CN113981150B - DNA probe for detecting influenza B virus nucleic acid and application thereof - Google Patents
DNA probe for detecting influenza B virus nucleic acid and application thereof Download PDFInfo
- Publication number
- CN113981150B CN113981150B CN202111405188.4A CN202111405188A CN113981150B CN 113981150 B CN113981150 B CN 113981150B CN 202111405188 A CN202111405188 A CN 202111405188A CN 113981150 B CN113981150 B CN 113981150B
- Authority
- CN
- China
- Prior art keywords
- probe
- dna probe
- virus
- influenza
- nucleic acid
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6816—Hybridisation assays characterised by the detection means
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Virology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a DNA probe for detecting influenza B virus nucleic acid and application thereof, wherein the DNA probe comprises a probe H1 and a probe H2, and the DNA probe is mixed with target RNA to catalyze hairpin self-assembly reaction; the 5 'end of probe H1 is modified with biotin and the 5' end of probe H2 is modified with digoxin. According to the invention, the DNA probe and the target RNA are mixed to catalyze the hairpin self-assembly reaction to form the H1/H2 hybrid double-strand, and the combined immunochromatography test strip is verified by non-reducing polyacrylamide gel electrophoresis and real-time fluorescence monitoring, so that the influenza B virus nucleic acid can be rapidly detected with high specificity and high sensitivity in an isothermal enzyme-free environment, the on-site instant detection of the influenza B virus is realized, the operation is simple and convenient, the detection cost is low, and the detection difficulty of medical workers is reduced.
Description
Technical Field
The invention relates to the technical field of biological detection, in particular to a DNA probe for detecting influenza B virus nucleic acid and application thereof.
Background
Influenza virus belongs to orthomyxoviridae, is a respiratory virus, is transmitted through aerosol and spray, is generally susceptible to crowds, and takes symptoms such as fever, muscle soreness, nasal obstruction, nasal discharge and the like as main clinical manifestations. Because influenza manifestations lack specificity and are difficult to distinguish from other diseases, early diagnosis of influenza b is critical for developing viral therapies and controlling infections.
Currently, the gold standard for clinical diagnosis of influenza b virus is reverse transcription polymerase chain reaction (RT-PCR). However, the RT-PCR method has complicated operation, time consumption, high requirements on instruments and equipment, and high requirements on the technical requirements of operators, and is difficult to develop point of care testing (POCT) in remote areas and small hospitals, so it is necessary to explore an influenza b virus detection method which is easy and fast to operate and has both sensitivity and specificity
Disclosure of Invention
The invention aims to provide a DNA probe for detecting influenza B virus nucleic acid and application thereof, which solve the technical problems, and can rapidly detect influenza B virus with high sensitivity and high specificity under isothermal enzyme-free amplification environment by combining a DNA probe and target RNA mixed catalysis hairpin self-assembly reaction with an immunochromatography test strip, so as to realize the on-site instant detection of influenza B virus.
The aim of the invention can be achieved by the following technical scheme:
a DNA probe for detecting influenza b virus nucleic acid, the DNA probe comprising probe H1 and probe H2, the sequences being as follows:
DNA probe H1:
ATTGGATGTTACTACCATGAGGCTCCATTTCACTCGCTCATGGTAGTAAC
DNA probe H2:
CCATGAGCGAGTGAAATGGAGCCTCATGGTAGTAACGCTCCATTTCACTCG
the DNA probe is mixed with target RNA to catalyze hairpin self-assembly reaction.
Further, the probe H1 and the probe H2 are both hairpin structures, the 5 'end of the probe H1 is modified by biotin, and the 5' end of the probe H2 is modified by digoxin.
Further, the target RNA selects a conserved sequence of 21 bases in length by sequence alignment.
Further, the catalytic hairpin self-assembly reaction is that the target RNA triggers a reaction to form an H1/H2 hybrid double strand after the DNA probe is mixed with the target RNA.
The application of the DNA probe for detecting the influenza B virus nucleic acid comprises the following steps:
s1, designing a DNA probe according to target RNA
Downloading an influenza B virus sequence in an NCBI influenza database, finding a conserved sequence through MAFFT sequence comparison function, designing a hairpin DNA probe in NUPACK according to the conserved sequence, modifying the 5 'end of hairpin DNA H1 by biotin, and modifying the 5' end of probe H2 by digoxin;
s2, mixing the DNA probe and the target RNA to catalyze the hairpin self-assembly reaction
Mixing 40-60 mu L of probe H1, 40-60 mu L of probe H2 and 40-60 mu L of target RNA, and reacting in a water bath kettle at 25-40 ℃ for 15-30min to generate H1/H2 hybrid double chains;
s3, dripping 70-80 mu L of the reaction solution obtained in the step S2 into an immunochromatography test strip, and waiting for 10-20
S4, detecting a fluorescence result by the immunochromatography test strip in the step S3 through an immunochromatography quantitative analyzer.
Further, in the step S2, the concentrations of the probe H1 and the probe H2 are 3nmol/L.
Further, the immunochromatographic test strip is composed of a sample pad, a binding pad, a nitrocellulose membrane and an absorption pad.
Further, the binding pad is coated with Alexa Fluor647 fluorescein and Streptavidin (SA) double-labeled nano-microspheres, and the nitrocellulose membrane is marked with a detection line and a quality control line; the detection line is prepared by spraying anti-digoxin/digoxin monoclonal antibody, and biotin is smeared on the quality control line.
Further, the DNA probe and target RNA are mixed to catalyze the hairpin self-assembly reaction product to be verified through non-reducing polyacrylamide gel electrophoresis and real-time fluorescence monitoring.
Further, the step S4 carries out specific analysis by detecting fluorescent values of single-base mutant RNA and double-base mutant RNA;
single base mutant RNA sequence: CUCAUGGUAGUUACAUCCAAU
Double base mutant RNA sequence: CUCGUGGUAGUUACAUCCAAU.
The invention has the beneficial effects that:
according to the invention, the DNA probe and the target RNA are mixed to catalyze the hairpin self-assembly reaction to form the H1/H2 hybrid double-strand, and the combined immunochromatography test strip is verified by non-reducing polyacrylamide gel electrophoresis and real-time fluorescence monitoring, so that the influenza B virus nucleic acid can be rapidly detected with high specificity and high sensitivity in an isothermal enzyme-free environment, the on-site instant detection of the influenza B virus is realized, the operation is simple and convenient, the detection cost is low, and the detection difficulty of medical workers is reduced.
Drawings
The invention is further described below with reference to the accompanying drawings.
FIG. 1 is a schematic illustration of the reaction principle of the catalytic hairpin self-assembly of the invention;
FIG. 2 is a schematic diagram of the principle of detecting double-strand H1/H2 hybridization of digoxin and biotin double-label by using the immunochromatographic test strip of the invention;
FIG. 3 is a schematic diagram of the results of a feasibility analysis of catalytic hairpin DNA self-assembly for detecting influenza B virus;
FIG. 4 is a schematic diagram showing the feasibility of the electrophoresis verification of the catalytic hairpin self-assembly detection of influenza B virus according to the invention;
FIG. 5 is a schematic diagram of the sensitivity analysis result of the detection system of the catalytic hairpin DNA self-assembly combined immunochromatography test strip of the invention;
FIG. 6 is a graph showing the linear relationship between the concentration of target RNA and fluorescence value;
FIG. 7 is a schematic diagram showing the result of specific analysis of the detection system of the catalytic hairpin DNA self-assembly combined immunochromatography test strip.
Detailed Description
The following description of the embodiments of the present invention will be made clearly and completely with reference to the accompanying drawings, in which it is apparent that the embodiments described are only some embodiments of the present invention, but not all embodiments. All other embodiments, which can be made by those skilled in the art based on the embodiments of the invention without making any inventive effort, are intended to be within the scope of the invention.
1. Preparation of detection probe freeze-dried powder
The target RNA of the invention realizes sequence comparison through MAFFT, a conserved sequence with the length of 21 bases in the influenza B virus gene is screened out as a detection target, DNA probes are designed through NUPACK software, and the designed probes are H1 and H2 respectively, and the sequences are as follows:
table 1: influenza b virus target RNA and probe sequences
Probes H1 and H2 are respectively modified with Biotin (Biotin) at the 5 'end of H1 and Digoxin (Digoxin) at the 5' end of H2, when target RNA exists, the target RNA triggers a reaction, the hairpin probes H1 and H2 are sequentially opened, and Digoxin and Biotin double-labeled H1/H2 hybridization double chains are formed due to sequence complementation, as shown in figure 1;
the prepared probe was dissolved in TNaK buffer (20X 10) -3 mol/LTris,pH 7.5；40×10 -3 mol/L NaCl；5×10 -3 mol/LKCl), annealing, placing the probe in a water bath kettle at 95 ℃, naturally cooling to room temperature, keeping the hairpin structure of the probe, and placing the probe at-20 ℃ for standby.
2. Feasibility analysis of catalytic hairpin DNA self-assembly for detecting influenza B virus
1. Real-time fluorescent quantitative PCR monitors the progress of the catalytic hairpin self-assembly reaction.
Probe H2 labeled fluorescent group (FAM) and quenching group (BHQ 1) were synthesized and purified by Shanghai engineering bioengineering company. The reaction temperature was set at 37℃and the reaction was carried out for 30 seconds for 80 cycles, with 10. Mu.L of 900nmol/L H1, 900nmol/L H2 and 900nmol/L of target RNA each, and the reaction was detected by the CFX96Real-Time System.
As shown in FIG. 3, the real-time fluorescence quantitative curve shows that when the target RNA does not exist, only weak fluorescence close to a blank group exists, and when the target sequence and the probe exist simultaneously, the hairpin of the probe H1 and the hairpin of the probe H2 are sequentially opened, so that a large number of H1/H2 hybridization double chains are finally formed, and an obvious fluorescence curve is generated.
2. Non-denaturing polyacrylamide gel electrophoresis (Native-PAGE) verifies the catalytic hairpin assembly reaction.
Preparing 12% non-denaturing polyacrylamide gel, diluting the annealed probes H1 and H2 and target RNA to 900nmol/L, taking 10 mu L of each of H1, H2 and target RNA, uniformly mixing, and then carrying out water bath at 37 ℃ for 15 minutes;
add 4. Mu.L of 6 Xloading buffer, mix, load 15. Mu.L of the mixture, electrophorese at 120V for 60 minutes, dye the electrophoresis gel with EB for 10 minutes, and image by gel imager. Electrophoresis bands 1-7 each: probe H1, probe H2, target RNA, probe h1+ probe H2, probe h1+ target RNA, probe h2+ target RNA, probe h1+ probe h2+ target RNA.
As shown in FIG. 4, lane 4 shows that the designed two probes H1 and H2 bind weakly spontaneously in the absence of target RNA, and lane 7 shows that a bright new band, H1/H2 hybrid, is produced when H1, H2 and target RNA are added.
3. Sensitivity analysis of catalytic hairpin DNA self-assembly combined immunochromatography test strip detection system
Diluting target RNA with pharyngeal swab virus preservation solution with concentration of 1nmol/L, 800pmol/L, 600pmol/L, 500pmol/L, 400pmol/L, 200pmol/L, 100pmol/L, 50pmol/L, 10pmol/L, and 1pmol/L respectively;
mixing 50 mu L of target RNA with different concentrations with 50 mu L H1 (3 nmol/L) and 50 mu L H2 (3 nmol/L) respectively, and reacting in a water bath kettle at 25 ℃ for 15 minutes (the optimal concentration ratio of probe H1 to probe H2 is 1:1, the optimal reaction temperature is 25 ℃, and the temperature is optimized);
and (2) dropwise adding 75 mu L of reaction liquid into an immunochromatographic test strip, wherein FIG. 2 is a schematic diagram of the principle of double-strand hybridization of double-labeled H1/H2 of digoxin and biotin detected by the immunochromatographic test strip, the immunochromatographic test strip consists of a sample pad, a binding pad, a nitrocellulose membrane and an absorption pad, the binding pad is coated with AlexaFluor647 fluorescein and Streptavidin (SA) double-labeled nano microspheres, the nitrocellulose membrane is labeled with a detection line (T line) and a quality control line (C line), the detection line is prepared by spraying digoxin/digoxin monoclonal antibody, biotin is smeared on the quality control line, and fluorescent values at the detection line and the quality control line are read on an immunofluorescence quantitative analyzer after 15 minutes.
As shown in FIG. 5 and FIG. 6, as the concentration of target RNA decreases, the fluorescence value also decreases, the concentration of the lowest detectable target RNA in the study is 1pmol/L, the concentration of target RNA and the fluorescence value are in a linear relationship, and the regression equation is Y=11.64×X+1314, R 2 ＝0.9801。
4. Specific analysis of catalytic hairpin DNA self-assembly combined immunochromatography test strip detection system
Single base mutant RNA (SM) and double base mutant RNA (DM) were designed from target RNAs, the sequences of which are shown in table 2:
table 2: single base mutant RNA (SM) and double base mutant RNA (DM) sequences
| Name | Sequence information(5’-3’) |
| SM | CUCAUGGUAGUUACAUCCAAU |
| DM | CUCGUGGUAGUUACAUCCAAU |
Diluting two sequences to 3nmol/L with pharyngeal swab virus preservation solution, taking 50 mu L of mutant RNA (3 nmol/L) and 50 mu L of probe H1 (3 nmol/L) and 50 mu L of probe H2 (3 nmol/L), mixing well, reacting in a water bath kettle at 37 ℃ for 15 minutes to obtain reaction solution;
and (3) dripping 75 mu L of the reaction solution into an immunochromatographic test strip, and reading fluorescence values at a detection line and a quality control line on an immunochromatographic quantitative analyzer after 15 minutes.
The detection result is shown in figure 7, and the fluorescence value detected by the target detection sequence is obviously different from the fluorescence value detected by the mutation sequence, so that the detection method has higher specificity for detecting the influenza B virus.
In the description of the present specification, the descriptions of the terms "one embodiment," "example," "specific example," and the like, mean that a particular feature, structure, material, or characteristic described in connection with the embodiment or example is included in at least one embodiment or example of the present invention. In this specification, schematic representations of the above terms do not necessarily refer to the same embodiments or examples. Furthermore, the particular features, structures, materials, or characteristics described may be combined in any suitable manner in any one or more embodiments or examples.
The foregoing has shown and described the basic principles, principal features and advantages of the invention. It will be understood by those skilled in the art that the present invention is not limited to the embodiments described above, and that the above embodiments and descriptions are merely illustrative of the principles of the present invention, and various changes and modifications may be made without departing from the spirit and scope of the invention, which is defined in the appended claims.
Sequence listing
<110> university of southeast
<120> a DNA probe for detecting influenza B virus nucleic acid and application thereof
<160> 5
<170> SIPOSequenceListing 1.0
<210> 1
<211> 50
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 1
attggatgtt actaccatga ggctccattt cactcgctca tggtagtaac 50
<210> 2
<211> 51
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 2
ccatgagcga gtgaaatgga gcctcatggt agtaacgctc catttcactc g 51
<210> 3
<211> 21
<212> RNA
<213> Artificial sequence (Artificial Sequence)
<400> 3
cucaugguag uaacauccaa u 21
<210> 4
<211> 21
<212> RNA
<213> Artificial sequence (Artificial Sequence)
<400> 4
cucaugguag uuacauccaa u 21
<210> 5
<211> 21
<212> RNA
<213> Artificial sequence (Artificial Sequence)
<400> 5
cucgugguag uuacauccaa u 21
Claims (7)
1. A DNA probe for detecting influenza b virus nucleic acid, wherein the DNA probe comprises probe H1 and probe H2, and has the following sequence:
DNA probe H1:
ATTGGATGTTACTACCATGAGGCTCCATTTCACTCGCTCATGGTAGTAAC
DNA probe H2:
CCATGAGCGAGTGAAATGGAGCCTCATGGTAGTAACGCTCCATTTCACTC G
the DNA probe and target RNA are mixed to catalyze hairpin self-assembly reaction;
the probe H1 and the probe H2 are both in hairpin structures, the 5 'end of the probe H1 is modified by biotin, and the 5' end of the probe H2 is modified by digoxin.
2. The DNA probe for detecting influenza b virus nucleic acid of claim 1, wherein the catalytic hairpin self-assembly reaction is a reaction triggered by the target RNA to form an H1/H2 hybrid duplex after the DNA probe is mixed with the target RNA.
3. Use of a DNA probe for detecting influenza b virus nucleic acid according to any one of claims 1-2 in the preparation of a kit for detecting influenza b virus, wherein the DNA probe is used for influenza virus nucleic acid detection, comprising the steps of:
s1, designing a DNA probe according to target RNA
Downloading an influenza B virus sequence in an NCBI influenza database, finding a conserved sequence through MAFFT sequence comparison function, designing a hairpin DNA probe in NUPACK according to the conserved sequence, modifying the 5 'end of hairpin DNA H1 by biotin, and modifying the 5' end of probe H2 by digoxin;
s2, mixing the DNA probe and the target RNA to catalyze the hairpin self-assembly reaction
Mixing 40-60 mu L of probe H1, 40-60 mu L of probe H2 and 40-60 mu L of target RNA, and reacting in a water bath kettle at 25-40 ℃ for 15-30min to generate H1/H2 hybrid double chains;
s3, dripping 70-80 mu L of the reaction liquid obtained in the step S2 into an immunochromatography test strip, and waiting for 10-20min;
s4, detecting a fluorescence result by the immunochromatography test strip in the step S3 through an immunochromatography quantitative analyzer.
4. The use of the DNA probe for detecting influenza b virus nucleic acid according to claim 3 for preparing a kit for detecting influenza b virus, wherein the concentrations of probe H1 and probe H2 in step S2 are 3nmol/L.
5. The use of a DNA probe for detecting influenza b virus nucleic acid according to claim 3 in the preparation of a kit for detecting influenza b virus, wherein the immunochromatographic test strip is composed of a sample pad, a binding pad, a nitrocellulose membrane, and an absorption pad.
6. The application of the DNA probe for detecting influenza B virus nucleic acid in preparing a kit for detecting influenza B virus according to claim 5, wherein the binding pad is coated with AlexaFluor647 fluorescein and streptavidin double-labeled nano-microspheres, and a nitrocellulose membrane is marked with a detection line and a quality control line; the detection line is prepared by spraying anti-digoxin monoclonal antibody, and biotin is smeared on the quality control line.
7. The use of a DNA probe for detecting influenza b virus nucleic acid according to claim 3 in the preparation of a kit for detecting influenza b virus, wherein the DNA probe and target RNA mix-catalyzed hairpin self-assembly reaction product is verified by non-reducing polyacrylamide gel electrophoresis and real-time fluorescence monitoring.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111405188.4A CN113981150B (en) | 2021-11-24 | 2021-11-24 | DNA probe for detecting influenza B virus nucleic acid and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111405188.4A CN113981150B (en) | 2021-11-24 | 2021-11-24 | DNA probe for detecting influenza B virus nucleic acid and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113981150A CN113981150A (en) | 2022-01-28 |
| CN113981150B true CN113981150B (en) | 2023-08-22 |
Family
ID=79750302
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111405188.4A Active CN113981150B (en) | 2021-11-24 | 2021-11-24 | DNA probe for detecting influenza B virus nucleic acid and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113981150B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115932238A (en) * | 2022-08-05 | 2023-04-07 | 南京鼓楼医院 | Probe and test strip for SFTS virus nucleic acid detection and use method |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109576352A (en) * | 2018-11-25 | 2019-04-05 | 江苏宏微特斯医药科技有限公司 | Single tube detects method, probe and its kit of multiple object to be measured nucleic acid sequences |
| CN110951918A (en) * | 2019-12-19 | 2020-04-03 | 武汉中帜生物科技股份有限公司 | Kit for jointly detecting influenza A virus and influenza B virus based on RNA isothermal amplification-gold probe chromatography technology and application thereof |
| CN113667775A (en) * | 2021-08-23 | 2021-11-19 | 东南大学 | DNA probe and test strip for HCV virus nucleic acid detection and application thereof |
-
2021
- 2021-11-24 CN CN202111405188.4A patent/CN113981150B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109576352A (en) * | 2018-11-25 | 2019-04-05 | 江苏宏微特斯医药科技有限公司 | Single tube detects method, probe and its kit of multiple object to be measured nucleic acid sequences |
| CN110951918A (en) * | 2019-12-19 | 2020-04-03 | 武汉中帜生物科技股份有限公司 | Kit for jointly detecting influenza A virus and influenza B virus based on RNA isothermal amplification-gold probe chromatography technology and application thereof |
| CN113667775A (en) * | 2021-08-23 | 2021-11-19 | 东南大学 | DNA probe and test strip for HCV virus nucleic acid detection and application thereof |
Non-Patent Citations (1)
| Title |
|---|
| 荧光定量RT-PCR快速检测乙型流感病毒核酸;卢亦愚, 严菊英, 冯燕, 史雯, 茅海燕;浙江预防医学;第17卷(第03期);第1-3页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN113981150A (en) | 2022-01-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110551846A (en) | cpf1 kit for quickly detecting African swine fever virus nucleic acid and detection method thereof | |
| WO2022057060A1 (en) | Method and kit for multiple detection of respiratory virus nucleic acids | |
| Xiong et al. | One-pot platform for rapid detecting virus utilizing recombinase polymerase amplification and CRISPR/Cas12a | |
| CN111235313A (en) | CRISPR-Cas13 method for rapidly detecting novel coronavirus | |
| CN111304366B (en) | Novel coronavirus COVID-19 nucleic acid detection method and kit | |
| CN113981150B (en) | DNA probe for detecting influenza B virus nucleic acid and application thereof | |
| WO2021136559A1 (en) | Method for distinguishing human dna based on fluorescent quantitative pcr technology | |
| CN115011713B (en) | Mycobacterium bovis detection probe set based on DNAzyme double-circulation system and detection method thereof | |
| CN111521781B (en) | Detection kit for SARS-CoV-2 nucleic acid of new coronary pneumonia virus and detection method thereof | |
| CN112501257B (en) | Visualization sensor based on nucleic acid self-assembly enzyme-catalysis-free circRNA living cell imaging | |
| CN110938708B (en) | Kit for detecting H7N9 avian influenza virus based on isothermal amplification technology and application thereof | |
| CN110904194B (en) | Mycoplasma pneumoniae and Chlamydia pneumoniae nucleic acid combined detection kit and application thereof | |
| CN113755643B (en) | DNA probe for detecting influenza A virus nucleic acid and application thereof | |
| CN116356079A (en) | RPA-CRISPR-Cas12a based visual detection kit for detecting Gaota virus and application | |
| CN114085927B (en) | DNA probe for detecting respiratory syncytial virus nucleic acid and application thereof | |
| CN110923363A (en) | Kit for detecting pathogenic nucleic acid of hand-foot-and-mouth disease and application thereof | |
| CN113667775B (en) | DNA probe and test strip for HCV virus nucleic acid detection and application thereof | |
| CN106319091B (en) | The multi-fluorescence immunoassay method and kit of a kind of quick differentiation canine distemper virus, canine parvovirus and rabies viruses | |
| CN115838834A (en) | Human rhinovirus type A and type C detection system based on RT-RAA and CRISPR/Cas12a | |
| CN112553379B (en) | Method and kit for detecting respiratory infectious disease virus based on liquid chip | |
| CN110129043B (en) | Preparation method of carbon quantum dots and kit and method for detecting nucleic acid | |
| Gao et al. | Rapid isothermal detection assay: a probe amplification method for the detection of nucleic acids | |
| CN114807435A (en) | Kit for detecting respiratory syncytial virus and application thereof | |
| CN106755600A (en) | A kind of PCR kit for fluorescence quantitative for detecting Zaire type Ebola virus | |
| CN109576394A (en) | It is a kind of detect Nebovirus SYBR Green fluorescence quantitative RT-PCR primer and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |