes one of three cancers in China, and the prevalence rate is increasing at a rate of 4.2%. The incidence of distant metastasis in all colorectal cancer patients is as high as 30% -50%, wherein 15% -25% of patients combine distant metastasis when intestinal cancer is diagnosed, and the other 15% -25% of patients have distant metastasis after radical excision of the primary intestinal cancer focus. Distant metastasis is one of the leading causes of death in colorectal cancer patients.
With the continuous progress of molecular biology technology, molecular markers for colorectal cancer detection have been developed to a certain extent, but the biomarkers applied to the clinical detection of patients with remote metastasis still have limitations, and a rapid, effective and accurate molecular marker at the nucleic acid level is still lacking clinically, so that the research in the field should be broadened, and a novel marker is actively searched. Screening molecular markers effective in predicting distant metastasis can be used as a screening means for census, or can provide clues for early diagnosis of distant metastasis of colon cancer.
Long non-coding RNA (lncRNA) is a Long non-coding RNA molecule which does not code protein and has a transcript length of more than 200nt, and can regulate the expression of genes on multiple layers (epigenetic regulation, transcriptional regulation, post-transcriptional regulation and the like). Recent studies show that lncRNA is involved in processes such as genome modification, transcriptional activation, transcriptional interference, and nuclear transport, and the regulation and control effects of lncRNA are being researched by more and more people. The functional lncRNA can directly or indirectly regulate the expression of oncogenes or cancer suppressor genes, and the fact that the functional lncRNA has a very wide prospect as a tumor diagnosis marker is suggested. At present, the role and mechanism of lncRNA in the occurrence and development of colon cancer become a new research hotspot.
Disclosure of Invention
The invention aims to provide a new application of a substance for detecting the expression level of LINC 01871.
The invention provides application of a substance for detecting the expression level of LINC01871 in any one of the following (a 1) - (a 9):
(a1) preparing a product for screening or assisting in diagnosing colorectal cancer distant metastasis;
(a2) preparing a product for judging or assisting in judging whether the colorectal cancer patient to be detected is a colorectal cancer far-end metastasis patient;
(a3) preparing a product for predicting the risk of developing distant metastasis in a colorectal cancer patient;
(a4) preparing a product for differentiating between patients with distal metastasis of colorectal cancer and patients with non-metastasis of colorectal cancer;
(a5) preparing a product for prognosis risk assessment of colorectal cancer patients;
(a6) preparing a product for prognosis overall survival rate evaluation of colorectal cancer patients;
(a7) preparing a product for prognosis disease-free survival rate evaluation of colorectal cancer patients;
(a8) preparing a product for predicting the incidence of distant metastasis in a patient with colorectal cancer;
(a9) preparing a product for predicting the incidence of lymphatic metastasis of a colorectal cancer patient.
It is another object of the present invention to provide a kit.
The kit provided by the invention comprises a substance for detecting the expression level of LINC 01871; the kit functions as any one of the following (b 1) - (b 9):
(b1) screening or aiding diagnosis of colorectal cancer distant metastasis;
(b2) judging or assisting to judge whether the colorectal cancer patient to be detected is a colorectal cancer far-end metastasis patient;
(b3) predicting the risk of developing distant metastasis in a colorectal cancer patient;
(b4) differentiating between patients with distal metastasis of colorectal cancer and non-metastatic patients;
(b5) assessing a prognostic risk of a colorectal cancer patient;
(b6) assessing the overall survival rate of colorectal cancer patients;
(b7) assessing prognosis disease-free survival rate of the colorectal cancer patient;
(b8) predicting the incidence of distant metastasis in colorectal cancer patients;
(b9) predicting the incidence rate of lymphatic metastasis of colorectal cancer patients.
It is a further object of this invention to provide such a system.
The system provided by the invention comprises a data processing device and a substance for detecting the expression level of LINC 01871; the function of the system is any one of the following (b 1) - (b 9):
(b1) screening or aiding diagnosis of colorectal cancer distant metastasis;
(b2) judging or assisting to judge whether the colorectal cancer patient to be detected is a colorectal cancer far-end metastasis patient;
(b3) predicting the risk of developing distant metastasis in a colorectal cancer patient;
(b4) differentiating between patients with distal metastasis of colorectal cancer and non-metastatic patients;
(b5) assessing a prognostic risk of a colorectal cancer patient;
(b6) assessing the overall survival rate of colorectal cancer patients;
(b7) assessing prognosis disease-free survival rate of the colorectal cancer patient;
(b8) predicting the incidence of distant metastasis in colorectal cancer patients;
(b9) predicting incidence of lymphatic metastasis in colorectal cancer patients;
the data processing device consists of a data input module, a data recording module, a data comparison module and a conclusion output module;
the data input module is configured to input a relative expression quantity value of LINC01871 in the cancer focus tissue of the colorectal cancer patient to be detected;
the data recording module is configured to store a relative expression quantity value and a judgment threshold value of LINC01871 in cancer focus tissues of a colorectal cancer patient to be detected;
the data comparison module is configured to receive the relative expression quantity value of the LINC01871 in the cancer focus tissue of the colorectal cancer patient to be detected, which is sent by the data input module, and call the judgment threshold value from the data recording module to compare with the relative expression quantity value of the LINC01871 in the cancer focus tissue of the colorectal cancer patient to be detected;
the conclusion output module is configured to receive the comparison result sent by the data comparison module and judge the comparison result according to a preset judgment condition.
Further, the predetermined determination condition is as follows: if the relative expression quantity value of LINC01871 in the cancer focus tissue of the colorectal cancer patient to be detected is less than or equal to 4.69, determining that the colorectal cancer patient to be detected is or is selected as a colorectal cancer far-end metastasis patient; and if the relative expression quantity value of the LINC01871 in the cancer focus tissue of the colorectal cancer patient to be detected is more than 4.69, the colorectal cancer patient to be detected is not or is not candidate to be the colorectal cancer remote metastasis patient.
The application of LINC01871 as a marker in any one of the following (a 1) - (a 9) also belongs to the protection scope of the invention:
(a1) preparing a product for screening or assisting in diagnosing colorectal cancer distant metastasis;
(a2) preparing a product for judging or assisting in judging whether the colorectal cancer patient to be detected is a colorectal cancer far-end metastasis patient;
(a3) preparing a product for predicting the risk of developing distant metastasis in a colorectal cancer patient;
(a4) preparing a product for differentiating between patients with distal metastasis of colorectal cancer and patients with non-metastasis of colorectal cancer;
(a5) preparing a product for prognosis risk assessment of colorectal cancer patients;
(a6) preparing a product for prognosis overall survival rate evaluation of colorectal cancer patients;
(a7) preparing a product for prognosis disease-free survival rate evaluation of colorectal cancer patients;
(a8) preparing a product for predicting the incidence of distant metastasis in a patient with colorectal cancer;
(a9) preparing a product for predicting the incidence of lymphatic metastasis of a colorectal cancer patient.
In any of the above applications or kits or systems, the substance for detecting the expression level of LINC01871 comprises a reagent and/or an instrument for detecting the relative expression level of LINC 01871.
Further, the reagent for detecting the relative expression amount of the LINC01871 comprises a LINC01871 amplification primer.
The instrument for detecting the relative expression quantity of the LINC01871 comprises a real-time quantitative fluorescent PCR instrument.
Furthermore, the LINC01871 amplification primer consists of a single-stranded DNA molecule shown in a sequence 1 in a sequence table and a single-stranded DNA molecule shown in a sequence 2 in the sequence table.
The relative expression quantity is the relative expression quantity of the reference internal reference gene LINC 01871.
The reference gene can be specificallyGAPDHA gene. The reagent also comprisesGAPDHAnd (3) gene amplification primers. The above-mentionedGAPDHThe gene amplification primer consists of a single-stranded DNA molecule shown as a sequence 3 in a sequence table and a single-stranded DNA molecule shown as a sequence 4 in the sequence table.
The phasesThe expression level was calculated as follows: taking the cDNA of a colorectal cancer patient to be detected as a template, carrying out RT-PCR by adopting the LINC01871 amplification primer, and then calculating the relative expression amount according to the following formula: EV = log2(RV 10000+1), where RV =2-ΔCt ，ΔCt=CtlncRNA-CtGAPDH。
The cDNA of the colorectal cancer patient to be detected is cDNA obtained by reverse transcription of RNA extracted from lesion (cancer focus) tissues of the colorectal cancer patient to be detected.
In any of the above uses or kits or systems, the distant metastasis is specifically liver metastasis.
In any of the above uses or kits or systems, the colorectal cancer is specifically colon cancer.
In any of the above applications or kits or systems, the nucleotide sequence of LINC01871 is shown as sequence 5 in the sequence table.
The invention obtains a novel lncRNA (LINC 01871) marker related to colorectal cancer distal metastasis by screening a TCGA database, and designs a specific primer for detecting the LINC01871 expression level in the cancer focus tissues of 46 cases of Chinese colon cancer patients. The results show that: in 46 cases of Chinese colon cancer patients, the relative expression quantity of LINC01871 in cancer focus tissues of a colon cancer distant metastasis patient is remarkably lower than that of a colon cancer non-metastasis patient. LINC01871 has certain application prospect in the aspects of colorectal cancer distal metastasis screening, diagnosis, risk prediction and colorectal cancer prognosis evaluation as a brand-new lncRNA molecular marker.
Drawings
FIG. 1 is a scattergram of the relative expression level of TCGA.
FIG. 2 is a correlation analysis of the relative expression level of LINC01871 and prognosis (overall survival rate) of colon cancer patients.
FIG. 3 is a correlation analysis of the relative expression level of LINC01871 and the prognosis (disease-free survival rate) of colon cancer patients.
FIG. 4 shows the amplification curve of RT-PCR.
FIG. 5 shows the melting curve of RT-PCR.
FIG. 6 shows the sequencing results of RT-PCR amplification products.
FIG. 7 shows the results of relative expression level detection of LINC 01871.
Detailed Description
The present invention is described in further detail below with reference to specific embodiments, which are given for the purpose of illustration only and are not intended to limit the scope of the invention. The examples provided below serve as a guide for further modifications by a person skilled in the art and do not constitute a limitation of the invention in any way.
The experimental procedures in the following examples, unless otherwise indicated, are conventional and are carried out according to the techniques or conditions described in the literature in the field or according to the instructions of the products. Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.
Example 1 obtaining of colorectal cancer distal metastasis specific long-chain non-coding RNA marker LINC01871, and detection method and application thereof
The invention obtains a novel long-chain non-coding RNA marker LINC01871 related to the distal metastasis of colon cancer by screening a TCGA database, and designs a specific detection primer for detecting the LINC01871 expression level in the cancer focus tissues of 46 cases of Chinese colon cancer patients. The method comprises the following specific steps:
first, obtaining of long-chain non-coding RNA marker LINC01871 with colorectal cancer distal end metastasis specificity
Differentially expressed lncRNA in The TCGA database (The Cancer Genome Atlas) was screened and analyzed as follows: p value <0.05, | logFC | >1, the analysis software package is as follows: the R language package edgeR. Wherein, FC is Fold Change, namely, the divisor of the average expression value of lncRNA in the tissues of distant metastatic cancer foci of colon cancer and the average expression value in the tissues of non-metastatic cancer foci of colon cancer.
Finally, screening to obtain a differentially expressed lncRNA: the results of detecting the expression level of LINC01871 in the cancer focus tissues of a distal metastatic patient of colon cancer and a non-metastatic patient of colon cancer are shown in figure 1, and the results show that: LINC01871 is low expressed in cancer focus tissues of patients with distal metastasis of colon cancer.
2. Correlation analysis of LINC01871 expression level and prognosis of colon cancer patient
325 cases of colon cancer patients in the TCGA database were classified into LINC01871 low-expression group colon cancer patients (n = 163) and LINC01871 high-expression group colon cancer patients (n = 162) according to the LINC01871 expression amount. Wherein the colon cancer patient with the LINC01871 low expression level is a colon cancer patient with an expression value less than or equal to 1.497785733, and the colon cancer patient with the LINC01871 high expression level is a colon cancer patient with an expression value more than 1.497785733.
1) Correlation analysis of LINC01871 expression level and overall survival rate of colon cancer patients
The overall survival (overall survival) analysis was performed based on the TCGA data, and the results are shown in fig. 2. The results show that: the overall survival rate of the colon cancer patient with the LINC01871 low expression group is lower than that of the colon cancer patient with the LINC01871 high expression group (P = 0.24), which indicates that the LINC01871 low expression is related to the poor prognosis of the colon cancer patient.
In practical applications, the overall survival rate of colon cancer patients can be evaluated according to the following method: taking cancer focus tissues of a to-be-detected population consisting of a plurality of colon cancer patients as samples, determining the relative expression level of LINC01871 in each sample, then arranging and halving the to-be-detected population according to the sequence of the relative expression levels of LINC01871 from low to high, taking 1/2 with low expression level as a LINC01871 low expression group, taking the rest 1/2 of to-be-detected population as a LINC01871 high expression group, and predicting the overall survival rate of the colon cancer patients from the to-be-detected population according to the following standards: the overall survival rate of colorectal cancer patients from the LINC01871 low expression group is lower than or candidate lower than that of colorectal cancer patients from the LINC01871 high expression group.
2) Correlation analysis of LINC01871 expression level and disease-free survival rate of colon cancer patient
The results of Disease-free survival analysis based on TCGA data are shown in FIG. 3. The results show that: the disease-free survival rate of the LINC01871 low-expression group colon cancer patients is obviously lower than that of the LINC01871 high-expression group colon cancer patients (P = 0.009), and the fact that the LINC01871 low expression is related to the relapse of the colon cancer patients is proved.
In practical applications, the prognosis of disease-free survival rate of colon cancer patients can be evaluated as follows: taking cancer focus tissues of a to-be-detected population consisting of a plurality of colon cancer patients as samples, determining the relative expression level of LINC01871 in each sample, then arranging and halving the to-be-detected population according to the sequence of the relative expression levels of LINC01871 from low to high, taking 1/2 with low expression level as a LINC01871 low expression group, taking the rest 1/2 of to-be-detected population as a LINC01871 high expression group, and predicting the prognosis disease-free survival rate of the colon cancer patients from the to-be-detected population according to the following standards: the disease-free survival rate of colorectal cancer patients from the LINC01871 low expression group is lower than or candidate lower than that of colorectal cancer patients from the LINC01871 high expression group.
3) Correlation analysis of LINC01871 expression level and incidence rate of lymphatic metastasis and distant metastasis of colon cancer patients
According to the result of LINC01871 expression data in TCGA database and the clinical index of the patient, single-factor analysis is carried out (Table 1), and the results show that: the colon cancer patients with the low expression LINC01871 group have poorer TNM stage (83/159), higher incidence rate of lymphatic metastasis (81/163) and higher incidence rate of distant metastasis (30/140).
TABLE 1 Single factor analysis
In practical application, the incidence rate of distant metastasis and the incidence rate of lymphatic metastasis of a colon cancer patient can be predicted according to the following methods: taking cancer focus tissues of a to-be-detected population consisting of a plurality of colon cancer patients as samples, determining the relative expression level of LINC01871 in each sample, then arranging and halving the to-be-detected population according to the sequence of the relative expression levels of LINC01871 from low to high, taking 1/2 with low expression level as a LINC01871 low expression group, taking the rest 1/2 of to-be-detected population as a LINC01871 high expression group, and predicting the occurrence rate of distal metastasis and the occurrence rate of lymphatic metastasis of the colon cancer patients from the to-be-detected population according to the following standards: the incidence of distant metastasis and the incidence of lymphatic metastasis from the colorectal cancer patients in the low-expression LINC01871 group are higher or are more candidate than the colorectal cancer patients in the high-expression LINC01871 group.
Secondly, detection method of colorectal cancer distal metastasis specific long-chain non-coding RNA marker LINC01871 and application thereof
1. Design of primers
And (2) carrying out specific primer design on the differentially expressed LINC01871 obtained by screening in the step one, wherein the designed primer sequence is as follows:
LINC 01871-Forward: GTCACACTACCAAAGGCCG (SEQ ID NO: 1);
LINC 01871-Reserve: GAGAGACAGATCGTCCACGG (SEQ ID NO: 2).
2. Preparation of samples to be tested
Cancer focus tissues excised by 46 clinically confirmed colon cancer patients are taken as samples to be tested, and the collection time is 2005-2017. 46 colon cancer patients were obtained from the people hospital of Beijing university and were approved by the ethical Committee of hospitals. Of 46 colon cancer patients, 6 were distal metastases (6 were metastatic to colon cancer liver), and 40 were non-metastatic (non-metastatic to colon cancer refers to colon cancer patients who did not develop any distal metastases).
3. RT-PCR detection of relative expression quantity of LINC01871
And detecting the relative expression quantity of the LINC01871 in the sample to be detected by adopting RT-PCR. The method comprises the following specific steps:
1) RNA extraction
RNA extraction was performed on cancer focal tissues surgically removed from 46 colon cancer patients.
2) Reverse transcription
The RNA sample was subjected to reverse transcription using a reverse transcription Kit (Takara PrimeScript RT reagent Kit, RR 037A) to obtain cDNA.
The reverse transcription system is shown in Table 2.
TABLE 2 reverse transcription System
Reverse transcription reaction conditions: 15 min at 37 ℃; 5 sec at 85 ℃; 4 ℃ is prepared.
3）RT-PCR
And (2) carrying out RT-PCR by using the cDNA as a template and an RT-PCR kit (TOYOBO SYBR Green Realtime PCR Master Mix, QPK-201) and the primers designed in the step 1 to obtain a PCR amplification product. GAPDH was also used as a reference gene. And (4) calculating the relative expression quantity of the LINC01871 according to the Ct value of the PCR amplification product, and sequencing and analyzing the PCR amplification product. The relative expression calculation formula is as follows:
EV=log2(RV*10000+1)，RV=2-ΔCt ，ΔCt=CtlncRNA-CtGAPDH。
the GAPDH amplification primer sequences are as follows:
GAPDH-F: AATGAAGGGGTCATTGATGG (SEQ ID NO: 3);
GAPDH-R: AAGGTGAAGGTCGGAGTCAA (SEQ ID NO: 4).
The RT-PCR amplification reaction system is shown in Table 3.
TABLE 3 RT-PCR amplification reaction System
The RT-PCR amplification reaction program is as follows: step 1: 3 minutes at 95 ℃; stage 2: 40 Cycles at 5 ℃ for 10 seconds, 60 ℃ for 60 seconds; stage 3: melt Curve.
4. Analysis of results
1) Amplification and dissolution curves
The amplification and dissolution curves of RT-PCR are shown in FIGS. 4 and 5. The results show that: the dissolution curve is unimodal, indicating good primer specificity. The Ct value of the amplification in the amplification curve is about 20-30, which indicates that the amplification efficiency of the primer is high.
2) Sequencing results
The sequencing results of the PCR amplification products are shown in FIG. 6. The results show that: the PCR amplification product is single, and the product is LINC01871 after sequence alignment.
3) Relative expression level detection result of LINC01871
The results of measuring the relative expression level of LINC01871 are shown in FIG. 7. The results show that: in 46 colon cancer clinical tissue samples (cancer focus tissues), the average value of the relative expression quantity of LINC01871 in the cancer focus tissues of 6 colon cancer remote metastatic patients is 4.69, the average value of the relative expression quantity of LINC01871 in the cancer focus tissues of 40 colon cancer non-metastatic patients is 6.13, and the relative expression quantity of LINC01871 in the cancer focus tissues of the colon cancer remote metastatic patients is obviously lower than that of the colon cancer non-metastatic patients. Therefore, the LINC01871 has higher application value in the prediction and diagnosis of the distal metastasis of the colon cancer as a target point.
In practical application, whether the colon cancer patient to be detected is a colon cancer distal metastasis patient can be judged according to the following method: extracting RNA of a cancer focus tissue of a colon cancer patient to be detected, and performing reverse transcription to obtain cDNA; taking cDNA as a template, and performing RT-PCR amplification by adopting DNA molecules shown in a sequence 1 and DNA molecules shown in a sequence 2 to obtain an amplification product; calculating the relative expression quantity of the LINC01871 of the colon cancer patient to be detected according to the Ct value of the amplification product, and judging whether the colon cancer patient to be detected is a colon cancer distal metastasis patient or not according to the relative expression quantity of the LINC01871 of the colon cancer patient to be detected: and if the relative expression quantity of the LINC01871 in the cancer focus tissue of the colon cancer patient to be detected is less than or equal to 4.69, determining that the colon cancer patient to be detected is or is a candidate for the colon cancer distal end metastasis patient, and if the relative expression quantity of the LINC01871 in the cancer focus tissue of the colon cancer patient to be detected is more than 4.69, determining that the colon cancer patient to be detected is not or is not a candidate for the colon cancer distal end metastasis patient.
The risk of distant metastasis of a colon cancer patient to be tested can also be predicted and evaluated as follows: extracting RNA of a cancer focus tissue of a colon cancer patient to be detected, and performing reverse transcription to obtain cDNA; taking cDNA as a template, and performing RT-PCR amplification by adopting DNA molecules shown in a sequence 1 and DNA molecules shown in a sequence 2 to obtain an amplification product; calculating the relative expression quantity of the LINC01871 of the colon cancer patient to be detected according to the Ct value of the amplification product, and predicting the risk of the LINC01871 of the colon cancer patient to be detected for generating the distal metastasis according to the relative expression quantity of the LINC 01871: the risk of distal metastasis of the colon cancer patient to be detected with the relative expression quantity of LINC01871 less than or equal to 4.69 is greater than or is more than the candidate colon cancer patient to be detected with the relative expression quantity of LINC01871 more than 4.69.
It is also possible to distinguish between distant metastatic patients of colon cancer and non-metastatic patients of colon cancer as follows: extracting RNA of a cancer focus tissue of a colon cancer patient to be detected, and performing reverse transcription to obtain cDNA; taking cDNA as a template, and performing RT-PCR amplification by adopting DNA molecules shown in a sequence 1 and DNA molecules shown in a sequence 2 to obtain an amplification product; calculating the relative expression quantity of the LINC01871 of the colon cancer patient to be detected according to the Ct value of the amplification product, and distinguishing the distal metastatic colon cancer patient from the non-metastatic colon cancer patient according to the relative expression quantity of the LINC01871 of the colon cancer patient to be detected: and if the relative expression quantity of the LINC01871 in the cancer focus tissue of the colon cancer patient to be detected is less than or equal to 4.69, determining that the colon cancer patient to be detected is or is a candidate for the distal cancer metastasis patient, and if the relative expression quantity of the LINC01871 in the cancer focus tissue of the colon cancer patient to be detected is more than 4.69, determining that the colon cancer patient to be detected is or is a candidate for the non-metastasis patient. The colon cancer non-metastatic patient is a colon cancer patient who has not developed any distant metastasis.
4) Correlation analysis of LINC01871 expression level and incidence rate of distal metastasis of colon cancer patient
According to the relative expression amount detection results of LINC01871 of 46 colon cancer patients, the patient with the relative expression amount less than or equal to 5.41 is defined as the colon cancer patient with the LINC01871 low expression group, and the patient with the relative expression amount more than 5.41 is defined as the colon cancer patient with the LINC01871 high expression group. Then, the relative expression level detection results and clinical indexes of LINC01871 of 46 colon cancer patients are subjected to single factor analysis (Table 4), and the results show that: the incidence of distant metastasis was higher in colon cancer patients with the low-expression LINC01871 group (6/23).
TABLE 4 Single factor analysis
Note: statistically significant differences, P < 0.01.
In practical application, the incidence of distant metastasis of a colon cancer patient can be predicted according to the following method: taking cancer focus tissues of a to-be-detected population consisting of a plurality of colon cancer patients as samples, determining the relative expression level of LINC01871 in each sample, then arranging and halving the to-be-detected population according to the sequence of the relative expression levels of LINC01871 from low to high, taking 1/2 with low expression level as a LINC01871 low expression group, taking the rest 1/2 of to-be-detected population as a LINC01871 high expression group, and predicting the incidence rate of distal metastasis of the colon cancer patients from the to-be-detected population according to the following standards: the incidence of distant metastasis from the colorectal cancer patients in the LINC01871 low expression group is higher or is more candidate than that from the colorectal cancer patients in the LINC01871 high expression group.
The present invention has been described in detail above. It will be apparent to those skilled in the art that the invention can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the invention and without undue experimentation. While the invention has been described with reference to specific embodiments, it will be appreciated that the invention can be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains. The use of some of the essential features is possible within the scope of the claims attached below.
Sequence listing
<110> Beijing university Hospital
<120> colorectal cancer distal metastasis specific long-chain non-coding RNA marker LINC01871 and detection kit thereof
<160> 5
<170> SIPOSequenceListing 1.0
<210> 1
<211> 19
<212> DNA
<213> Artificial Sequence
<400> 1
gtcacactac caaaggccg 19
<210> 2
<211> 20
<212> DNA
<213> Artificial Sequence
<400> 2
<210> 3
<211> 20
<212> DNA
<213> Artificial Sequence
<400> 3
<210> 4
<211> 20
<212> DNA
<213> Artificial Sequence
<400> 4
<210> 5
<211> 240
<212> DNA
<213> Artificial Sequence
<400> 5
tcataagatg gggacgttaa gcatgcagca actacagtca tttgttctca gaggtctgga 60
ccaaagagaa acaagaaaag ctggagtcac actaccaaag gccgaagctg agcaacagag 120
ctctggagtc agctgcctgg gttcagcatg cagcgctgcc gtggacgatc tgtctctctt 180
gcatatatga cttaccagtt ttactttcag tctctccatt tctaattaaa tgagatgcag 240
Claims (7)
1. The application of the substance for detecting the expression level of LINC01871 in any one of the following (a 1) - (a 5):
(a1) preparing a product for screening or assisting in diagnosing colorectal cancer distant metastasis;
(a2) preparing a product for judging or assisting in judging whether the colorectal cancer patient to be detected is a colorectal cancer far-end metastasis patient;
(a3) preparing a product for predicting the risk of developing distant metastasis in a colorectal cancer patient;
(a4) preparing a product for differentiating between patients with distal metastasis of colorectal cancer and patients with non-metastasis of colorectal cancer;
(a5) preparing a product for predicting the incidence of distant metastasis in a patient with colorectal cancer;
the distant metastasis is hepatic metastasis;
the nucleotide sequence of the LINC01871 is shown as a sequence 5 in a sequence table.
2. Use according to claim 1, characterized in that: the substance for detecting the expression quantity of the LINC01871 is a reagent and/or an instrument for detecting the relative expression quantity of the LINC 01871.
3. Use according to claim 2, characterized in that: the reagent for detecting the relative expression quantity of the LINC01871 comprises an LINC01871 amplification primer; the LINC01871 amplification primer consists of a single-stranded DNA molecule shown in a sequence 1 in a sequence table and a single-stranded DNA molecule shown in a sequence 2 in the sequence table.
4. A system, which comprises a data processing device and a substance for detecting the expression amount of LINC 01871; the function of the system is any one of the following (b 1) - (b 5):
(b1) screening or aiding diagnosis of colorectal cancer distant metastasis;
(b2) judging or assisting to judge whether the colorectal cancer patient to be detected is a colorectal cancer far-end metastasis patient;
(b3) predicting the risk of developing distant metastasis in a colorectal cancer patient;
(b4) differentiating between patients with distal metastasis of colorectal cancer and non-metastatic patients;
(b5) predicting the incidence of distant metastasis in colorectal cancer patients;
the data processing device consists of a data input module, a data recording module, a data comparison module and a conclusion output module;
the data input module is configured to input a relative expression quantity value of LINC01871 in the cancer focus tissue of the colorectal cancer patient to be detected;
the data recording module is configured to store a relative expression quantity value and a judgment threshold value of LINC01871 in cancer focus tissues of a colorectal cancer patient to be detected;
the data comparison module is configured to receive the relative expression quantity value of the LINC01871 in the cancer focus tissue of the colorectal cancer patient to be detected, which is sent by the data input module, and call the judgment threshold value from the data recording module to compare with the relative expression quantity value of the LINC01871 in the cancer focus tissue of the colorectal cancer patient to be detected;
the conclusion output module is configured to receive the comparison result sent by the data comparison module and judge the comparison result according to a preset judgment condition;
the predetermined determination condition is as follows: if the relative expression quantity value of LINC01871 in the cancer focus tissue of the colorectal cancer patient to be detected is less than or equal to 4.69, determining that the colorectal cancer patient to be detected is or is selected as a colorectal cancer far-end metastasis patient; if the relative expression quantity value of LINC01871 in the cancer focus tissue of the colorectal cancer patient to be detected is more than 4.69, the colorectal cancer patient to be detected is not or is not a candidate for being the colorectal cancer remote metastasis patient;
the distant metastasis is hepatic metastasis;
the nucleotide sequence of the LINC01871 is shown as a sequence 5 in a sequence table.
5. The system of claim 4, wherein: the substance for detecting the expression quantity of the LINC01871 is a reagent and/or an instrument for detecting the relative expression quantity of the LINC 01871.
6. The system of claim 5, wherein: the reagent for detecting the relative expression quantity of the LINC01871 comprises an LINC01871 amplification primer; the LINC01871 amplification primer consists of a single-stranded DNA molecule shown in a sequence 1 in a sequence table and a single-stranded DNA molecule shown in a sequence 2 in the sequence table.
Use of LINC01871 as a marker in any of the following (a 1) - (a 5):
(a1) preparing a product for screening or assisting in diagnosing colorectal cancer distant metastasis;
(a2) preparing a product for judging or assisting in judging whether the colorectal cancer patient to be detected is a colorectal cancer far-end metastasis patient;
(a3) preparing a product for predicting the risk of developing distant metastasis in a colorectal cancer patient;
(a4) preparing a product for differentiating between patients with distal metastasis of colorectal cancer and patients with non-metastasis of colorectal cancer;
(a5) preparing a product for predicting the incidence of distant metastasis in a patient with colorectal cancer;
the distant metastasis is hepatic metastasis;
the nucleotide sequence of the LINC01871 is shown as a sequence 5 in a sequence table.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111657296.0A CN113999918B (en) | 2021-12-31 | 2021-12-31 | Colorectal cancer distal metastasis specific long-chain non-coding RNA marker LINC01871 and detection kit thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111657296.0A CN113999918B (en) | 2021-12-31 | 2021-12-31 | Colorectal cancer distal metastasis specific long-chain non-coding RNA marker LINC01871 and detection kit thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113999918A CN113999918A (en) | 2022-02-01 |
| CN113999918B true CN113999918B (en) | 2022-04-08 |
Family
ID=79932425
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111657296.0A Active CN113999918B (en) | 2021-12-31 | 2021-12-31 | Colorectal cancer distal metastasis specific long-chain non-coding RNA marker LINC01871 and detection kit thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113999918B (en) |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR102459214B1 (en) * | 2020-05-27 | 2022-10-26 | 연세대학교 산학협력단 | Composition for prediction prognosis of cancer and kit comprising the same |
| KR102482601B1 (en) * | 2020-05-27 | 2022-12-29 | 연세대학교 산학협력단 | Composition for preventing or treating cancer |
-
2021
- 2021-12-31 CN CN202111657296.0A patent/CN113999918B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN113999918A (en) | 2022-02-01 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Chiang et al. | Focal gains of VEGFA and molecular classification of hepatocellular carcinoma | |
| Warton et al. | Methylation of cell-free circulating DNA in the diagnosis of cancer | |
| Li et al. | Serum circulating human mRNA profiling and its utility for oral cancer detection | |
| Xu et al. | Pan-cancer transcriptome analysis reveals a gene expression signature for the identification of tumor tissue origin | |
| WO2019068082A1 (en) | Dna methylation biomarkers for cancer diagnosing | |
| EP3034624A1 (en) | Method for the prognosis of hepatocellular carcinoma | |
| JP2010538658A (en) | Prostate cancer biomarker | |
| CN113785076A (en) | Methods and compositions for predicting cancer prognosis | |
| WO2015073949A1 (en) | Method of subtyping high-grade bladder cancer and uses thereof | |
| CN112992354A (en) | Method and system for assessing colorectal cancer metastasis and recurrence risk and dynamically monitoring based on methyl marker combination | |
| WO2020020072A1 (en) | Methylation modification-based tumor marker stamp-ep2 | |
| EP2966183B1 (en) | Method for obtaining information on lung cancer, and use of marker and determination device for obtaining information on lung cancer | |
| JP2024020392A (en) | Composition for diagnosing liver cancer using CPG methylation changes in specific genes and its use | |
| Fassan et al. | Circulating microRNA expression profiling revealed miR-92a-3p as a novel biomarker of Barrett’s carcinogenesis | |
| CN113444798A (en) | Renal cancer survival risk biomarker group, diagnosis product and application | |
| Sin et al. | Down‐regulation of TROP‐2 Predicts Poor Prognosis of Hepatocellular Carcinoma Patients | |
| Rahmatallah et al. | Platform-independent gene expression signature differentiates sessile serrated adenomas/polyps and hyperplastic polyps of the colon | |
| CN113999918B (en) | Colorectal cancer distal metastasis specific long-chain non-coding RNA marker LINC01871 and detection kit thereof | |
| CN114015782B (en) | Colorectal cancer distal metastasis specific long-chain non-coding RNA marker AP002498.1 and detection kit thereof | |
| Wilmott et al. | Tumour procurement, DNA extraction, coverage analysis and optimisation of mutation-detection algorithms for human melanoma genomes | |
| WO2009123990A1 (en) | Cancer risk biomarker | |
| CN113444799A (en) | Immune-related genes for identifying poor prognosis of renal cancer | |
| CN113444801A (en) | Kidney cancer prognosis detection marker and related diagnosis product thereof | |
| CN113388684A (en) | Use of biomarkers for predicting the prognosis of renal cancer | |
| US20210324476A1 (en) | Compositions and methods for identifying cancer |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |