CN113985038A - Biosensor and preparation method and application thereof - Google Patents
Biosensor and preparation method and application thereof Download PDFInfo
- Publication number
- CN113985038A CN113985038A CN202111223898.5A CN202111223898A CN113985038A CN 113985038 A CN113985038 A CN 113985038A CN 202111223898 A CN202111223898 A CN 202111223898A CN 113985038 A CN113985038 A CN 113985038A
- Authority
- CN
- China
- Prior art keywords
- apt
- biosensor
- tsh
- ucnps
- aptamer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/74—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving hormones or other non-cytokine intercellular protein regulatory factors such as growth factors, including receptors to hormones and growth factors
- G01N33/76—Human chorionic gonadotropin including luteinising hormone, follicle stimulating hormone, thyroid stimulating hormone or their receptors
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N21/00—Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
- G01N21/62—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light
- G01N21/63—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light optically excited
- G01N21/64—Fluorescence; Phosphorescence
- G01N21/6428—Measuring fluorescence of fluorescent products of reactions or of fluorochrome labelled reactive substances, e.g. measuring quenching effects, using measuring "optrodes"
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Abstract
The invention discloses a biosensor and a preparation method and application thereof, and belongs to the field of sensors. The composition of the biosensor comprises: the aptamer Apt-1 loaded rare earth up-conversion nanometer material, the aptamer Apt-2 modified with fluorescent dye and buffer solution containing metal ions. The invention divides the aptamer capable of specifically recognizing TSH into Apt-1 and Apt-2, modifies Apt-1 on the conversion nano material on the energy donor, and modifies the energy acceptor tetramethyl rhodamine on Apt-2. In the presence of a target substance TSH, the aptamer can specifically recognize and combine with TSH and form a hairpin structure, so that the distance between UCNPs and TAMRA is shortened, and fluorescence resonance energy transfer is generated under the excitation of 980nm near infrared light. The biosensor prepared by the invention can be used for detecting low-concentration TSH, and the detection limit is as low as 0.07647 mU/L.
Description
Technical Field
The invention relates to the field of sensors, in particular to a biosensor and a preparation method and application thereof.
Background
Thyroid Stimulating Hormone (TSH) is an essential hormone in the human body and is a glycoprotein secreted by thyroid stimulating cells in the pituitary gland. It stimulates the synthesis and secretion of thyroid hormones, including triiodothyronine (T3) and tetraiodothyronine (T4), and the values and balance of the T3 and T4 hormones are important to the metabolic processes of the human body. In addition, the TSH level is low, and the serum T4 and T3 concentrations are normal, so that the TSH can be used as an index of subclinical hyperthyroidism. Hyperthyroidism, while an asymptomatic disease, untreated subclinical hyperthyroidism can lead to serious consequences, including heart failure, atrial fibrillation, cardiac dysfunction, neuropsychiatric symptoms, osteoporosis, and overt hyperthyroidism. Dominant hyperthyroidism is characterized by low TSH activity, whereas the thyroid hormone: including T3, T4, both elevated. Studies have also reported that the TSH levels of pituitary tumours are significantly higher than normal; in addition, TSH is also a biomarker for early diagnosis of thyroid cancer. If an individual has insufficient iodine content, the body will increase TSH production and thus iodine capture, and thus elevated TSH levels in this case may be indicative of hypothyroidism. Conversely, a decrease in TSH levels may indicate hyperthyroidism. In addition, the most common pathological state of hypothyroidism (i.e., elevated TSH levels) in children is endemic cretinism, in which physiological and psychological development of children is severely affected. Adult hypothyroidism (i.e., increased TSH levels) can result in decreased basal metabolic rate, hypothermia, and cold intolerance. Hyperthyroidism can lead to Graves' disease, a disease similar to TSH autonomic dysfunction. Therefore, early detection of TSH is of self-evident importance for diagnosis of related diseases.
While immunemedicine methods have been developed for detecting TSH activity and sensitivity is acceptable, detection of TSH activity typically requires reliance on visual or more sophisticated reflectance sensors, detection of very low TSH activity (0.4mU/L) is often not easily measurable, whereas normal TSH levels in adults are 0.3-5 mU/L. Based on this fact, while most TSH immunological assays have focused on the detection of hypothyroidism, they are only suitable for the detection of TSH at higher concentration levels; and because the measuring range of the TSH is very low, the method for measuring the TSH in human serum is difficult.
Therefore, the development of the biosensor which is suitable for detecting the TSH with a low concentration level, has high accuracy and high precision and has rapid monitoring capability on the TSH has great significance to the field of medical detection.
Disclosure of Invention
The invention aims to provide a biosensor and a preparation method and application thereof, which are used for solving the problems in the prior art, so that the biosensor can be used for detecting low-concentration level TSH, and the detection accuracy, precision, sensitivity and detection rate are improved.
In order to achieve the purpose, the invention provides the following scheme:
in one embodiment of the present invention, a biosensor comprises: the aptamer Apt-1 loaded rare earth up-conversion nanometer material, the aptamer Apt-2 modified with fluorescent dye and buffer solution containing metal ions.
Further, the rare earth up-conversion nano material is BF4 -Modified NaYF4：Yb，Er。
Further, the NaYF4: the molar ratio of Y to Yb to Er in Yb and Er is 78: 20: 2.
Further, the sequence of the aptamer Apt-1 is AUGUUGGCAGCAGGGUCC; the sequence of the aptamer Apt-2 is GACGGCGUAACCUUGCCAGCUG.
Further, the fluorescent dye is tetramethyl rhodamine.
Further, the buffer solution containing metal ions is Mg2+Tris-HCl-EDTA buffer.
Further, the concentrations of the aptamer Apt-1 and the aptamer Apt-2 in the biosensor are the same.
Further, the concentration of Apt-2 is 0.1-1 μ M.
In the second technical solution of the present invention, the method for manufacturing the biosensor comprises the following steps:
BF mixing4 -Adding the modified rare earth up-conversion material into a buffer solution containing metal ions to obtain a mixed solution, adding an aptamer Apt-1 into the mixed solution, and oscillating to obtain the buffer solution of the rare earth up-conversion nanomaterial loaded with the aptamer Apt-1, namely the buffer solution of the Apt-1-UCNPs probe;
adding Apt-2 modified with fluorescent dye into a buffer solution of an Apt-1-UCNPs probe, and incubating to obtain the biosensor.
Further, Apt-2 labeled with a fluorescent dye is added to the buffer of the Apt-1-UCNPs probe to keep the concentrations of Apt-2 and Apt-1 consistent.
Further, the metal ion concentration is 1-20 mM.
Further, the concentration of Apt-2 is 0.1-1 μ M.
Further, the incubation is specifically performed for 1-20min under the conditions of temperature of 20-40 ℃, pH of 5-8.5 and metal ion concentration of 1-20 mM.
In the third technical scheme of the invention, the biosensor is applied to detection of thyroid stimulating hormone.
Further, the application conditions are specifically as follows: the temperature is 20-40 deg.C, pH is 5-8.5, incubation time is 1-20min, and metal ion concentration is 1-20 mM.
The technical idea of the invention is as follows:
the invention is based on fluorescence resonance energy transfer technology (LRET) to realize the detection of low concentration level TSH, and in the technical scheme of the invention, how to select proper energy donor and acceptor and proper nucleic acid aptamer is particularly important, because the factors determine the LRET efficiency and thus determine the detection sensitivity.
The aptamer is a single-chain deoxyribonucleic acid (DNA) or ribonucleic acid (RNA) molecule, is combined with a protein target by folding into a three-dimensional conformation to form the effect similar to an antigen-antibody, and has the characteristics of high affinity and high specificity; the present invention selects aptamers that specifically recognize TSH as Apt-1(AUGUUGGCAGCAGGGUCC) and Apt-2 (GACGGCGUAACCUUGCCAGCUG). As a novel nano material, the rare earth up-conversion nano material (UCNPs) has the advantages of large anti-Stokes displacement, strong photobleaching resistance, no background signal, narrow emission bandwidth, deep light penetration depth and the like; the Tetramethylrhodamine (TAMRA) fluorescent dye has the advantages of high quantum yield, excellent light stability, visible light excitation, chemical stability under physiological conditions and the like. Absorption spectrum of TAMRA and rare earth up-conversion nano material NaYF4: the emission spectra of Yb, Er UCNPs mostly coincide. Thus, TAMRA, NaYF4: yb and Er UCNPs can be respectively used as an energy acceptor and an energy donor in an LRET process.
The invention divides the aptamer capable of specifically recognizing TSH into Apt-1 and Apt-2 (without influencing the performance of the aptamer), modifies Apt-1 on the UCNPs of an energy donor, and modifies TAMRA of an energy acceptor on Apt-2. In the presence of a target substance TSH, the aptamer can specifically recognize and combine with the TSH and form a hairpin structure, so that the distance between UCNPs and TAMRA is shortened, and LRET occurs under the excitation of 980nm near infrared light. With the increase of the added amount of TSH, the upconversion fluorescence of UCNPs at 545nm is gradually weakened, the fluorescence of TAMRA at 585nm is gradually strengthened, and the quantitative detection of TSH activity is realized through the change of the fluorescence intensity ratio of the UCNPs and the TAMRA (ratiometric fluorescence).
The invention discloses the following technical effects:
(1) the invention adopts rare earth doped NaYF4: yb, Er UCNPs as seedsRaw material of substance sensor, due to NaYF4: yb and Er UCNPs are excited by near infrared light, so that the fluorescence life is long, and the interference of biological background fluorescence is avoided;
(2) the biosensor prepared by the invention can be used for detecting low-concentration TSH, and the detection limit is as low as 0.07647 mU/L;
(3) the invention has simple equipment, simple and convenient operation and no washing in the detection process;
(3) the biosensor prepared by the invention has high precision, high detection rate, high sensitivity and good selectivity on TSH, and is suitable for complex biological systems.
Drawings
In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings needed in the embodiments will be briefly described below, and it is obvious that the drawings in the following description are only some embodiments of the present invention, and it is obvious for those skilled in the art to obtain other drawings without creative efforts.
FIG. 1 shows OA-UCNPs and BF in example 14 --transmission electron microscopy of UCNPs; wherein A is transmission electron micrograph of OA-UCNPs, and B is BF4 --transmission electron microscopy of UCNPs;
FIG. 2 is a diagram showing the UV-Vis spectrum and Zeta potential of Apt-1-UCNPs probe solution; wherein, A is an ultraviolet visible light spectrum, and B is a Zeta potential characterization diagram;
FIG. 3 is a graph of Apt-1-FAM standard curve and the variation of Apt-1 loading on the surface of UCNPs; wherein A is a standard curve of Apt-1-FAM, and B is a load change diagram of Apt-1 on the surface of UCNPs;
FIG. 4 is BF in example 14 --emission spectra of UCNPs and uv-vis absorption spectra and fluorescence emission spectra of TAMRA;
FIG. 5 is a feasibility characterization chart of LRET and Er of UCNPs and Apt-2-TAMRA under 980nm laser irradiation3+Fluorescence lifetime curve at 545 nm; wherein, A is a feasibility characterization chart of LRET, B is Er of UCNPs and Apt-2-TAMRA under 980nm laser irradiation3+At 545nA fluorescence lifetime curve at m;
FIG. 6 shows fluorescence spectra and I of the biosensors obtained in example 1 after reaction with TSH of different activities585nm/I545nmAnd a standard curve for TSH activity; wherein A is a fluorescence spectrum of the biosensor prepared in example 1 after reaction with TSH of different activities, B is a partially enlarged view of the graph A, and C is I585nm/I545nmAnd a standard curve for TSH activity;
FIG. 7 is a specificity chart of the biosensor manufactured in example 1;
FIG. 8 is a technical roadmap for the present invention.
Detailed Description
Reference will now be made in detail to various exemplary embodiments of the invention, the detailed description should not be construed as limiting the invention but as a more detailed description of certain aspects, features and embodiments of the invention.
It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. Further, for numerical ranges in this disclosure, it is understood that each intervening value, between the upper and lower limit of that range, is also specifically disclosed. Every smaller range between any stated value or intervening value in a stated range and any other stated or intervening value in a stated range is encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included or excluded in the range.
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference herein for the purpose of disclosing and describing the methods and/or materials associated with the documents. In case of conflict with any incorporated document, the present specification will control.
It will be apparent to those skilled in the art that various modifications and variations can be made in the specific embodiments of the present disclosure without departing from the scope or spirit of the disclosure. Other embodiments will be apparent to those skilled in the art from consideration of the specification. The description and examples are intended to be illustrative only.
As used herein, the terms "comprising," "including," "having," "containing," and the like are open-ended terms that mean including, but not limited to.
The aptamers Apt-1(AUGUUGGCAGCAGGGUCC) and Apt-2(GACGGCGUAACCUUGCCAGCUG) used in the examples of the present invention were purchased from Biotechnology engineering (Shanghai) Ltd.
The OA-UCNPs used in the embodiment of the invention are unmodified NaYF4：Yb，Er。
EXAMPLE 1 preparation of biosensor
Step 3, modifying TAMRA on Apt-2, and marking as Apt-2-TAMRA (obtained by the company of Biotechnology, Shanghai, Inc., and having a trade name of GACGGCGUAACCUUGCCAGCUG-TAMRA).
And 4, adding 5mu L of 100 mu M Apt-2-TAMRA into 1mL of the mixed solution prepared in the step 1 and dissolved with the Apt-1-UCNPs probe to obtain a mixed solution with the concentrations of the Apt-2-TAMRA and the Apt-1-UCNPs probe being 0.5 mu M, thus obtaining the biosensor.
EXAMPLE 1 OA-UCNPs and BF in step 14 -Transmission electron microscopy of UCNPs as shown in fig. 1; wherein, the picture A is a transmission electron micrograph of OA-UCNPs, and the picture B is BF4 --transmission electron microscopy of UCNPs; as can be seen from FIG. 1, the synthesized nanoparticles have regular morphology and uniform particle size distribution.
The ultraviolet-visible light spectrum and Zeta potential characterization diagram of the Apt-1-UCNPs probe solution prepared in the step 2 of the example 1 are shown in a figure 2; wherein, the graph A is an ultraviolet visible light spectrum, and the graph B is a Zeta potential characterization graph; from FIG. 2, it can be seen that Apt-1 was successfully loaded to BF4 --the surface of nanoparticles of UCNPs.
Application of the biosensor:
to the biosensor prepared in example 1, a series of TSH was added to give final activities of 0, 0.1, 0.5, 1, 1.5, 2mU/L, and then Mg was added at 25 ℃ and pH7.5, respectively2+Incubating for 15min under the condition of a concentration of 10mM, and detecting the fluorescence emission spectrum of the sample in the wavelength range of 350-750nm under the irradiation of a 980nm near-infrared exciter.
The incubation time of the biosensor was optimized:
Apt-2-TAMRA was added to an appropriate amount of the Apt-1-UCNPs solution prepared in step 2 of example 1 to a final concentration of 0.5. mu.M corresponding to Apt-1, and TSH was added to a final activity of 2 mU/L. After incubation for 1, 5, 10, 15 and 20min at 25 ℃ and pH7.5, fluorescence emission spectra of samples in the wavelength range of 400-700nm are detected under the irradiation of a 980nm near-infrared exciter. The experiment explored that the optimal reaction time for this system was 15 min.
Optimizing the reaction temperature of the biosensor:
Apt-2-TAMRA was added to an appropriate amount of the Apt-1-UCNPs solution prepared in step 2 of example 1 to a final concentration of 0.5. mu.M corresponding to Apt-1, and TSH was added to a final activity of 2 mU/L. Respectively incubating for 15min at the temperature of 20, 25, 30, 35 and 40 ℃, wherein the pH of the reaction system is 7.5, and detecting the fluorescence emission spectrum of the sample in the wavelength range of 400-700nm under the irradiation of a 980nm near-infrared exciter. The experiment explored that the optimum reaction temperature for this system was 25 ℃.
Reaction pH of the biosensor was optimized:
the pH of the buffer solution of the reaction system is respectively adjusted to 5, 5.5, 6, 6.5, 7, 7.5, 8 and 8.5, and the buffer solution with different pH is respectively added into the reaction system with the same conditions: adding Apt-2-TAMRA into appropriate amount of Apt-1-UCNPs solution to make its final concentration consistent with Apt-1 and 0.5. mu.M, and adding TSH to make its final activity 2 mU/L. Incubating for 15min at the temperature of 25 ℃, and detecting the fluorescence emission spectrum of the sample in the wavelength range of 400-700nm under the irradiation of a 980nm near-infrared exciter. The experiment explored that the optimum pH for the system reaction was 7.5.
For Mg in biosensor2+And (3) optimizing the concentration:
system Mg2+And (3) optimizing the concentration: mg of buffer solution of reaction system2+The concentrations were adjusted to 1, 5, 10, 15, 20mM, pH7.5, respectively, using the different Mg's mentioned above2+The buffers with the concentrations are respectively added into the reaction systems with the same conditions: adding Apt-2-TAMRA into appropriate amount of Apt-1-UCNPs solution to make its final concentration consistent with Apt-1 and 0.5. mu.M, and adding TSH to make its final activity 2 mU/L. Incubating for 15min at the temperature of 25 ℃, and detecting the fluorescence emission spectrum of the sample in the wavelength range of 400-700nm under the irradiation of a 980nm near-infrared exciter. Experiments explore the optimal Mg of the system reaction2+The concentration was 10 mM.
For BF4 --Apt-1 loading optimization of UCNPs surface:
the fluorescence intensity of the aptamer Apt-1(Apt-1-FAM) of the end-labeled FAM fluorescent dye was measured at different concentrations and normalized, and the results are shown in FIG. 3A. Taking a proper amount of Mg2+Tris-HCl-EDTA buffer at a concentration of 10mM, pH 7.4Dispersed BF4 --UCNPs，BF4 --UCNPs concentration of 2Mg/mL, to which different concentrations of aptamer Apt-1 of end-labeled FAM fluorescent dye, and Mg were added2+Tris-HCl-EDTA buffer solution with the concentration of 10mM and the pH value of 7.4 ensures that the final concentrations of the aptamer in the system are respectively 0.1, 0.2, 0.3, 0.4, 0.5 and 1 mu M, after mixing, stirring is carried out for 15min at room temperature, then centrifuging is carried out for 5min at 8000rpm, supernatant fluid is collected, and the fluorescence of the free marked FAM aptamer in the supernatant fluid is detected. The aptamer concentration of the supernatant can be calculated by a standard curve, and BF can be calculated by the following formula4 --the concentration of aptamer loaded onto the surface of UCNPs.
Loading concentration-concentration of aptamer added-concentration of supernatant aptamer
BF4 -FIG. 3B shows the Apt-1 loading variation of the surface of UCNPs. From FIG. 3, it can be seen that the maximum loading amount is 0.5. mu.M.
The feasibility of the invention adopting the LRET technology is verified:
BF in example 14 -The emission spectra of UCNPs and the uv-vis absorption spectra and fluorescence emission spectra of TAMRA are shown in fig. 4; wherein a represents an upconversion emission spectrum of UCNPs, b represents a UV-Vis absorption spectrum of TAMRA, and c represents a fluorescence emission spectrum of TAMRA. As can be seen from fig. 4, the spectra of the energy donor and the energy acceptor satisfy the condition of energy resonance transfer, which can occur therebetween.
The feasibility characterization of LRET is shown in FIG. 5A, and Er is obtained by UCNPs and UCNPs-TAMRA under 980nm laser irradiation3+The fluorescence lifetime curve at 545nm is shown in FIG. 5B; from FIG. 5, it can be seen that the fluorescence lifetime is slightly decreased after the combination of UCNPs and TAMRA, indicating that energy resonance transfer occurs between UCNPs and fluorescent dye. This illustrates that LRET is feasible in the solution of the present application.
The biosensor prepared in example 1 was used for serum sample detection, as follows:
after centrifuging human serum samples at 9000rpm for 12min, three TSH concentrations were separatedSeparately adding into serum, and taking 4 μ L of the above serum sample added with TSH, adding into 1ml, 1mg/ml biosensor prepared in example 1, and incubating for 15min, the result is shown in FIG. 6, wherein Panel A is fluorescence spectrum of the biosensor prepared in example 1 after reacting with TSH (0, 0.1, 0.5, 1, 1.5, 2mU/L) with different activities, Panel B is partial enlarged view of Panel A, and Panel C is I585nm/I545nmAnd TSH activity (0-2 mU/L). As can be seen from FIG. 6, as the TSH activity increases, the aptamer in the system reacts with TSH to form a hairpin structure, and the distance between TAMRA and UCNPs is shortened, so that the luminescence of UCNPs at 545nm is gradually reduced, and the fluorescence intensity of TAMRA at 585nm is gradually increased. By plotting the ratio of the fluorescence intensity of the two and the TSH activity, the regression equation of the standard curve can be obtained as that Y is 0.0013C +9.8652E-4, R2The detection limit was 0.07647mU/L (by 3. delta./S) at 0.9921, which indicates that the ratio of fluorescence intensity and TSH activity are in a good linear relationship within a certain range.
The biosensor prepared in example 1 was examined specifically:
aiming at researching the specificity of the prepared biosensor, the following interferents are selected to be added into the system: cu2+、K+Cysteine, glutamic acid, glycine, tyrosine, human serum albumin, bovine serum albumin, the concentration of the above-mentioned interferents was 0.1mg/mL, and the results are shown in FIG. 7. As can be seen from FIG. 7, in the case of adding the above-mentioned interferents, none of the interferents interfered with the detection of TSH, which indicates that the biosensor prepared in example 1 had good recognition specificity for TSH.
The above-described embodiments are merely illustrative of the preferred embodiments of the present invention, and do not limit the scope of the present invention, and various modifications and improvements of the technical solutions of the present invention can be made by those skilled in the art without departing from the spirit of the present invention, and the technical solutions of the present invention are within the scope of the present invention defined by the claims.
Claims (8)
1. A biosensor, wherein the composition of the biosensor comprises: the aptamer Apt-1 loaded rare earth up-conversion nanometer material, the aptamer Apt-2 modified with fluorescent dye and buffer solution containing metal ions.
2. The biosensor as in claim 1, wherein said rare earth up-conversion nanomaterial is BF4 -Modified NaYF4：Yb，Er。
3. The biosensor in accordance with claim 1, wherein said aptamer Apt-1 has the sequence AUGUUGGCAGCAGGGUCC; the sequence of the aptamer Apt-2 is GACGGCGUAACCUUGCCAGCUG.
4. The biosensor in accordance with claim 1, wherein said fluorescent dye is tetramethylrhodamine.
5. Biosensor according to claim 1, wherein the buffer containing metal ions is in particular Mg2+Tris-HCl-EDTA buffer.
6. A method for preparing a biosensor as claimed in any one of claims 1 to 5, comprising the steps of:
BF mixing4 -Adding the modified rare earth up-conversion material into a buffer solution containing metal ions to obtain a mixed solution, adding an aptamer Apt-1 into the mixed solution, and oscillating to obtain the buffer solution of the rare earth up-conversion nanomaterial loaded with the aptamer Apt-1, namely the buffer solution of the Apt-1-UCNPs probe;
adding Apt-2 modified with fluorescent dye into a buffer solution of an Apt-1-UCNPs probe, and incubating to obtain the biosensor.
7. The method of claim 6, wherein the Apt-2 labeled with a fluorescent dye is added to the buffer of the Apt-1-UCNPs probe to keep the concentrations of Apt-2 and Apt-1 consistent.
8. Use of a biosensor as claimed in any one of claims 1 to 5 for the detection of thyroid stimulating hormone.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111223898.5A CN113985038B (en) | 2021-10-19 | 2021-10-19 | Biosensor and preparation method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111223898.5A CN113985038B (en) | 2021-10-19 | 2021-10-19 | Biosensor and preparation method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113985038A true CN113985038A (en) | 2022-01-28 |
| CN113985038B CN113985038B (en) | 2023-04-21 |
Family
ID=79739752
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111223898.5A Active CN113985038B (en) | 2021-10-19 | 2021-10-19 | Biosensor and preparation method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113985038B (en) |
Citations (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CA2397545A1 (en) * | 2000-01-20 | 2001-07-26 | Japan Science And Technology Corporation | Method of detecting dna by dna hybridization method with the use of fluorescent resonance energy transfer |
| CN101144814A (en) * | 2007-10-22 | 2008-03-19 | 中国人民解放军第三军医大学第一附属医院 | Method for detecting, identifying and/ or quantifying compound using adapter type reagent |
| JP2009195187A (en) * | 2008-02-22 | 2009-09-03 | Olympus Corp | Screening method for nucleic acid aptamer |
| CN103649755A (en) * | 2011-05-27 | 2014-03-19 | 雅培医护站股份有限公司 | TSH immunoassays and processes for performing TSH immunoassays in the presence of endogenous contaminants in restricted wash formats |
| US20140147391A1 (en) * | 2012-11-28 | 2014-05-29 | The Hong Kong Polytechnic University | BIOPROBE BASED ON SINGLE-PHASE UPCONVERSION NANOPARTICLES (UCNPs) FOR MULTI-MODAL BIOIMAGING |
| CN104345048A (en) * | 2013-08-07 | 2015-02-11 | 杨晓林 | Method for detecting biological molecules based on upconversion luminescent material and detection system implementing same |
| CN109187473A (en) * | 2018-09-15 | 2019-01-11 | 福建医科大学 | Fluorescence resonance energy transfer based on up-conversion nano material and tetramethylrhodamine is used for the detection of excretion body |
| CN111175266A (en) * | 2020-01-19 | 2020-05-19 | 厦门大学 | Construction method and detection method of near-infrared fluorescence biosensor |
| CN112159661A (en) * | 2020-08-31 | 2021-01-01 | 南昌航空大学 | Preparation method and application of rare earth up-conversion fluorescent probe for detecting DNA damage marker |
| CN112375561A (en) * | 2020-10-27 | 2021-02-19 | 中南民族大学 | Up-conversion fluorescent nanoprobe and application thereof |
-
2021
- 2021-10-19 CN CN202111223898.5A patent/CN113985038B/en active Active
Patent Citations (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CA2397545A1 (en) * | 2000-01-20 | 2001-07-26 | Japan Science And Technology Corporation | Method of detecting dna by dna hybridization method with the use of fluorescent resonance energy transfer |
| CN101144814A (en) * | 2007-10-22 | 2008-03-19 | 中国人民解放军第三军医大学第一附属医院 | Method for detecting, identifying and/ or quantifying compound using adapter type reagent |
| JP2009195187A (en) * | 2008-02-22 | 2009-09-03 | Olympus Corp | Screening method for nucleic acid aptamer |
| CN103649755A (en) * | 2011-05-27 | 2014-03-19 | 雅培医护站股份有限公司 | TSH immunoassays and processes for performing TSH immunoassays in the presence of endogenous contaminants in restricted wash formats |
| US20140147391A1 (en) * | 2012-11-28 | 2014-05-29 | The Hong Kong Polytechnic University | BIOPROBE BASED ON SINGLE-PHASE UPCONVERSION NANOPARTICLES (UCNPs) FOR MULTI-MODAL BIOIMAGING |
| CN104345048A (en) * | 2013-08-07 | 2015-02-11 | 杨晓林 | Method for detecting biological molecules based on upconversion luminescent material and detection system implementing same |
| CN109187473A (en) * | 2018-09-15 | 2019-01-11 | 福建医科大学 | Fluorescence resonance energy transfer based on up-conversion nano material and tetramethylrhodamine is used for the detection of excretion body |
| CN111175266A (en) * | 2020-01-19 | 2020-05-19 | 厦门大学 | Construction method and detection method of near-infrared fluorescence biosensor |
| CN112159661A (en) * | 2020-08-31 | 2021-01-01 | 南昌航空大学 | Preparation method and application of rare earth up-conversion fluorescent probe for detecting DNA damage marker |
| CN112375561A (en) * | 2020-10-27 | 2021-02-19 | 中南民族大学 | Up-conversion fluorescent nanoprobe and application thereof |
Non-Patent Citations (1)
| Title |
|---|
| LIU 等: "Upconversion luminescence-based aptasensor for the detection of thyroid-stimulating hormone in serum" * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN113985038B (en) | 2023-04-21 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Yao et al. | Upconversion luminescence nanomaterials: A versatile platform for imaging, sensing, and therapy | |
| Li et al. | Upconversion nanoprobes for biodetections | |
| Sun et al. | Lanthanide upconversion and downshifting luminescence for biomolecules detection | |
| Kuningas et al. | Homogeneous assay technology based on upconverting phosphors | |
| Ji et al. | Point of care upconversion nanoparticles-based lateral flow assay quantifying myoglobin in clinical human blood samples | |
| Wu et al. | Magnetic nanobead-based immunoassay for the simultaneous detection of aflatoxin B1 and ochratoxin A using upconversion nanoparticles as multicolor labels | |
| Wang et al. | Immunoassay of goat antihuman immunoglobulin G antibody based on luminescence resonance energy transfer between near-infrared responsive NaYF4: Yb, Er upconversion fluorescent nanoparticles and gold nanoparticles | |
| Shao et al. | Near-infrared carbon dots-based fluorescence turn on aptasensor for determination of carcinoembryonic antigen in pleural effusion | |
| Wilhelm et al. | Spectrally matched upconverting luminescent nanoparticles for monitoring enzymatic reactions | |
| Chen et al. | Synthesis of improved upconversion nanoparticles as ultrasensitive fluorescence probe for mycotoxins | |
| CN110596060B (en) | Construction method and application of fluorescence sensor in spectral analysis for detecting prostate specific antigen | |
| WO2015109682A1 (en) | Paper chip, preparation method thereof and detection method for biological molecules | |
| Li et al. | Strategies for constructing upconversion luminescence nanoprobes to improve signal contrast | |
| Kuningas et al. | Simultaneous use of time-resolved fluorescence and anti-stokes photoluminescence in a bioaffinity assay | |
| Zhou et al. | Ultrasensitive electrochemiluminescent detection of cardiac troponin I based on a self-enhanced Ru (II) complex | |
| Liu et al. | A convenient and label-free fluorescence “turn off–on” nanosensor with high sensitivity and selectivity for acid phosphatase | |
| Hu et al. | A rapid and sensitive turn-on fluorescent probe for ascorbic acid detection based on carbon dots–MnO 2 nanocomposites | |
| Zhu et al. | A novel anodic electrochemiluminescence behavior of sulfur-doped carbon nitride nanosheets in the presence of nitrogen-doped carbon dots and its application for detecting folic acid | |
| Jouyban et al. | Sensors/nanosensors based on upconversion materials for the determination of pharmaceuticals and biomolecules: An overview | |
| Li et al. | Gold nanocluster-europium (III) ratiometric fluorescence assay for dipicolinic acid | |
| Gao et al. | Electrochemiluminescence immunosensor for cancer antigen 125 detection based on novel resonance energy transfer between graphitic carbon nitride and NIR CdTe/CdS QDs | |
| Li et al. | Glucose detection via glucose-induced disaggregation of ammonium-modified tetraphenylethylene from polyanion | |
| Shi et al. | Ratiometric persistent luminescence aptasensors for carcinoembryonic antigen detection | |
| Li et al. | Ratiometric fluorescence and chromaticity dual-readout assay for β-glucuronidase activity based on luminescent lanthanide metal-organic framework | |
| Zhao et al. | Conjugated polymer-based luminescent probes for ratiometric detection of biomolecules |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |