CN113981146B - Multiplex RT-PCR method and kit for simultaneously detecting TSWV, TZSV, PCSV, INSV four viruses - Google Patents
Multiplex RT-PCR method and kit for simultaneously detecting TSWV, TZSV, PCSV, INSV four viruses Download PDFInfo
- Publication number
- CN113981146B CN113981146B CN202111357953.XA CN202111357953A CN113981146B CN 113981146 B CN113981146 B CN 113981146B CN 202111357953 A CN202111357953 A CN 202111357953A CN 113981146 B CN113981146 B CN 113981146B
- Authority
- CN
- China
- Prior art keywords
- muf
- mur
- tzsv
- insv
- pcsv
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
- 241000016010 Tomato spotted wilt orthotospovirus Species 0.000 title claims abstract description 23
- 241000712893 Impatiens necrotic spot virus Species 0.000 title claims abstract description 22
- 238000003757 reverse transcription PCR Methods 0.000 title claims abstract description 22
- 241000700605 Viruses Species 0.000 title claims abstract description 20
- 241000744791 Pepper chlorotic spot virus Species 0.000 title claims abstract description 19
- 241001097253 Tomato zonate spot virus Species 0.000 title claims abstract description 19
- 238000000034 method Methods 0.000 title claims abstract description 18
- 238000006243 chemical reaction Methods 0.000 claims description 7
- 238000000137 annealing Methods 0.000 claims description 5
- 239000002299 complementary DNA Substances 0.000 claims description 5
- 238000004925 denaturation Methods 0.000 claims description 5
- 230000036425 denaturation Effects 0.000 claims description 5
- 238000001514 detection method Methods 0.000 abstract description 14
- 235000002566 Capsicum Nutrition 0.000 abstract description 3
- 241000723681 Tomato ringspot virus Species 0.000 abstract description 3
- 208000006278 hypochromic anemia Diseases 0.000 abstract description 3
- 230000035945 sensitivity Effects 0.000 abstract description 3
- 240000008574 Capsicum frutescens Species 0.000 abstract description 2
- 239000001390 capsicum minimum Substances 0.000 abstract description 2
- 235000002637 Nicotiana tabacum Nutrition 0.000 description 24
- 241000208125 Nicotiana Species 0.000 description 22
- 239000000047 product Substances 0.000 description 13
- 230000003321 amplification Effects 0.000 description 5
- 238000003199 nucleic acid amplification method Methods 0.000 description 5
- HEDRZPFGACZZDS-UHFFFAOYSA-N Chloroform Chemical compound ClC(Cl)Cl HEDRZPFGACZZDS-UHFFFAOYSA-N 0.000 description 4
- 241000196324 Embryophyta Species 0.000 description 4
- LFQSCWFLJHTTHZ-UHFFFAOYSA-N Ethanol Chemical compound CCO LFQSCWFLJHTTHZ-UHFFFAOYSA-N 0.000 description 4
- 201000010099 disease Diseases 0.000 description 4
- 208000037265 diseases, disorders, signs and symptoms Diseases 0.000 description 4
- 230000001338 necrotic effect Effects 0.000 description 4
- 239000006228 supernatant Substances 0.000 description 4
- 241001414989 Thysanoptera Species 0.000 description 3
- 239000007788 liquid Substances 0.000 description 3
- 238000004519 manufacturing process Methods 0.000 description 3
- IJGRMHOSHXDMSA-UHFFFAOYSA-N Atomic nitrogen Chemical compound N#N IJGRMHOSHXDMSA-UHFFFAOYSA-N 0.000 description 2
- KFZMGEQAYNKOFK-UHFFFAOYSA-N Isopropanol Chemical compound CC(C)O KFZMGEQAYNKOFK-UHFFFAOYSA-N 0.000 description 2
- 244000061176 Nicotiana tabacum Species 0.000 description 2
- 238000002474 experimental method Methods 0.000 description 2
- PHTQWCKDNZKARW-UHFFFAOYSA-N isoamylol Chemical compound CC(C)CCO PHTQWCKDNZKARW-UHFFFAOYSA-N 0.000 description 2
- 238000002156 mixing Methods 0.000 description 2
- 238000012257 pre-denaturation Methods 0.000 description 2
- 238000010839 reverse transcription Methods 0.000 description 2
- 208000024891 symptom Diseases 0.000 description 2
- 241000927584 Frankliniella occidentalis Species 0.000 description 1
- 235000007688 Lycopersicon esculentum Nutrition 0.000 description 1
- 239000006002 Pepper Substances 0.000 description 1
- 241000722363 Piper Species 0.000 description 1
- 235000016761 Piper aduncum Nutrition 0.000 description 1
- 235000017804 Piper guineense Nutrition 0.000 description 1
- 235000008184 Piper nigrum Nutrition 0.000 description 1
- 240000003768 Solanum lycopersicum Species 0.000 description 1
- 239000011543 agarose gel Substances 0.000 description 1
- 238000000246 agarose gel electrophoresis Methods 0.000 description 1
- 239000008346 aqueous phase Substances 0.000 description 1
- 230000005540 biological transmission Effects 0.000 description 1
- 238000010805 cDNA synthesis kit Methods 0.000 description 1
- 230000007547 defect Effects 0.000 description 1
- 230000006806 disease prevention Effects 0.000 description 1
- 238000001962 electrophoresis Methods 0.000 description 1
- 238000005516 engineering process Methods 0.000 description 1
- 235000019441 ethanol Nutrition 0.000 description 1
- 238000000605 extraction Methods 0.000 description 1
- 239000000499 gel Substances 0.000 description 1
- 238000000227 grinding Methods 0.000 description 1
- 238000003306 harvesting Methods 0.000 description 1
- 238000003384 imaging method Methods 0.000 description 1
- 230000006698 induction Effects 0.000 description 1
- 238000011081 inoculation Methods 0.000 description 1
- 238000011835 investigation Methods 0.000 description 1
- 238000002844 melting Methods 0.000 description 1
- 230000008018 melting Effects 0.000 description 1
- 229910052757 nitrogen Inorganic materials 0.000 description 1
- 244000052769 pathogen Species 0.000 description 1
- 239000012071 phase Substances 0.000 description 1
- 239000002244 precipitate Substances 0.000 description 1
- 238000006467 substitution reaction Methods 0.000 description 1
- 230000001502 supplementing effect Effects 0.000 description 1
- 230000009466 transformation Effects 0.000 description 1
- 238000010792 warming Methods 0.000 description 1
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 description 1
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/16—Primer sets for multiplex assays
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Genetics & Genomics (AREA)
- Virology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a multiplex RT-PCR method and a kit for simultaneously detecting TSWV, TZSV, PCSV, INSV four viruses, wherein the related methods and the kit comprise four groups of primers: PCSV-muF/PCSV-muR, INSV-muF/INSV-muR, TSWV-muF/TSWV-muR, TZSV-muF/TZSV-muR. The primer has the advantages of strong specificity and high sensitivity, is very efficient in the actual multiplex RT-PCR detection process, and can detect Tomato Spotted Wilt Virus (TSWV), tomato ring spot virus (Tomato zonate spot virus, TZSV), impatiens necrotic spot virus (Impatiens necrotic spot virus, INSV) and capsicum chlorosis spot virus (Pepper chlorotic spot virus, PCSV) simultaneously.
Description
Technical Field
The invention relates to the technical field of molecular plant virology virus detection, in particular to an RT-PCR primer group for simultaneously detecting four tomato spotted wilt virus viruses in tobacco and a detection method thereof.
Background
Tobacco leaf spot caused by thrips transmitted tomato leaf spot viruses (toscoviruses) is a new disease of tobacco that has emerged in recent years. Before 2007, the disease is sporadically generated in Yunnan province, and then aggravated year by year, and outbreaks are epidemic in Yunnan Kunming, red river and Wenshan tobacco areas before and after 2010, the incidence rate is usually 10-30%, the incidence rate of serious tobacco areas is more than 90%, huge losses are caused for local tobacco leaf production, and partial serious tobacco fields are out of harvest. In recent years, along with factors such as spreading of frankliniella occidentalis in the whole country and climate warming, tobacco leaf spot wilt gradually occurs and prevails in other tobacco regions, and at present, tobacco leaf producing regions such as Sichuan, guangxi, gansu, shandong and Heilongjiang are also generated besides Yunnan.
According to the investigation result in recent years, tobacco leaf spot is most easily infected by flue-cured tobacco before the period of the glowing peak mainly concentrated at the end of the period of the group and the early stage of vigorous growth, leaf spot can be observed in the period of the picking and baking, but the incidence rate is low. After the tobacco is infected in early growth stage, necrotic spots or necrotic concentric rings are formed on the leaves, part of the leaves are necrotic, growing points are necrotic, head-distorting symptoms are formed, and the whole plant of the tobacco is dead, so that great loss is caused to tobacco production.
More than 20 Tospiraries are reported in the world, tobacco can be infected by mechanical inoculation and thrips virus transmission under experimental conditions, and currently 4 tomato spotted wilt viruses are mainly detected as tobacco spotted wilt pathogens in China, namely Tomato Spotted Wilt Virus (TSWV), tomato ring spot virus (Tomato zonate spot virus, TZSV), impatiens necrotic spot virus (Impatiens necrotic spot virus, INSV) and pepper chlorosis spot virus (Pepper chlorotic spot virus, PCSV).
At present, no tobacco leaf spot disease resistant variety exists, and the tobacco leaf spot disease prevention and control weight is used for preventing and controlling thrips in production, and the plant resistance is improved by adopting technologies such as tobacco plant resistance induction and the like. The symptoms generated by the four tomato spotted wilt virus viruses on tobacco are basically consistent, and can not be distinguished by naked eyes, and can only be determined by a molecular detection means. The RT-PCR has the advantages of high sensitivity, strong specificity, high detection efficiency, low cost and the like, and is the detection method which is most widely applied in the current plant virus detection. The single RT-PCR detection means of the four viruses are mature, but the multiple PCR detection method for the four viruses is not reported at home and abroad.
Disclosure of Invention
The invention aims to solve the defects, and provides a multiplex RT-PCR method and a kit for simultaneously detecting TSWV, TZSV, PCSV, INSV four viruses.
The invention is realized by adopting the following technical scheme.
The invention discloses a multiplex RT-PCR method for simultaneously detecting TSWV, TZSV, PCSV, INSV four viruses, which comprises the following four groups of primers:
PCSV-muF：5'-GTTCGTTTTCTGCGGTAAGCAAA-3'；
PCSV-muR：5-AGCAACATCATAATTGGGAGG-3'；
INSV-muF：5-GAACATGACTACTGCATCTTG-3'；
INSV-muR：5-TAGACATGTCAATTCCAAGC-3'；
TSWV-muF：5-GATGAGTGTTATTTCATGTCTGAC-3'；
TSWV-muR：5-CAAGCTATCAAGCCTTCTGAAG-3'；
TZSV-muF：5-CAAGAACTATTGGCTGGAG-3'；
TZSV-muR：5-GCTGCTCTTCTTCTTTGGTGCCTG-3'。
further, the PCR reaction system in the method of the present invention is 30ul in total, wherein 2xPCRmix 15ul,cDNA template is 1.5ul, TSWV-muF/TSWV-muR is 0.5ul each, TZSV-muF/TZSV-muR is 0.3-0.4ul each, INSV-muF is 0.2ul, INSV-muR is 0.3 ul, PCSV-muF/PCSV-muR is 0.4-0.5ul each, ddH 2 Supplementing O to 30ul; the primer concentrations in the above systems were 10. Mu.M.
Further, the PCR reaction procedure in the method of the invention is that the pre-denaturation is carried out at 95 ℃ for 3min, the denaturation is carried out at 94 ℃ for 30s, the annealing is carried out at 54 ℃ for 30-35s, the extension is carried out at 72 ℃ for 40s, the total of 32 cycles of denaturation, annealing and extension are repeated, and the extension is carried out at 72 ℃ for 5min.
Further, the size of the amplified product of the primer group PCSV-muF/PCSV-muR is 220bp.
Furthermore, the amplified product of the primer group INSV-muF/INSV-muR has the size of 422bp.
Further, the size of the amplified product of the primer set TSWV-muF/TSWV-muR is 157bp.
Further, the size of the amplified product of the primer set TZSV-muF/TZSV-muR is 779bp.
A detection kit comprising the above primer set.
The primer has the advantages of strong specificity and high sensitivity, is very efficient in the actual multiplex RT-PCR detection process, and can detect Tomato Spotted Wilt Virus (TSWV), tomato ring spot virus (Tomato zonate spot virus, TZSV), impatiens necrotic spot virus (Impatiens necrotic spot virus, INSV) and capsicum chlorosis spot virus (Pepper chlorotic spot virus, PCSV) simultaneously.
The invention is further explained below with reference to the drawings and the detailed description.
Drawings
FIG. 1 shows the simultaneous detection TSWV, TZSV, PCSV and INSV electrophoresis patterns of the multiplex RT-PCR of the present invention.
Detailed Description
The invention designs a primer group comprising 8 primers, wherein the TSWV-muF/TSWV-muR primer pair is a specific primer for amplifying TSWV, and the size of a product is 157bp; the TZSV-muF/TZSV-muR primer pair is a specific primer for amplifying TZSV, and the size of the product is 779bp; the INSV-muF/INSV-muR primer pair is a specific primer for amplifying the INSV, and the product size is 422bp; the PCSV-muF/PCSV-muR primer pair is a specific primer for amplifying PCSV, the size of the product is 220bp, the sequences of the primer set are shown in Table 1, and the primers are synthesized by the Proteects of the family of the biological sciences, inc. (Kunming).
TABLE 1 primers for multiplex RT-PCR detection of TSWV, TZSV, INSV, PCSV four viruses
The method for simultaneously detecting four tomato spotted wilt virus viruses in TSWV, TZSV, INSV, PCSV tobacco by using the primer set for multiplex RT-PCR comprises the following steps:
1. extracting RNA of suspected tobacco leaf spot disease incidence leaves (Trizol method extraction, invitrogen, cat. No. 10296028);
a. taking 0.1g of diseased leaves, and fully grinding liquid nitrogen;
b. rapidly adding 1000 mu l of Trizol liquid before melting the sample, and sufficiently shaking and uniformly mixing to dissolve the sample into brown transparent liquid under the protection of the Trizol;
c.4 ℃ and 12000rpm for 10min, taking supernatant into a new 1.5ml centrifuge tube;
d. adding 200 μl of chloroform, shaking vigorously for 20s, standing at room temperature for 5min, centrifuging at 12000rpm at 4deg.C for 10min, and transferring the upper aqueous phase into a new centrifuge tube;
e. adding equal volume of chloroform/isoamyl alcohol (24:1), shaking vigorously for 20s, standing at room temperature for 3min, centrifuging at 12000rpm for 10min at 4 ℃, and transferring the upper water phase into a new centrifuge tube;
f. adding equal volume of isopropanol, mixing, standing at-20deg.C for half an hour, and centrifuging at 12000rpm at 4deg.C for 10min;
g. pouring out the supernatant, adding 1000ul of 75% ethanol, and centrifuging at 12000rpm at 4 ℃ for 10min;
h. pouring out the supernatant, adding 1000ul of absolute ethyl alcohol, and centrifuging at 12000rpm at 4 ℃ for 5min;
i. pouring out the supernatant to leave a precipitate, draining, airing, and adding ddH 2 O40 μl was dissolved and stored at-80deg.C for subsequent experiments
2. RNA reverse transcription to obtain cDNA
cDNA was synthesized by reverse transcription using the instructions of the Takara PrimeScrip IV one-strand cDNA synthesis kit (cat. No. 6215).
3. Multiplex RT-PCR
The optimal reaction system and PCR reaction program are designed according to the characteristics of the primer group.
A PCR reaction system was 30ul, wherein 2xPCRMix 15ul, 1.5ul of the cDNA template obtained in step 2, 0.5ul each of TSWV-muF/TSWV-muR, 0.3 to 0.4ul each of TZSV-muF/TZSV-muR, 0.2ul each of INSV-muF, 0.3 ul each of INSV-muR, 0.4 to 0.5ul each of PCSV-muF/PCSV-muR, ddH 2 O was made up to 30ul. The primer concentrations in the above systems were 10. Mu.M.
The PCR reaction procedure is that the pre-denaturation is carried out for 3min at 95 ℃, the denaturation is carried out for 30s at 94 ℃, the annealing is carried out for 30-35s at 54 ℃, the extension is carried out for 40s at 72 ℃, the total of 32 cycles of denaturation, annealing and extension are repeated, and the extension is carried out for 5min at 72 ℃.
4. Agarose gel electrophoresis
2.5% agarose gel was prepared, the PCR samples were electrophoresed and photographed in a gel imaging system and recorded.
As seen in FIG. 1, the leftmost lane is 50 bpDNAMmarker, lanes 1-5 contain four viruses (TSWV, TZSV, PCSV and INSV), lane 1 is the product of a single RT-PCR amplification using the primer set INSV-muF/INSV-muR, lane 2 is the product of a single RT-PCR amplification using PCSV-muF/PCSV-muR, lane 3 is the product of a single RT-PCR amplification using TSWV-muF/TSWV-muR, lane 4 is the product of a single RT-PCR amplification using TZSV-muF/TZSV-muR, and lane 5 is the amplification product of a multiplex RT-PCR using the primer set of the invention (8 primers).
As can be seen from FIG. 1, in this experiment, the primer set of the present invention can achieve simultaneous detection of TSWV, TZSV, PCSV and INSV (lane 5). While lanes 1-4 contained four viruses, only one virus was detected by using only one primer pair.
What has been described above is only a partial embodiment of the invention, and the details or common sense of the knowledge in the scheme are not described here too much. It should be noted that the above embodiments do not limit the present invention in any way, and it is within the scope of the present invention for those skilled in the art to obtain the technical solution by equivalent substitution or equivalent transformation. The protection scope of the present application shall be subject to the content of the claims, and the description of the specific embodiments and the like in the specification can be used for explaining the content of the claims.
<110> tobacco agricultural science institute of Yunnan province
<120> a multiplex RT-PCR method and kit for simultaneously detecting TSWV, TZSV, PCSV, INSV four viruses
<160>8
<210>1
<211>23
<212>DNA
<213> artificial sequence
<400>1
GTTCGTTTTCTGCGGTAAGCAAA
<210>2
<211>21
<212>DNA
<213> artificial sequence
<400>2
AGCAACATCATAATTGGGAGG
<210>3
<211>21
<212>DNA
<213> artificial sequence
<400>3
GAACATGACTACTGCATCTTG
<210>4
<211>20
<212>DNA
<213> artificial sequence
<400>4
TAGACATGTCAATTCCAAGC
<210>5
<211>24
<212>DNA
<213> artificial sequence
<400>5
GATGAGTGTTATTTCATGTCTGAC
<210>6
<211>22
<212>DNA
<213> artificial sequence
<400>6
CAAGCTATCAAGCCTTCTGAAG
<210>7
<211>19
<212>DNA
<213> artificial sequence
<400>7
CAAGAACTATTGGCTGGAG
<210>8
<211>24
<212>DNA
<213> artificial sequence
<400>8
GCTGCTCTTCTTCTTTGGTGCCTG
Claims (4)
1. A multiplex RT-PCR method for simultaneously detecting TSWV, TZSV, PCSV, INSV four viruses, comprising the following four sets of primers:
PCSV-muF：5'- GTTCGTTTTCTGCGGTAAGCAAA-3'；
PCSV-muR ：5- AGCAACATCATAATTGGGAGG-3'；
INSV-muF：5- GAACATGACTACTGCATCTTG-3'；
INSV-muR：5- TAGACATGTCAATTCCAAGC-3'；
TSWV-muF：5- GATGAGTGTTATTTCATGTCTGAC-3'；
TSWV-muR：5- CAAGCTATCAAGCCTTCTGAAG-3'；
TZSV-muF：5- CAAGAACTATTGGCTGGAG-3'；
TZSV-muR：5- GCTGCTCTTCTTCTTTGGTGCCTG-3'；
the size of the amplified product of the primer group PCSV-muF/PCSV-muR is 220bp;
the amplified product of the primer group INSV-muF/INSV-muR has the size of 422bp;
the size of the amplified product of the primer set TSWV-muF/TSWV-muR is 157bp;
the size of the amplified product of the primer set TZSV-muF/TZSV-muR is 779bp.
2. The multiplex RT-PCR method according to claim 1, wherein the PCR reaction system is 30. 30ul, wherein 2xPCRmix 15ul, cDNA templates 1.5ul, TSWV-muF/TSWV-muR each 0.5ul, TZSV-muF/TZSV-muR each 0.3-0.4ul, INSV-muF 0.2ul, INSV-muR0.3 ul, PCSV-muF/PCSV-muR each 0.4-0.5ul, ddH 2 O is fed to 30ul; the primer concentrations in the above systems were 10. Mu.M.
3. The method according to claim 1, wherein the PCR reaction is performed at 95℃for 3min,94℃for 30s,54℃for 30-35s,72℃for 40s, and the steps of denaturation, annealing and extension are repeated for a total of 32 cycles, and the final step of extension is performed at 72℃for 5min.
4. A test kit comprising the primer set of claim 1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111357953.XA CN113981146B (en) | 2021-11-16 | 2021-11-16 | Multiplex RT-PCR method and kit for simultaneously detecting TSWV, TZSV, PCSV, INSV four viruses |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111357953.XA CN113981146B (en) | 2021-11-16 | 2021-11-16 | Multiplex RT-PCR method and kit for simultaneously detecting TSWV, TZSV, PCSV, INSV four viruses |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113981146A CN113981146A (en) | 2022-01-28 |
| CN113981146B true CN113981146B (en) | 2024-01-26 |
Family
ID=79748895
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111357953.XA Active CN113981146B (en) | 2021-11-16 | 2021-11-16 | Multiplex RT-PCR method and kit for simultaneously detecting TSWV, TZSV, PCSV, INSV four viruses |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113981146B (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104120193A (en) * | 2014-07-01 | 2014-10-29 | 中国农业科学院蔬菜花卉研究所 | Primer and method for carrying out specific detection and absolute quantification on tomato spotted wilt virus |
| CN105039594A (en) * | 2015-07-24 | 2015-11-11 | 湖南农业大学 | Triple RT-PCR method capable of detecting three viruses causing potato tuber necrosis simultaneously and primer combination thereof |
| CN110499390A (en) * | 2019-09-29 | 2019-11-26 | 云南省烟草农业科学研究院 | Molecular labeling primer, the method and its application of assisted Selection for the anti-spotted wilt RTSW gene-assisted selection of tobacco |
-
2021
- 2021-11-16 CN CN202111357953.XA patent/CN113981146B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104120193A (en) * | 2014-07-01 | 2014-10-29 | 中国农业科学院蔬菜花卉研究所 | Primer and method for carrying out specific detection and absolute quantification on tomato spotted wilt virus |
| CN105039594A (en) * | 2015-07-24 | 2015-11-11 | 湖南农业大学 | Triple RT-PCR method capable of detecting three viruses causing potato tuber necrosis simultaneously and primer combination thereof |
| CN110499390A (en) * | 2019-09-29 | 2019-11-26 | 云南省烟草农业科学研究院 | Molecular labeling primer, the method and its application of assisted Selection for the anti-spotted wilt RTSW gene-assisted selection of tobacco |
Non-Patent Citations (6)
| Title |
|---|
| Orthotospovirus impatiensnecromaculae isolate Green trick segment S, complete sequence GenBank: MH453563.1;GENBANK;《GENBANK》;CDS * |
| Pepper chlorotic spot virus isolate T548 nucleocapsid protein gene, complete cds GenBank: MK070340.1;GENBANK;《GENBANK》;CDS * |
| Pepper chlorotic spot virus isolate TwPep3 segment S, complete sequence GenBank: KF383956.1;GENBANK;《GENBANK》;CDS * |
| Tomato spotted wilt orthotospovirus clone TSWV-N-1 nucleocapsid protein gene, complete cds ， GenBank: MK426730.1;GENBANK;《GENBANK》;CDS * |
| Tomato zonate spot virus isolate TZSV-tomato nucleocapsid protein (N) gene, complete cds GenBank: MG656994.1;GENBANK;《GENBANK》;CDS * |
| 深度测序技术分析番茄斑萎病毒病害寄主及介体中病毒种类;尹跃艳;李婷婷;卢训;丁铭;;植物病理学报(第04期);第1.4、2.3-2.4节，表1，图2-3 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN113981146A (en) | 2022-01-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101875982B (en) | Method for synchronously detecting multiple tobacco viruses | |
| CN101906485B (en) | Primer set and kit for quickly detecting various melon viruses | |
| CN111363856B (en) | Method for simultaneously detecting four tomato viruses by multiple RT-PCR | |
| CN104178585A (en) | Potato virus detection primers and potato virus detection method | |
| CN101875983B (en) | Method for rapidly detecting various viruses of melons | |
| CN113981146B (en) | Multiplex RT-PCR method and kit for simultaneously detecting TSWV, TZSV, PCSV, INSV four viruses | |
| CN111057796A (en) | PCR primer group and kit for detecting pepper mild mottle virus and application thereof | |
| CN103805610A (en) | Rhopalosiphum padi Linnaeus EF1-alpha reference gene partial sequence as well as cloning method and application thereof | |
| CN104946796A (en) | Kit and detection method for detecting tomato spotted wilf virus by RT-LAMP method | |
| CN111979352A (en) | System for detecting pinellia ternata infecting virus by mRT-PCR and application thereof | |
| CN109777888A (en) | Primer combination that is a kind of while detecting a variety of A group Human enterovirus virus and its application | |
| CN111118221B (en) | RPA primer, probe and kit for detecting mosaic virus of cassava mosaic virus of Sri Lanka | |
| CN103820462A (en) | Rhopalosiphum padi ACT1 reference gene partial sequence, cloning method and application | |
| CN113667776A (en) | Real-time fluorescent quantitative PCR (polymerase chain reaction) method for detecting plantain mosaic virus in lily | |
| CN111808992A (en) | Hot pepper vein mottle virus polygene joint detection and identification method | |
| CN112458209B (en) | Multiple RPA detection method for corn lethal necrosis disease | |
| CN105256047A (en) | Locked nucleotide sensitized real-time fluorescent quantitative PCR (polymerase chain reaction) detection method for detecting colonization quantity of phytophthora parasitica in tobacco planting soil | |
| CN104263854B (en) | South leaf mustard mosaic virus SYBR Green I real-time fluorescent RT-PCR detection reagent box and method | |
| CN110607392A (en) | RT-PCR method for simultaneously detecting 4 dragon fruit viruses | |
| CN110982920B (en) | Detection primer, kit and detection method for diversity of endophytic fungi of taxus chinensis | |
| CN117210609B (en) | Primer pair, kit and identification method for identifying cymbidium sinense | |
| CN117187439A (en) | Detection primer, detection kit and detection method for paris polyphylla turnip mosaic virus | |
| CN110512028B (en) | Primer for detecting jujube virus disease and application thereof | |
| CN113322353B (en) | RPA kit for detecting sweet potato pinnate mottle virus and sweet potato chlorotic stunt virus | |
| CN111500785B (en) | Kit and primer group for identifying three subtypes of duck hepatitis A virus |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |