CN113999271B

CN113999271B - Simple method for extracting 5' -cytidylic acid from microbial fermentation broth

Info

Publication number: CN113999271B
Application number: CN202111282272.1A
Authority: CN
Inventors: 于广; 张玮琪; 张飞龙; 陈礼伟; 张剑
Original assignee: Jiangsu Xiangdi Chemical Co ltd
Current assignee: Jiangsu Xiangdi Chemical Co ltd
Priority date: 2021-11-01
Filing date: 2021-11-01
Publication date: 2023-03-14
Anticipated expiration: 2041-11-01
Also published as: CN113999271A

Abstract

The invention discloses a method for extracting 5' -cytidylic acid from microbial fermentation liquor, belonging to the technical field of biochemical separation. The invention comprises the following steps: (1) inactivating the fermentation liquor of 5' -cytidylic acid at high temperature; (2) adjusting the pH value to 5.0-6.0, and filtering by a ceramic membrane; (3) decompression concentration, active carbon decolorization, (4) PH regulation to 2.0-4.0 isoelectric point precipitation; (4) dripping alcoholic solution, precipitating with alcohol, crystallizing, centrifuging, rinsing, and vacuum drying to obtain 5' -cytidylic acid product with content of more than 98%.

Description

Simple method for extracting 5' -cytidylic acid from microbial fermentation broth

Technical Field

A simple method for extracting 5' -cytidylic acid from microbial fermentation broth belongs to the technical field of biochemical separation.

Background

5' -cytidine acid is an important biochemical substance in biological cells and participates in various physiological and biochemical reactions. In industry, 5' -cytidine is mainly used for manufacturing drugs such as citicoline, cytidine triphosphate, cytarabine, polyinosinic. In recent years, the composition can also be added into milk powder with other nucleotide to enhance the immunity of infants.

The 5' -cytidylic acid is mainly produced by the following modes: RNA (ribonucleic acid) degradation, chemical synthesis, enzymatic synthesis and biological fermentation. Referring to FIG. 7, four products can be obtained at a time by RNA degradation, but three other products except 5' -cytidylic acid become side products. Because of the limitation of RNA source, the separation operation in the production process is complex and the yield is low. At present, a chemical method is mainly used for industrially synthesizing 5' -cytidylic acid, and the method has the main defects of high raw material cost, more three wastes, equipment corrosion and no harm to the health of personnel and industrial production. At present, enzyme catalysis and biological fermentation methods are reported less, and corresponding post-treatment methods are more rarely reported.

The 5 '-cytidylic acid in the invention is mainly derived from fermentation broth of microorganism, for example, escherichia coli is genetically modified to make escherichia coli use glycerol and glucose as carbon sources, and the fermentation broth of microorganism containing 5' -cytidylic acid is obtained by fermentation technology, wherein the fermentation broth contains a large amount of hypha, pigment, macromolecular protein, a small amount of inorganic salt, unconsumed glucose and glycerol, lactamic acid generated by metabolism, uridine, uracil and impurities generated by bacterial autolysis. The fermentation liquor has more components and is difficult to separate.

Disclosure of Invention

Aiming at the problems of more impurities in fermentation liquor of 5 '-cytidylic acid, complex operation, lower separation degree, low yield and the like of the conventional extraction method, the invention aims to design a 5' -cytidylic acid separation and purification scheme with simple separation process, high separation degree, high yield and low production cost. The invention separates 5' -cytidylic acid by a simple separation method, realizes green production and has the advantages of high product yield, high quality and the like.

The technical idea of the invention is as follows: comparing the difference of physicochemical properties of 5 '-cytidylic acid and impurities in the fermentation liquor, designing the following steps to extract the 5' -cytidylic acid from the fermentation liquor:

(1) inactivating microorganisms in the microorganism fermentation liquor by a heating sterilization mode;

(2) adjusting the pH value to 5.0-6.0 to ensure that the 5' -cytidylic acid keeps stable structure and is fully dissolved in the fermentation broth, and filtering macromolecular impurities (thallus macromolecular proteins, macromolecular pigments and other macromolecular impurities) by a ceramic membrane; 5' -Cytosic acid is now present in filtrate A;

(3) concentrating the filtrate A under reduced pressure until the concentration of cytidylic acid in the aqueous solution is 10-50%, and adsorbing and removing residual pigment and impurities by using activated carbon;

(4) adjusting the pH value to 2.0-4.0 near the isoelectric point to gradually separate out 5' -cytidylic acid;

(5) the alcohol crystallization is used, so that the 5 '-cytidylic acid can be separated out as much as possible, soluble impurities can be removed, and meanwhile, the dispersion degree of the 5' -cytidylic acid crystals can be increased, and the impurities are prevented from being wrapped and entrained.

Specifically, the invention adopts the following technical scheme:

the invention aims to provide a simple method for extracting 5' -cytidylic acid from microbial fermentation liquor, which comprises the following steps of:

(1) heating and sterilizing;

(2) adjusting the pH value to 5.0-6.0, and filtering by a ceramic membrane to obtain a filtrate A;

(3) concentrating under reduced pressure, and decolorizing with active carbon to obtain decolorized solution;

(4) regulating the pH of the destaining solution to 2.0-4.0, and gradually separating out 5' -cytidylic acid;

(5) and (4) dripping an alcohol organic solvent into the system obtained in the step (4) for crystallization, centrifuging, rinsing and vacuum drying to obtain a finished product of 5' -cytidylic acid.

As one embodiment of the invention, the sterilization temperature in the step (1) is 60-100 ℃, and the sterilization time is 30-60 min.

In one embodiment of the present invention, the molecular weight cut-off of the ceramic membrane in step (2) is 1000 to 5000 daltons.

As one embodiment of the present invention, the reduced pressure concentration condition of the step (3): the concentration temperature is 50-70 ℃, the vacuum degree is-0.1 MPa to-0.08 MPa, and the concentration is carried out until the concentration of the cytidylic acid is 10-50 percent. Under the reduced pressure concentration condition, the degradation of 5' -cytidylic acid can be reduced by controlling the lower concentration temperature.

In one embodiment of the present invention, the volume of the alcohol organic solvent in the step (5) is 2 to 8 times of the volume of the decolorized solution.

As one embodiment of the present invention, the alcoholic organic solvent in the step (5) includes any one of methanol, ethanol, isopropanol and an aqueous solution thereof.

As one embodiment of the present invention, the crystallization temperature in the step (5) is 0 to 25 ℃ and the crystallization time is 1 to 12 hours.

In one embodiment of the present invention, the microbial fermentation broth mainly contains 5' -cytidylic acid, microbial threads, pigments, protein substances, inorganic salts, glucose, glycerol, orotic acid, uridine, uracil and impurities generated by microbial cell autolysis.

As one embodiment of the invention, the method is to subject the microorganism fermentation liquor to the following steps in sequence:

(1) heating the microbial fermentation liquor containing 5' -cytidylic acid to 60-100 ℃ for sterilization, wherein the sterilization time is 30-60 min; the operation is simple, the condition is mild, and the realization is easy;

(2) adjusting the pH value to 5.0-6.0, then filtering by a ceramic membrane, and filtering by adopting the ceramic membrane with the molecular weight cutoff of 1000-5000 daltons, wherein thalli and most impurities can be completely intercepted at one time, so that relatively pure 5' -cytidylic acid can be obtained;

(3) by controlling the parameters of the reduced pressure concentration: the temperature is 50-70 ℃, the vacuum degree is-0.1 MPa to-0.08MPa, the pH is 5.0-6.0, the stability of the 5' -cytidylic acid is high under the concentration condition, and the degradation condition can not occur basically; adsorbing with activated carbon to remove impurities and decolorize to obtain decolorized solution;

(4) the pH of the destaining solution is adjusted to be near the isoelectric point of 5' -cytidylic acid (the pH is about 2.0-4.0), 5' -cytidylic acid is gradually separated out near the isoelectric point, the separation of 5' -cytidylic acid and other trace impurities is facilitated, simultaneously, separated microcrystals can be used as crystal nuclei of subsequent alcohol crystallization, and the crystallization efficiency of the subsequent alcohol crystallization is improved;

(5) slowly dripping ethanol solution into the system obtained in the step (4), gradually separating out 5' -cytidylic acid, controlling the temperature to be 0-25 ℃, and controlling the dripping time to be 60-180 min; after dripping, keeping the temperature at 0-25 ℃ and crystallizing for 1-12 h; then centrifugally filtering, rinsing the crystals by using 40-80% ethanol solution to replace entrained mother liquor, and distilling the crystallized mother liquor to recover ethanol. The filter cake (crystal) is dried to obtain the pure product 5' -cytidylic acid with the content of more than 98 percent.

The invention has the following beneficial effects:

the invention can obtain 5' -cytidylic acid with higher content by a simple separation process, avoids using ion exchange resin, and avoids producing a large amount of waste water in the links of resin activation, column feeding, elution and the like. The content of the 5' -cytidylic acid prepared by the method can reach more than 98 percent, the yield can reach more than 75 percent, and the production process is green and environment-friendly.

Drawings

FIG. 1 shows the construction concept of recombinant E.coli, (A): gene ushA knockout, udk gene overexpression, (B): gene ushA knock-out, gene ppnN knock-out, udk gene overexpression, (C): recombinant plasmid pRSFDuet-1-udk for overexpression of the udk gene;

fig. 2 (a): PCR verification of ushA knockout colonies; (B): PCR verification map of the ppnN knockout colony;

FIG. 3 is a SDS-PAGE picture of udk gene overexpression;

FIG. 4 is a graph showing the comparison of the production of 5' -cytidylic acid by the strains.

FIG. 5 is an HPLC chart showing the production of 5' -cytidylic acid by recombinant strains of Δ ushA/Δ ppnN + OE _ udk of the strain in which ppnN and ushA genes are knocked out and the uridine kinase gene udk is overexpressed.

FIG. 6 is a schematic diagram of the process for extracting 5' -cytidylic acid from the fermentation broth of a microorganism according to the present invention;

FIG. 7 is a schematic diagram of a process for extracting 5' -cytidylic acid by RNA degradation.

Detailed Description

HPLC detection conditions for cytidylic acid: liquid chromatograph shimadzu 10A, column: INERTSIL ODS-SP 5 μm4.6 × 250mm, mobile phase: preparing a buffer solution: 0.1mol/L potassium dihydrogenphosphate aqueous solution: 0.01mol/L tetrabutylammonium hydroxide: methanol =95:95:10, then the pH is adjusted to 4.5 with phosphoric acid, wavelength: 276nm, flow rate: 1.0mL/min.

Preparation of microbial fermentation broth containing 5' -cytidylic acid:

preparation example 1: construction method of recombinant escherichia coli for producing 5' -cytidylic acid

The invention adopts gene knockout technology to knock out the gene ushA of the monophosphate pyrophosphorylase on the genome of escherichia coli, cuts off the path for producing 5' -cytidine by catalyzing 5' -cytidylic acid, and leads the 5' -cytidylic acid to be accumulated; knocking out nucleotide 5' -monophosphate nucleotidase gene ppnN on the genome of the escherichia coli by adopting a gene knockout technology, cutting off a path for producing cytosine by catalyzing 5' -cytidine, and accumulating the 5' -cytidine; and over-expressing uridine kinase gene udk, enhancing the transformation from 5 '-cytidine to 5' -cytidylic acid, efficiently producing 5 '-cytidylic acid (5' -CMP), and promoting the application thereof in the fields of medicine and the like.

The invention provides a recombinant bacterium for producing 5 '-cytidylic acid, which is characterized in that a cytidine monophosphate pyrophosphorylase gene ushA and a nucleotide 5' -monophosphate nucleotidase gene ppnN on a genome of escherichia coli or bacillus subtilis are knocked out, and a uridine kinase gene udk is overexpressed to realize high-efficiency production of 5 '-cytidylic acid (5' -CMP).

Further, the escherichia coli is selected from: DH5 α, BL21 (DE 3), JM109, HB101; the bacillus subtilis is selected from: WB600 and WB800.

Furthermore, the recombinant bacterium is preferably recombinant Escherichia coli BL21 (DE 3).

Furthermore, when the uridine kinase gene udk is over-expressed, the recombinant bacteria adopt plasmids pET22b, pET28a or pRSFDuet-1 and the like for free expression, or integrate the uridine kinase gene udk into the genome of escherichia coli for integrated expression.

The invention also provides a method for producing 5' -cytidylic acid by applying the recombinant strain, which comprises the steps of inoculating the recombinant strain into an LB culture medium containing kanamycin to culture so as to obtain a seed solution; transferring the seed liquid into a fermentation culture medium, performing fermentation culture at 30-42 ℃ and 100-300rpm, correlating dissolved oxygen supplementation, supplementing when the dissolved oxygen is higher than 20-50%, and controlling pH to be neutral by adopting ammonia water; when the fermentation is carried out until the bacterial concentration OD600 reaches 15-28, an inducer IPTG is added for induction, and the culture temperature is reduced to 33 ℃.

Further, the recombinant strain is inoculated into LB culture medium containing kanamycin and cultivated to obtain seed liquid, the seed liquid is transferred into fermentation culture medium containing kanamycin according to the inoculation amount of 6%, fermentation culture is carried out under the conditions of 37 ℃ and 200rpm, and the initial liquid loading amount of a 30L fermentation tank is 13L; in the fermentation process, the dissolved oxygen is supplemented, when the dissolved oxygen is higher than 35%, the supplement is carried out, and ammonia water is adopted to control the pH value to be 7.0; when the fermentation is carried out until the bacterial concentration OD600 reaches 15-28, an inducer IPTG with the final concentration of 0.6mM is added for induction, and the culture temperature is reduced to 33 ℃.

Further, the fermentation medium is: 30g/L of glycerol, 8mg/L of ferric chloride, 1g/L of MgSO4, 8mg/L of sodium citrate, 150mg/L of calcium chloride, 3g/L of disodium hydrogen phosphate, 3.0g/L of sodium dihydrogen phosphate, 20mg/L of zinc chloride, 6g/L of yeast powder, 5g/L of peptone and 10mL of trace element solution; wherein the microelement solution contains 21g/L of copper chloride, 18g/L of zinc sulfate and 25g/L of sodium molybdate.

Further, the feed medium was: 600g/L of glycerol, 6g/L of peptone and 6g/L of yeast powder.

(1) Construction of recombinant plasmid pRSFDuet-udk for overexpression of uridine kinase Gene

Primers udk-FW CATGCCCATGGGCACTGATCAGTCTCATCAGTG (SEQ ID NO: 7) and udk-RS CGGGATCCTTATCAAAGAACTGACTT (SEQ ID NO: 8) are adopted, and Escherichia coli genome is used as a template to carry out PCR amplification to obtain an udk target fragment (a nucleotide sequence is shown as SEQ ID NO:5, and an amino acid sequence of an encoded enzyme is shown as SEQ ID NO: 6). Conditions for PCR amplification: pre-denaturation at 98 deg.C for 5min; denaturation at 95 ℃ for 30s; annealing at 55 ℃ for 30s; extending at 72 ℃ for 1min; setting for 29 times of circulation; extending for 10min at 72 ℃; finally, the temperature is kept at 16 ℃. PCR amplification System: 5 XPS buffer 20. Mu.L, dNTP 10. Mu.L, upstream/downstream primer (10. Mu. Mol. L) ^-1 ) 2. Mu.L, template 1. Mu.L, enzyme 1. Mu.L, water 66. Mu.L. The udk gene fragment obtained by PCR and the pRSFDuet-1 plasmid were digested with restriction enzymes Nco I and BamH I. The enzyme-digested udk gene fragment and pRSFDuet-1 plasmid are connected by using ligase, escherichia coli JM109 is transformed, an LB plate is coated for screening to obtain a positive clone, the plasmid is extracted for gene sequencing verification, and the obtained recombinant plasmid pRSFDuet-1-udk (figure 1C) is constructed.

(2) Knock-out cytidine monophosphate pyrophosphorylase gene ushA

By means of gene knockout, cytidine monophosphate pyrophosphorylase gene ushA (the nucleotide sequence is shown as SEQ ID NO:1, and the amino acid sequence of the encoded enzyme is shown as SEQ ID NO: 2) on the genome of Escherichia coli BL21 (DE 3) is knocked out, and a recombinant strain capable of efficiently accumulating 5' -cytidylic acid is constructed.

Specifically, the primers are adopted: Δ ushA-1-FW ATATATGGTGAATTGGTCTGG (SEQ ID NO: 9); Δ ushA-1-RS CTAGAAAGTATAGGAACTTCGGGTCGCCGCGATAATAATG (SEQ ID NO: 10); Δ ushA-2-FW TTCTAGAGAATACTTCTGGATTGTGCAGGCGCATGA (SEQ ID NO: 11); delta ushA-2-RS ATTGATTACTTGCGCGCCGT (SEQ ID NO: 12), using Escherichia coli genome as template, obtaining the cytidine monophosphate pyrophosphate knockout by fusion PCR technologyA knock-out frame of the chemolase gene ushA (. DELTA.ushA). Adopting a primer Sg-ushA-FW GTCCTAGGTAATAATACTAGTCTGCATACCAATGATCAGTTTTAGAGCTAGTAAATAGC (SEQ ID NO: 13); pTarget-RS CGGACTAGTATTATACCTAGGACTGAGC (SEQ ID NO: 14), and a recombinant plasmid pTarget containing a guide RNA was constructed. Conditions for PCR amplification: pre-denaturation at 98 deg.C for 5min; denaturation at 95 ℃ for 30s; annealing at 55 ℃ for 30s; extension 72 ℃ (the extension speed of the enzyme is 1kb/min, and the specific time is set according to the length of the amplified fragment); setting and circulating for 30 times; extending for 10min at 72 ℃; finally, the temperature is kept at 16 ℃. PCR amplification System: 5 XPS buffer 20. Mu.L, dNTP 10. Mu.L, upstream/downstream primer (10. Mu. Mol. L) ^-1 ) 2. Mu.L, template 1. Mu.L, enzyme 1. Mu.L, water 66. Mu.L. The plasmid pCas is transformed into Escherichia coli BL21 (DE 3), and a recombinant Escherichia coli strain is obtained by screening on a resistant plate. pTarget and knockout frame. DELTA.ushA were electrotransformed into recombinant E.coli strains containing plasmid pCas and selected on resistant plates containing bleomycin and kanamycin. The single colony obtained was subjected to colony PCR verification using primers. DELTA.ushA-1-FW: ATATATGGTGAATTGGTCTGG (SEQ ID NO: 15) and. DELTA.ushA-2-RS: ATTGATTACTTGCGCCGT (SEQ ID NO: 16), and as can be seen from the electrophoretogram (FIG. 2A), the bands obtained by PCR of E.coli A1- (1) (. DELTA.ushA) and A1- (2) (. DELTA.ushA) obtained by screening were smaller than those of the control strain, indicating that the cytidine monophosphate pyrophosphorylase gene ushA has been knocked out, and the sequence was sent to the sequencer for correct sequencing verification.

Activating the constructed strain A1- (1) by adopting an LB (LB) culture medium, inoculating a fermentation culture medium for fermentation culture, and measuring the content of 5' -cytidylic acid by adopting an HPLC (high performance liquid chromatography) method. The fermentation medium is as follows: 30g/L of glycerol, 8mg/L of ferric chloride and MgSO ₄ 1g/L, 8mg/L sodium citrate, 150mg/L calcium chloride, 3g/L disodium hydrogen phosphate, 3.0g/L sodium dihydrogen phosphate, 20mg/L zinc chloride, 6g/L yeast powder, 5g/L peptone, 10mL trace elements (containing 21g/L copper chloride, 18g/L zinc sulfate, 25g/L sodium molybdate. Supplemented medium: 600g/L glycerol, 6g/L peptone, 6g/L yeast powder. The culture method comprises inoculating the strain into LB medium containing kanamycin, culturing at 37 deg.C and 200rpm for 8h, transferring the seed solution in the LB medium to the fermentation medium containing kanamycin according to 6% inoculation amount (30L fermentation tank, initial liquid loading amount is 13L) were cultured at 37 ℃ and 200rpm in conjunction with dissolved oxygen feeding, feeding being carried out when the dissolved oxygen was higher than 35%. The pH was controlled to 7.0 with ammonia. Fermenting to bacterial concentration OD ₆₀₀ When 15 to 28 ℃ was reached, the induction was carried out by adding IPTG (final concentration of 0.6 mM) as an inducer, and the culture temperature was lowered to 33 ℃. After the fermentation is finished, the thalli are removed by centrifugation, the supernatant fluid is taken, and the content of the 5' -cytidylic acid in the supernatant fluid is measured by HPLC. The control strain without the ushA gene knockout was found to have almost no detectable 5' -cytidylic acid content by measurement; a1- (1) (. DELTA.ushA) strain in which the ushA gene was deleted exhibited a 5' -cytidylic acid content of 0.4g/L (FIG. 4).

(3) Based on the deletion of cytidine monophosphate pyrophosphorylase gene ushA, ppnN is further deleted

On the basis of the cytidine monophosphate pyrophosphorylase gene ushA knock-out strain constructed in the step (2), continuously knocking out nucleotide 5 '-monophosphate nucleotidase ppnN (the nucleotide sequence is shown as SEQ ID NO:3, and the amino acid sequence of the coded enzyme is shown as SEQ ID NO: 4) on the genome of the escherichia coli by adopting a gene knock-out means, and constructing a recombinant strain capable of efficiently accumulating 5' -cytidylic acid.

Specifically, the primers are adopted: Δ ppnN-1-FW TGGATATGCTTAAACGCACCGC (SEQ ID NO: 17); Δ ppnN-1-RS AGGATCAATGGTAAAACCTGAGCTCACGCAGGCCCAGCTG (SEQ ID NO: 18); Δ ppnN-2-FW CAGCTGGGCCTGCGTGAGCTCAGGTTTTTACATTGATCCT (SEQ ID NO: 19); delta ppnN-2-RS CGTGCAGATTTCGTAGCAAGGGA (SEQ ID NO: 20), a knock-out frame delta ppnN for knocking out the cytidine monophosphate pyrophosphorylase gene ppnN is obtained by using an escherichia coli genome as a template through a fusion PCR technology. Adopting a primer Sg-ppnN-FW GTCCTAGGTAATAATACTAGTCTGCATACCAATGATCAGTTTTAGAGCTAGAATAGC (SEQ ID NO: 21); pTarget-RS CGGACTAGTATTATACCTAGGACTGAGC (SEQ ID NO: 22), and a recombinant plasmid pTarget containing a guide RNA was constructed. Conditions for PCR amplification: performing pre-denaturation at 98 ℃ for 5min; denaturation at 95 ℃ for 30s; annealing at 55 ℃ for 30s; extension 72 ℃ (the extension speed of the enzyme is 1kb/min, and the specific time is set according to the length of the amplified fragment); setting and circulating for 30 times; extending for 10min at 72 ℃; finally, the temperature is kept at 16 ℃. PCR amplification System: 5 XPS buffer 20. Mu.L, dNTP 10. Mu.L, upstream/downstream primer (10. Mu. Mol. L) ^-1 ) 2. Mu.L, template 1. Mu.L, enzyme 1. Mu.L, water 66. Mu.L. The plasmid pCas was transformed into E.coli A1- (1) (Δ ushA), and the resulting plasmid was screened for resistance plates to obtain a recombinant E.coli strain. pTarget and the knockout box. DELTA. PpnN were electroporated into recombinant E.coli strains containing plasmid pCas and selected on resistant plates containing bleomycin and kanamycin. The obtained single colony is subjected to colony PCR verification by using primers delta ppnN-1-FW: GTGCTGGATTCACGCAGAAGAAGGTT (SEQ ID NO: 23) and delta ppnN-2-RS: CTGTGATGATTTGTCGCGTGAG (SEQ ID NO: 24), and the bands obtained by PCR of screened Escherichia coli B1- (1) (delta ushA/delta ppnN) and B1- (2) (delta ushA/delta ppnN) are smaller than those of a control strain as can be seen from an electrophoretogram (FIG. 2B), so that the cytidine monophosphate pyrophosphorylase gene ppnN is knocked out, and the sequence is sent to a sequencing company for sequencing verification to be correct.

Activating the constructed strain B1- (1) by adopting an LB culture medium, inoculating a fermentation culture medium for fermentation culture, and measuring the content of 5' -cytidylic acid by adopting an HPLC method. And (3) fermenting to produce 5' -cytidylic acid by adopting the fermentation culture medium and the culture conditions in the step (2). After the fermentation is finished, the thalli are centrifuged, and the supernatant is taken and the content of the 5' -cytidylic acid in the supernatant is measured by HPLC. By assay, it was found that the B1- (1) (Δ ushA/. DELTA.ppnN) strain in which the ppnN and ushA genes were knocked out could detect a 5' -cytidylic acid content of 1.6g/L (FIG. 4).

(4) Construction of recombinant E.coli Strain Δ ushA/Δ ppnN + OE _ udk

The recombinant plasmid pRSFDuet-udk constructed in the step (1) is transformed into a cytidine monophosphate pyrophosphorylase gene ushA knock-out Escherichia coli strain A1- (1) (delta ushA), and a positive clone of the recombinant Escherichia coli strain delta ushA + OE _ udk is obtained by coating LB plate screening (FIG. 1A).

The recombinant plasmid pRSFDuet-udk constructed in the step (1) was transformed into a cytidine monophosphate pyrophosphorylase gene ushA and nucleotide 5' -monophosphate nucleotidase gene ppnN double-knocked-out E.coli strain B1- (1) (Δ ushA/. DELTA.ppnN), and a positive clone recombinant E.coli strain Δ ushA/. DELTA.ppnN + OE _ udk was obtained by screening with LB plates (FIG. 1B).

And respectively carrying out shake flask fermentation culture on the constructed recombinant escherichia coli strains delta ushA + OE _ udk and delta ushA/delta ppnN + OE _ udk, and detecting the content of 5' -cytidylic acid by adopting HPLC. And (3) adopting the fermentation culture medium and culture conditions in the step (2) to carry out fermentation to produce the 5' -cytidylic acid. After the fermentation, the cells were centrifuged, and the supernatant was collected to determine the 5' -cytidylic acid content therein. After the fermentation is finished, the thalli are centrifuged, and the supernatant is taken to measure the content of the 5' -cytidylic acid in the supernatant.

It was found by measurement that the 5 '-cytidylic acid production amount of Δ ushA + OE _ udk of the strain whose ushA gene was knocked out while overexpressing the uridine kinase gene udk was significantly increased and the 5' -cytidylic acid content was 6.1g/L, as compared with the strain whose ushA gene was knocked out but did not overexpress the uridine kinase gene udk constructed in step (2) (FIG. 4). Meanwhile, compared to the B1- (1) (Δ ushA/Δ ppnN) strain constructed in step (3) in which the ppnN and ushA genes are knocked out but the uridine kinase gene udk is not excessively expressed, the strain Δ ushA/Δ ppnN + OE _ udk in which the ppnN and ushA genes are knocked out while the uridine kinase gene udk is excessively expressed has significantly increased production of 5 '-cytidylic acid, the 5' -cytidylic acid content may reach 31.8g/L, and the contents of uracil and guanosine impurities are very low (fig. 4, fig. 5).

Example 1

A simple method for extracting 5' -cytidylic acid from microbial fermentation broth comprises the following steps:

heating and sterilizing: preparing 5' -cytidylic acid-containing microbial fermentation broth in a 60L fermentation tank by adopting the method, after the 5' -cytidylic acid fermentation is finished, heating steam to 100 ℃, preserving heat for 30min, rapidly cooling to room temperature, and putting the fermentation tank to obtain 45L of 5' -cytidylic acid fermentation broth, wherein the concentration of 5' -cytidylic acid is 28.5g/L, and the total amount of 5' -cytidylic acid is 1282.5g.

Ceramic membrane filtration: the pH of the combined solution was adjusted to 5.5 with 20% lye. Filtering the 5' -cytidylic acid fermentation liquor subjected to heating sterilization treatment by a ceramic membrane with the molecular weight cutoff of 5000 daltons: the working pressure of the ceramic membrane is 0.5-0.8 MPa, when 5L of filter residue is left, the filter residue is washed twice by 5L of deionized water, the filtration is carried out, the filtrate and the washing liquid are combined, the content of 5' -cytidylic acid in the combined liquid is 1195g, and the yield is 93.18%.

Concentrating under reduced pressure, and decoloring by active carbon: then, the combined solution is concentrated under reduced pressure, the concentration temperature is controlled to be 55 ℃, the vacuum degree is controlled to be-0.098 MPa, the combined solution containing 5' -cytidylic acid and the pH value is 5.5, the combined solution is concentrated until the concentration of cytidylic acid is 30 percent, the weight of the concentrated solution is 3965g, and the yield is 99.54 percent. Adding 3.98g of activated carbon into the concentrated solution, heating to 45 ℃, keeping the temperature and stirring for 30min, filtering by a precision filter, rinsing the activated carbon by 70g of pure water, and combining the filtrates to obtain 4025g of decolorized solution.

Isoelectric point precipitation, namely controlling the temperature to be 25 ℃, dropwise adding 736g of 20 percent hydrochloric acid into the decolorized solution, adjusting the pH to be 2.5, keeping the temperature and stirring, keeping the weight to be 4761g, the concentration to be 24.74 percent, the yield to be 99.03 percent, and waiting for crystallization.

Alcohol crystallization: and (3) dropwise adding 95% ethanol into the decolored solution with the adjusted pH, controlling the dropwise adding temperature to be 20 ℃, wherein the dropwise adding time is 100min, dropwise adding 14285mL of 95% ethanol in total, keeping the temperature and stirring for 10h under the adjustment of 20 ℃ after the dropwise adding is finished, standing for 2h, starting centrifugation after the crystallization is finished, filtering, and rinsing the filter cake twice by 1000mL of 70% ethanol to obtain 1950g of a wet product. And (3) drying the wet product in vacuum: drying at 60 ℃ for 8h to obtain 1.5% water and 978g net weight, and 83% crystallization yield. The total extraction yield of the fermentation liquor 5 '-cytidine acid is 76.25%, and the content of 5' -cytidylic acid is 98.54% by HPLC detection.

Example 2

heating and sterilizing: preparing 5' -cytidylic acid-containing microbial fermentation broth in a 30-L fermentation tank by adopting the method, after the 5' -cytidylic acid fermentation is finished, heating steam to 75 ℃, preserving the heat for 30min, rapidly cooling to room temperature, and placing the fermentation tank to obtain 22.5L of 5' -cytidylic acid fermentation broth, wherein the concentration of 5' -cytidylic acid is 30.0g/L, and the total concentration of 5' -cytidylic acid is 675g.

Ceramic membrane filtration: the pH of the combined solution was adjusted to 5.5 with 20% lye. Filtering the 5' -cytidylic acid fermentation liquor subjected to heating sterilization treatment by a ceramic membrane with the molecular weight cutoff of 5000 daltons: the working pressure of the ceramic membrane is 0.5-0.8 MPa, when 5L of filter residue is left, the filter residue is washed twice by 5L of deionized water, the filtration is carried out, the filtrate and the washing liquid are combined, the content of 5' -cytidylic acid in the combined liquid is 635g, and the yield is 94.07%.

Decompression concentration and active carbon decoloration: then, the combined solution is concentrated under reduced pressure, the concentration temperature is controlled to be 55 ℃, the vacuum degree is controlled to be-0.098 MPa, the combined solution containing 5' -cytidylic acid and having the pH value of 5.5 is concentrated until the concentration of cytidylic acid is 30 percent, the concentrated solution weight is 2111.4g, and the yield is 99.75 percent. Adding 2.1g of activated carbon into the concentrated solution, heating to 45 ℃, keeping the temperature and stirring for 30min, filtering by a precision filter, rinsing the activated carbon by 30g of pure water, and combining the filtrates to obtain 2136.5g of decolorized solution.

Isoelectric point precipitation, namely controlling the temperature to be 25 ℃, dropwise adding 392.2g of 20 percent hydrochloric acid into the decolorized solution, adjusting the pH to be 2.5, keeping the temperature and stirring, keeping the weight to be 2528.7g, ensuring the concentration to be 24.86 percent, ensuring the yield to be 99.23 percent, and waiting for crystallization.

Alcohol crystallization: and (3) dropwise adding 95% ethanol into the decolored solution with the adjusted pH, controlling the dropwise adding temperature to be 20 ℃, keeping the dropwise adding temperature for 100min, dropwise adding 7586mL of 95% ethanol in total, keeping the temperature and stirring for 10h under the adjustment of 20 ℃ after the dropwise adding is finished, standing for 2h, beginning centrifugation after the crystallization is finished, filtering, and rinsing the filter cake twice by 500mL of 70% ethanol to obtain 1050g of a wet product. And (3) drying the wet product in vacuum: drying at 60 ℃ for 8h to obtain water content of 1.32%, net weight of 524.3g and crystallization yield of 83.4%. The total extraction yield of the fermentation liquid 5 '-cytidine acid is 77.67%, and the content of the 5' -cytidylic acid is 98.75% through HPLC detection.

The crystallization mother liquor is distilled to recover ethanol, and the residual 5' -cytidylic acid in the crystallization mother liquor can be recovered and reused by other technologies.

Comparative example 1 (omitting isoelectric precipitation step with respect to example 2)

Referring to example 2, the only difference is that the isoelectric precipitation step is omitted. I.e. the decolourised liquid is about 5.5 when the alcohol crystallizes.

And (3) drying the wet product in vacuum: the temperature is 60 ℃, the drying is carried out for 8h, the water content is 3.52 percent, the net weight is 65.6g, and the crystallization yield is 10.43 percent. The total extraction yield of the fermentation liquid of the 5 '-cytidine acid is 9.71 percent, and the content of the 5' -cytidylic acid is 93.4 percent through HPLC detection.

Comparative example 2 (omitting the alcohol crystallization step with respect to example 2)

Referring to example 2, the only difference is that the alcohol crystallization step is omitted and the isoelectric precipitation step is changed to: controlling the temperature to be 25 ℃, dropwise adding 392.2g of 20% hydrochloric acid into the decolorized solution, adjusting the pH to be 2.5, and stirring at the constant temperature until the weight is 2528.7g, the concentration is 24.86% and the yield is 99.23%. And (3) drying the wet product in vacuum: drying at 60 ℃ for 8h to obtain water content of 1.25 percent and net weight of 425.5g, and the crystallization yield is 67.68 percent. The total extraction yield of the fermentation liquor 5 '-cytidine acid is 63.03 percent, and the content of the 5' -cytidylic acid is 94.64 percent through HPLC detection.

And (4) conclusion: comparing example 2, comparative example 1 and comparative example 2, it can be seen that, based on the process steps of the present invention, if the isoelectric point precipitation step is omitted and alcohol crystallization is directly used, not only the yield of cytidylic acid is greatly reduced, but also the content of cytidylic acid obtained is low; if only isoelectric precipitation is used and alcohol crystallization is not used, the yield of cytidylic acid is obviously reduced, and the content of prepared cytidylic acid is also lower. Therefore, the isoelectric point precipitation step and the alcohol crystallization step are both indispensable and the advantages of the isoelectric point precipitation step and the alcohol crystallization are combined, so that the high-content and high-yield cytidine acid extraction can be realized.

Example 3 selection of pH in isoelectric precipitation step

Referring to example 2, the only difference is: the isoelectric point steps are adjusted to different pH values.

TABLE 1 Effect of pH selection in isoelectric precipitation step on Cytidine acid extraction

pH value	Net weight of cytidylic acid g	Water content%	Content%	The crystal yield%	The total yield is%
						1.5	445.2	1.44％	98.58％	70.70％	65.84％
2.0	501.6	1.62％	98.62％	79.68％	74.21％
						2.5	524.3	1.32％	98.75％	83.40％	77.67％
3.0	464.7	1.52％	97.52％	73.20％	67.98％
						3.5	361.1	2.49％	96.18％	55.95％	52.10％

And (4) conclusion: experiments compare the pH value of the isoelectric point, and experimental data show that the effect is best when the pH value is adjusted to 2.5, and when the pH value is lower than 2.5, the yield of the cytidylic acid is obviously reduced although the content of the cytidylic acid is not obviously changed; when the pH value is higher than 2.5, the content of cytidylic acid and the yield are obviously reduced.

Example 4 selection of molecular weight cut-offs in ceramic Membrane filtration step

Referring to example 2, the only difference is: different types of ceramic membranes were used for filtration.

TABLE 2 influence of the selection of the molecular weight cut-off of the ceramic membranes on the extraction of cytidine acid

And (4) conclusion: through selecting and using the ceramic membrane of different molecular weight entrapment to carry out the experiment contrast, the experiment finds that the content of the prepared cytidylic acid reduces along with the increase of the molecular weight entrapment, mainly because after the molecular weight entrapment becomes big, macromolecular protein will not be entrapped, because a large amount of protein is precipitated after denaturation in the isoelectric point precipitation and alcohol crystallization steps, thereby the content of the cytidylic acid is reduced greatly, so, when the entrapment of the ceramic membrane to the molecular weight is more than 5000 daltons, the protein, polypeptide, polysaccharide and other macromolecular impurities that permeate the ceramic membrane increase, and the content of the cytidylic acid obtained by the subsequent crystallization purification obviously reduces.

SEQUENCE LISTING

<110> Jiangsu Suxiangdi chemical Co., ltd

<120> simple method for extracting 5' -cytidylic acid from microbial fermentation liquor

<130> BAA211255A

<160> 24

<170> PatentIn version 3.3

<210> 1

<211> 1653

<212> DNA

<213> Escherichia coli

<400> 1

atgaaattat tgcagcgggg cgtggcgtta gcactgttaa ccacatttac actggcgagt 60

gaaactgctc tggcgtacga gcaggataaa acctacaaaa ttacagttct gcataccaat 120

gatcatcatg ggcatttttg gcgcaatgaa tatggtgaat atggtctggc ggagcaaaaa 180

acgctggtgg atggtatccg caaagaggtt gcggctgaag gcggtagcgt gctgctactt 240

tccggtggcg acattaacac tggcgtgccc gagtccgact tacaggatgc cgaacctgat 300

tttcgcggta tgaatctggt gggctatgac gcgatggcga tcggtaatca tgaatttgat 360

aacccgctca ccgtattacg ccagcaggaa aagtgggcta agttcccgtt gctttccgcc 420

aatatctacc agaaaagtac cggcgagcgc ctgtttaaac catgggcgct gtttaagcgt 480

caggatctga aaattgccgt tattggcctg acgacggatg acacagccaa aattggtaat 540

ccggaatatt tcactgatat cgaatttcgt aagcccgctg atgaagcgaa gctggtgatt 600

caggagctgc aacagacaga aaagccagac attattatcg cggcgaccca tatggggcat 660

tacgacaatg gtgagcacgg ctctaacgca ccgggcgatg tggagatggc acgcgcgctg 720

cctgccggat cgctggcgat gatcgtcggt ggtcactcgc aagatccggt ctgtatggcg 780

gcagaaaaca aaaaacaggt cgattacgtg ccgggtacgc catgcaaacc ggatcaacaa 840

aacggcatct ggattgtgca ggcgcatgag tggggcaaat acgtgggacg ggctgatttt 900

gagtttcgta atggcgaaat gaaaatggtt aactaccagc tgattccggt gaacctgaag 960

aagaaagtga cctgggaaga cgggaaaagc gagcgcgtgc tgtacacccc tgaaatcgct 1020

gaaaaccagc aaatgatctc gctgttatca ccgttccaga acaaaggtaa agcgcagctg 1080

gaagtgaaaa taggcgaaac caatggtcgt ctggaaggcg atcgtgacaa agtgcgtttt 1140

gtacagacca atatggggcg gttgattctg gcagcacaaa tggatcgcac tggtgccgac 1200

tttgcggtga tgagcggagg cggaattcgt gattctatcg aagcaggtga tatcagctat 1260

aaaaacgtac tgaaagtgca gccattcggc aatgtggtgg tgtatgccga catgaccggt 1320

aaagaggtga ttgattactt gaccgccgtc gcgcagatga agccagattc aggtgcctac 1380

ccgcaatttg ccaacgttag ctttgtggcg aaagacggta aactgaacga cctgaaaatc 1440

aaaggcgaac cggtcgatcc ggcgaaaact taccgcatgg cgacattaaa cttcaatgcc 1500

accggcgggg atggctatcc gcgccttgat aacaaaccgg gctatgtgaa taccggcttt 1560

attgatgccg aagtgctgaa agcgtatatc cagaaaagct cgccgctgga tgtgagtgtt 1620

tatgaaccga aaggtgaggt gagctggcag taa 1653

<210> 2

<211> 550

<212> PRT

<213> Escherichia coli

<400> 2

Met Lys Leu Leu Gln Arg Gly Val Ala Leu Ala Leu Leu Thr Thr Phe

1 5 10 15

Thr Leu Ala Ser Glu Thr Ala Leu Ala Tyr Glu Gln Asp Lys Thr Tyr

20 25 30

Lys Ile Thr Val Leu His Thr Asn Asp His His Gly His Phe Trp Arg

35 40 45

Asn Glu Tyr Gly Glu Tyr Gly Leu Ala Glu Gln Lys Thr Leu Val Asp

50 55 60

Gly Ile Arg Lys Glu Val Ala Ala Glu Gly Gly Ser Val Leu Leu Leu

65 70 75 80

Ser Gly Gly Asp Ile Asn Thr Gly Val Pro Glu Ser Asp Leu Gln Asp

85 90 95

Ala Glu Pro Asp Phe Arg Gly Met Asn Leu Val Gly Tyr Asp Ala Met

100 105 110

Ala Ile Gly Asn His Glu Phe Asp Asn Pro Leu Thr Val Leu Arg Gln

115 120 125

Gln Glu Lys Trp Ala Lys Phe Pro Leu Leu Ser Ala Asn Ile Tyr Gln

130 135 140

Lys Ser Thr Gly Glu Arg Leu Phe Lys Pro Trp Ala Leu Phe Lys Arg

145 150 155 160

Gln Asp Leu Lys Ile Ala Val Ile Gly Leu Thr Thr Asp Asp Thr Ala

165 170 175

Lys Ile Gly Asn Pro Glu Tyr Phe Thr Asp Ile Glu Phe Arg Lys Pro

180 185 190

Ala Asp Glu Ala Lys Leu Val Ile Gln Glu Leu Gln Gln Thr Glu Lys

195 200 205

Pro Asp Ile Ile Ile Ala Ala Thr His Met Gly His Tyr Asp Asn Gly

210 215 220

Glu His Gly Ser Asn Ala Pro Gly Asp Val Glu Met Ala Arg Ala Leu

225 230 235 240

Pro Ala Gly Ser Leu Ala Met Ile Val Gly Gly His Ser Gln Asp Pro

245 250 255

Val Cys Met Ala Ala Glu Asn Lys Lys Gln Val Asp Tyr Val Pro Gly

260 265 270

Thr Pro Cys Lys Pro Asp Gln Gln Asn Gly Ile Trp Ile Val Gln Ala

275 280 285

His Glu Trp Gly Lys Tyr Val Gly Arg Ala Asp Phe Glu Phe Arg Asn

290 295 300

Gly Glu Met Lys Met Val Asn Tyr Gln Leu Ile Pro Val Asn Leu Lys

305 310 315 320

Lys Lys Val Thr Trp Glu Asp Gly Lys Ser Glu Arg Val Leu Tyr Thr

325 330 335

Pro Glu Ile Ala Glu Asn Gln Gln Met Ile Ser Leu Leu Ser Pro Phe

340 345 350

Gln Asn Lys Gly Lys Ala Gln Leu Glu Val Lys Ile Gly Glu Thr Asn

355 360 365

Gly Arg Leu Glu Gly Asp Arg Asp Lys Val Arg Phe Val Gln Thr Asn

370 375 380

Met Gly Arg Leu Ile Leu Ala Ala Gln Met Asp Arg Thr Gly Ala Asp

385 390 395 400

Phe Ala Val Met Ser Gly Gly Gly Ile Arg Asp Ser Ile Glu Ala Gly

405 410 415

Asp Ile Ser Tyr Lys Asn Val Leu Lys Val Gln Pro Phe Gly Asn Val

420 425 430

Val Val Tyr Ala Asp Met Thr Gly Lys Glu Val Ile Asp Tyr Leu Thr

435 440 445

Ala Val Ala Gln Met Lys Pro Asp Ser Gly Ala Tyr Pro Gln Phe Ala

450 455 460

Asn Val Ser Phe Val Ala Lys Asp Gly Lys Leu Asn Asp Leu Lys Ile

465 470 475 480

Lys Gly Glu Pro Val Asp Pro Ala Lys Thr Tyr Arg Met Ala Thr Leu

485 490 495

Asn Phe Asn Ala Thr Gly Gly Asp Gly Tyr Pro Arg Leu Asp Asn Lys

500 505 510

Pro Gly Tyr Val Asn Thr Gly Phe Ile Asp Ala Glu Val Leu Lys Ala

515 520 525

Tyr Ile Gln Lys Ser Ser Pro Leu Asp Val Ser Val Tyr Glu Pro Lys

530 535 540

Gly Glu Val Ser Trp Gln

545 550

<210> 3

<211> 1365

<212> DNA

<213> Escherichia coli

<400> 3

ttgattacac atattagccc gcttggctcc atggatatgt tgtcgcagct ggaagtggat 60

atgcttaaac gcaccgccag cagcgacctc tatcaactgt ttcgcaactg ttcacttgcc 120

gtactgaact ccggtagttt gaccgataac agcaaagaat tgctgtctcg ttttgaaaat 180

ttcgatatta acgtcttgcg ccgtgaacgc ggcgtaaagc tggaactgat taatcccccg 240

gaagaggctt ttgtcgatgg gcgaattatt cgcgctttgc aggccaactt gttcgcggtc 300

ctgcgtgaca ttctcttcgt ttacgggcaa atccataaca ccgttcgttt tcccaacctg 360

aatctcgaca actccgtcca catcactaac ctggtctttt ccatcttgcg taacgctcgc 420

gcgctgcatg tgggtgaagc gccaaatatg gtggtctgct ggggcggtca ctcaattaac 480

gaaaacgagt atttgtatgc ccgtcgcgtc ggaaaccagc tgggcctgcg tgagctgaat 540

atctgcaccg gctgtggtcc gggagcgatg gaagcgccga tgaaaggtgc tgcggtcgga 600

cacgcgcagc agcgttacaa agacagtcgt tttattggta tgacagagcc gtcgattatc 660

gccgctgaac cgcctaaccc gctggtcaac gaattgatca tcatgccaga tatcgaaaaa 720

cgtctggaag cgtttgtccg tatcgctcac ggtatcatta tcttccctgg cggtgtgggt 780

acggcagaag agttgctcta tttgctggga attttaatga acccggccaa caaagatcag 840

gttttaccat tgatcctcac cggcccgaaa gagagcgccg actacttccg cgtactggac 900

gagtttgtcg tgcatacgct gggtgaaaac gcgcgccgcc attaccgcat catcattgat 960

gacgccgctg aagtcgctcg tcagatgaaa aaatcgatgc cgctggtgaa agaaaatcgc 1020

cgtgatacag gcgatgccta cagctttaac tggtcaatgc gcattgcgcc agatttgcaa 1080

atgccgtttg agccgtctca cgagaatatg gctaatctga agctttaccc ggatcaacct 1140

gttgaagtgc tggctgccga cctgcgccgt gcgttctccg gtattgtggc gggtaacgta 1200

aaagaagtcg gtattcgcgc cattgaagag tttggtcctt acaaaatcaa cggcgataaa 1260

gagattatgc gtcgtatgga cgacctgcta cagggttttg ttgcccagca tcgtatgaag 1320

ttgccaggct cagcctacat cccttgctac gaaatctgca cgtaa 1365

<210> 4

<211> 454

<212> PRT

<213> Escherichia coli

<400> 4

Met Ile Thr His Ile Ser Pro Leu Gly Ser Met Asp Met Leu Ser Gln

1 5 10 15

Leu Glu Val Asp Met Leu Lys Arg Thr Ala Ser Ser Asp Leu Tyr Gln

20 25 30

Leu Phe Arg Asn Cys Ser Leu Ala Val Leu Asn Ser Gly Ser Leu Thr

35 40 45

Asp Asn Ser Lys Glu Leu Leu Ser Arg Phe Glu Asn Phe Asp Ile Asn

50 55 60

Val Leu Arg Arg Glu Arg Gly Val Lys Leu Glu Leu Ile Asn Pro Pro

65 70 75 80

Glu Glu Ala Phe Val Asp Gly Arg Ile Ile Arg Ala Leu Gln Ala Asn

85 90 95

Leu Phe Ala Val Leu Arg Asp Ile Leu Phe Val Tyr Gly Gln Ile His

100 105 110

Asn Thr Val Arg Phe Pro Asn Leu Asn Leu Asp Asn Ser Val His Ile

115 120 125

Thr Asn Leu Val Phe Ser Ile Leu Arg Asn Ala Arg Ala Leu His Val

130 135 140

Gly Glu Ala Pro Asn Met Val Val Cys Trp Gly Gly His Ser Ile Asn

145 150 155 160

Glu Asn Glu Tyr Leu Tyr Ala Arg Arg Val Gly Asn Gln Leu Gly Leu

165 170 175

Arg Glu Leu Asn Ile Cys Thr Gly Cys Gly Pro Gly Ala Met Glu Ala

180 185 190

Pro Met Lys Gly Ala Ala Val Gly His Ala Gln Gln Arg Tyr Lys Asp

195 200 205

Ser Arg Phe Ile Gly Met Thr Glu Pro Ser Ile Ile Ala Ala Glu Pro

210 215 220

Pro Asn Pro Leu Val Asn Glu Leu Ile Ile Met Pro Asp Ile Glu Lys

225 230 235 240

Arg Leu Glu Ala Phe Val Arg Ile Ala His Gly Ile Ile Ile Phe Pro

245 250 255

Gly Gly Val Gly Thr Ala Glu Glu Leu Leu Tyr Leu Leu Gly Ile Leu

260 265 270

Met Asn Pro Ala Asn Lys Asp Gln Val Leu Pro Leu Ile Leu Thr Gly

275 280 285

Pro Lys Glu Ser Ala Asp Tyr Phe Arg Val Leu Asp Glu Phe Val Val

290 295 300

His Thr Leu Gly Glu Asn Ala Arg Arg His Tyr Arg Ile Ile Ile Asp

305 310 315 320

Asp Ala Ala Glu Val Ala Arg Gln Met Lys Lys Ser Met Pro Leu Val

325 330 335

Lys Glu Asn Arg Arg Asp Thr Gly Asp Ala Tyr Ser Phe Asn Trp Ser

340 345 350

Met Arg Ile Ala Pro Asp Leu Gln Met Pro Phe Glu Pro Ser His Glu

355 360 365

Asn Met Ala Asn Leu Lys Leu Tyr Pro Asp Gln Pro Val Glu Val Leu

370 375 380

Ala Ala Asp Leu Arg Arg Ala Phe Ser Gly Ile Val Ala Gly Asn Val

385 390 395 400

Lys Glu Val Gly Ile Arg Ala Ile Glu Glu Phe Gly Pro Tyr Lys Ile

405 410 415

Asn Gly Asp Lys Glu Ile Met Arg Arg Met Asp Asp Leu Leu Gln Gly

420 425 430

Phe Val Ala Gln His Arg Met Lys Leu Pro Gly Ser Ala Tyr Ile Pro

435 440 445

Cys Tyr Glu Ile Cys Thr

450

<210> 5

<211> 642

<212> DNA

<213> Escherichia coli

<400> 5

atgactgatc agtctcatca gtgcgtcatt atcggtatcg ctggcgcatc ggcttccggc 60

aagagtctta ttgccagtac cctttatcgt gaattgcgtg agcaagtcgg tgatgaacac 120

atcggcgtaa ttcccgaaga ctgctattac aaagatcaaa gccatctgtc gatggaagaa 180

cgcgttaaga ccaactacga ccatcccagc gcgatggatc acagtctgct gcttgagcat 240

ttacaagcgt tgaaacgcgg ctcggcaatt gacctgccgg tttacagcta tgttgaacat 300

acgcgtatga aagaaacggt gacggttgag ccgaagaagg tcatcattct cgaaggcatt 360

ttgttgctga cggatgcgcg tttgcgtgac gaacttaact tctccatttt cgttgatacc 420

ccgctggata tctgcctgat gcgccgcatc aagcgtgacg ttaacgagcg tgggcgttca 480

atggattcag tgatggcgca atatcaaaaa accgtgcgcc cgatgttcct gcaattcatt 540

gagccttcta aacaatatgc ggacattatc gtgccgcgcg gcgggaaaaa ccgcatcgcg 600

atcgatatat tgaaagcgaa aataagtcag ttctttgaat aa 642

<210> 6

<211> 213

<212> PRT

<213> Escherichia coli

<400> 6

Met Thr Asp Gln Ser His Gln Cys Val Ile Ile Gly Ile Ala Gly Ala

1 5 10 15

Ser Ala Ser Gly Lys Ser Leu Ile Ala Ser Thr Leu Tyr Arg Glu Leu

20 25 30

Arg Glu Gln Val Gly Asp Glu His Ile Gly Val Ile Pro Glu Asp Cys

35 40 45

Tyr Tyr Lys Asp Gln Ser His Leu Ser Met Glu Glu Arg Val Lys Thr

50 55 60

Asn Tyr Asp His Pro Ser Ala Met Asp His Ser Leu Leu Leu Glu His

65 70 75 80

Leu Gln Ala Leu Lys Arg Gly Ser Ala Ile Asp Leu Pro Val Tyr Ser

85 90 95

Tyr Val Glu His Thr Arg Met Lys Glu Thr Val Thr Val Glu Pro Lys

100 105 110

Lys Val Ile Ile Leu Glu Gly Ile Leu Leu Leu Thr Asp Ala Arg Leu

115 120 125

Arg Asp Glu Leu Asn Phe Ser Ile Phe Val Asp Thr Pro Leu Asp Ile

130 135 140

Cys Leu Met Arg Arg Ile Lys Arg Asp Val Asn Glu Arg Gly Arg Ser

145 150 155 160

Met Asp Ser Val Met Ala Gln Tyr Gln Lys Thr Val Arg Pro Met Phe

165 170 175

Leu Gln Phe Ile Glu Pro Ser Lys Gln Tyr Ala Asp Ile Ile Val Pro

180 185 190

Arg Gly Gly Lys Asn Arg Ile Ala Ile Asp Ile Leu Lys Ala Lys Ile

195 200 205

Ser Gln Phe Phe Glu

210

<210> 7

<211> 32

<212> DNA

<213> Artificial sequence

<400> 7

catgccatgg gcactgatca gtctcatcag tg 32

<210> 8

<211> 27

<212> DNA

<213> Artificial sequence

<400> 8

cgggatcctt attcaaagaa ctgactt 27

<210> 9

<211> 20

<212> DNA

<213> Artificial sequence

<400> 9

atatggtgaa tatggtctgg 20

<210> 10

<211> 40

<212> DNA

<213> Artificial sequence

<400> 10

ctagaaagta taggaacttc gggtcgccgc gataataatg 40

<210> 11

<211> 40

<212> DNA

<213> Artificial sequence

<400> 11

ttctagagaa taggaacttc tggattgtgc aggcgcatga 40

<210> 12

<211> 20

<212> DNA

<213> Artificial sequence

<400> 12

attgattact tgaccgccgt 20

<210> 13

<211> 60

<212> DNA

<213> Artificial sequence

<400> 13

gtcctaggta taatactagt ctgcatacca atgatcatca gttttagagc tagaaatagc 60

<210> 14

<211> 28

<212> DNA

<213> Artificial sequence

<400> 14

cggactagta ttatacctag gactgagc 28

<210> 15

<211> 20

<212> DNA

<213> Artificial sequence

<400> 15

atatggtgaa tatggtctgg 20

<210> 16

<211> 20

<212> DNA

<213> Artificial sequence

<400> 16

attgattact tgaccgccgt 20

<210> 17

<211> 22

<212> DNA

<213> Artificial sequence

<400> 17

tggatatgct taaacgcacc gc 22

<210> 18

<211> 40

<212> DNA

<213> Artificial sequence

<400> 18

aggatcaatg gtaaaacctg agctcacgca ggcccagctg 40

<210> 19

<211> 40

<212> DNA

<213> Artificial sequence

<400> 19

cagctgggcc tgcgtgagct caggttttac cattgatcct 40

<210> 20

<211> 23

<212> DNA

<213> Artificial sequence

<400> 20

cgtgcagatt tcgtagcaag gga 23

<210> 21

<211> 60

<212> DNA

<213> Artificial sequence

<400> 21

gtcctaggta taatactagt ctgcatacca atgatcatca gttttagagc tagaaatagc 60

<210> 22

<211> 28

<212> DNA

<213> Artificial sequence

<400> 22

cggactagta ttatacctag gactgagc 28

<210> 23

<211> 23

<212> DNA

<213> Artificial sequence

<400> 23

gtgctggatt cacgcagaag gtt 23

<210> 24

<211> 24

<212> DNA

<213> Artificial sequence

<400> 24

ctgtgatgat atttgtcgcg tgag 24

Claims

1. A simple method for extracting 5' -cytidylic acid from microbial fermentation liquor is characterized in that the method comprises the following steps of:

(1) heating and sterilizing;

(5) and (5) dripping an alcohol organic solvent into the system obtained in the step (4) for crystallization, centrifuging, rinsing and vacuum drying to obtain a finished product of 5' -cytidylic acid.

2. The simple method according to claim 1, wherein the sterilization temperature in the step (1) is 60-100 ℃ and the sterilization time is 30-60 min.

3. The simplified method according to claim 1, wherein the ceramic membrane in step (2) has a molecular weight cut-off of 1000 to 5000 daltons.

4. The simplified method according to claim 1, wherein the reduced pressure concentration conditions in step (3): the concentration temperature is 50-70 ℃, the vacuum degree is-0.1 MPa to-0.08 MPa, and the concentration is carried out until the concentration of the cytidylic acid is 10-50 percent.

5. The simple method according to claim 1, wherein the volume of the alcohol organic solvent in the step (5) is 2-8 times of the volume of the decolorized solution.

6. The simplified method as claimed in claim 1, wherein the alcohol organic solvent in step (5) includes any one of methanol, ethanol, and isopropanol, and its aqueous solution.

7. The simplified method as claimed in claim 1, wherein the crystallization temperature in step (5) is 0-25 ℃ and the crystallization time is 1-12 h.

8. The method according to any one of claims 1 to 7, wherein the microbial fermentation broth mainly contains 5' -cytidylic acid, microbial filaments, pigments, proteinaceous substances, inorganic salts, glucose, glycerol, orotic acid, uridine, uracil and impurities formed by autolysis of microbial cells.