CN113981022A

CN113981022A - 4, 6-alpha-glucosyltransferase and application thereof in production of slow digestion energy storage type branched alpha-glucan

Info

Publication number: CN113981022A
Application number: CN202111405478.9A
Authority: CN
Inventors: 陈晟; 吴敬; 杨卫康; 盛露菲; 饶德明; 黄燕
Original assignee: Jiangnan University
Current assignee: Jiangnan University
Priority date: 2021-11-24
Filing date: 2021-11-24
Publication date: 2022-01-28

Abstract

The invention discloses 4, 6-alpha-glucosyltransferase and application thereof in production of slow digestion energy storage type branched alpha-glucan, belonging to the technical field of genetic engineering. The invention uses 4, 6-alpha-glucosyltransferase GtfD from Geobacillus sp.12AMORR 1 and starch or a substance containing starch as a substrate to prepare the alpha-glucan rich in alpha, 1-6 glycosidic bond proportion, the alpha-glucan has smaller molecular weight and good solubility, and can stably, slowly and long-term release the energy storage capacity of glucose, thereby well meeting the requirement on the capacity of storing glucose in the existing industrial production.

Description

4, 6-alpha-glucosyltransferase and application thereof in production of slow digestion energy storage type branched alpha-glucan

Technical Field

The invention relates to 4, 6-alpha-glucosyltransferase and application thereof in production of slow digestion energy storage type branched alpha-glucan, belonging to the technical field of genetic engineering.

Background

In recent years, with the development of society, the human living environment has changed greatly, such as the pace of life is accelerated, the dietary structure is changed, the social competition is intense, and the environment is polluted. These changes are threatening to the health of people at all times, leaving most people in sub-health. In order to follow the development direction of modern food technology and meet the health requirements of consumers, functional carbohydrate with low blood sugar and low calorie becomes the development trend of health food in the 21 st century.

Starch is an inexpensive alpha-glucan with an extremely abundant natural reserve, and its structure is such that the glucose is linked by alpha, 1-4 and alpha, 1-6 glycosidic bonds. Alpha, 1-4 accounts for most of the natural starch structure, sugar chains connected with the alpha, 1-4 can be rapidly hydrolyzed under the action of human digestive tract hydrolytic enzyme to release glucose, and the released glucose is absorbed into blood in the process of passing through intestinal tracts; in the structure, alpha, 1-6 accounts for a few, and the sugar chains connected with alpha, 1-6 glycosidic bonds are hydrolyzed in the human digestive tract at a rate far slower than that of the alpha, 1-4 glycosidic bonds, so that glucose molecules forming the part of the sugar chains cannot be rapidly absorbed and utilized by the digestive tract. Therefore, the alpha, 1-6 glycosidic bond in the starch structure is increased, and the alpha, 1-6 glycosidic bond is introduced between the continuous alpha, 1-4 glycosidic bonds in the starch structure, so that the degradation rate of the starch in the digestive tract is slowed, the glucose is slowly released, the uniform rise of the blood glucose concentration of a human body is controlled, and the starch can provide energy for the human body for a long time.

In recent years, starch has been enzymatically modified using a variety of α -glucosidases to increase the α -1,6 linkages. 4, 6-alpha-glucosyltransferase is a novel GH70 family enzyme discovered in the last decade, which can utilize starch and maltodextrin as substrates to synthesize slowly digestible alpha-1, 6 bonds, but the GH70 family enzyme reported in the prior art is still less and has different performances, and can not completely satisfy the enzymatic preparation of alpha-glucan with novel functions.

Disclosure of Invention

Aiming at the requirements of the modern society on various functional dietary fibers, the invention discovers 4, 6-alpha-glucosyltransferase GtfD, a product prepared from starch by adopting the enzyme is rich in 42 percent of alpha-1, 6 bonds, has small molecular weight of 2000-6000Da, has good solubility and shows the characteristic of slow and uniform degradation in the digestive tract of a human body, is an energy storage soluble dietary fiber with the property of slowly releasing glucose, and can be used in functional sports food and beverages.

The invention provides a recombinant bacterium for producing 4, 6-alpha-glucosyltransferase GtfD, which takes bacillus subtilis CCTCC M2016536 as an expression host.

In one embodiment, the bacillus subtilis CCTCC M2016536 has been disclosed in patent publication No. CN 106754466A; the amino acid sequence of the 4, 6-alpha-glucosyltransferase GtfD is shown in SEQ ID NO. 1.

In one embodiment, the nucleotide sequence of the gene encoding 4, 6-alpha-glucosyltransferase is set forth in SEQ ID No. 2.

In one embodiment, the 4,6- α -glucosyltransferase GtfD is derived from Geobacillus sp.12amor 1.

The invention provides an expression vector, which takes a pHY series vector as a starting vector, and carries a nucleotide sequence shown in SEQ ID NO.2 or expresses 4, 6-alpha-glucosyltransferase GtfD of which the amino acid sequence is shown in SEQ ID N0.1.

In one embodiment, the pHY series vector is pHY300 PLK.

The invention provides a method for producing 4, 6-alpha-glucosyltransferase GtfD, which comprises the steps of inoculating a recombinant strain into LB containing 80-120 ug/mL kanamycin, culturing at 35-39 ℃ and 200-220 rpm for 8-10h to obtain a culture solution, then inoculating the culture solution into a TB culture medium according to the inoculation amount of 5-10% of the volume of the culture medium, culturing at 35-39 ℃ and 200-220 rpm for 1.5-3 h, performing shake flask induced fermentation when thalli reach a certain concentration to obtain a fermentation broth, homogenizing and crushing the fermentation broth under high pressure, and centrifuging to obtain the supernatant, namely the 4, 6-alpha-glucosyltransferase GtfD.

In one embodiment, the bacterial cells OD₆₀₀Carrying out shake flask fermentation at 0.5-1.0.

In one embodiment, the shake flask fermentation is carried out under the conditions of 30-35 ℃ and 200-220 rpm for 45-50 h.

The invention provides a method for preparing alpha-glucan, which is characterized in that 4, 6-alpha-glucosyltransferase with an amino acid sequence shown as SEQ ID NO.1 is used for producing the alpha-glucan by taking starch, starch derivatives or substances containing the starch as substrates.

In one embodiment, the α -glucan is produced by heating a starch suspension to gelatinize, cooling, adding pullulanase to the starch suspension to perform a reaction to obtain a reaction solution, adding the 4,6- α -glucosyltransferase to the reaction solution to perform a reaction to obtain a reaction solution containing α -glucan.

In one embodiment, the 4,6- α -glucosyltransferase is added to the reaction solution in an amount of 2500-.

In one embodiment, the reaction is carried out at a pH of 5.0 to 7.5 and a temperature of 35 to 40 ℃ for 20 to 24 hours.

In one embodiment, the concentration of the starch suspension is 15-25% by mass volume, and the starch suspension is gelatinized by heating to 60-80 ℃.

In one embodiment, pullulanase is added to the reaction solution after the gelatinization in an amount of 10 to 50U/g substrate to carry out the reaction.

In one embodiment, pullulanase is added and then reacted for 20-24 hours at a pH value of 5.0-7.5 and a temperature of 35-40 ℃.

In one embodiment, the starch is a cereal starch, or a potato starch, or a starch derivative: the cereal starch is corn starch, wheat starch, rice starch, mung bean starch and pea starch; the potato starch is cassava starch, potato starch, sweet potato starch and other potato starches; the starch derivatives are maltodextrin, dextrin, soluble starch and other starch derivatives; the substance containing starch is rice protein peptide.

The invention provides application of 4, 6-alpha-glucosyltransferase with an amino acid sequence shown as SEQ ID NO.1 or gene with a nucleotide sequence shown as SEQ ID NO.2 in the fields of food, health care products or cosmetics.

In one embodiment, the use comprises preparing a slowly digestible energy storing branched alpha-glucan, or an alpha-glucan containing alpha-1, 6 glycosidic linkages.

The invention has the beneficial effects that:

the method takes starch or a starch-containing system as a substrate, 4, 6-alpha-glucosyltransferase GtfD from Geobacillus sp.12AMORR 1 is added after high-temperature gelatinization and pullulanase debranching to react and synthesize the branched alpha-glucan rich in 42 percent of alpha, 1-6 glycosidic bond proportion, the molecular weight of the alpha-glucan is smaller between 2000 and 6000Da, the alpha-glucan has better solubility, and the alpha-glucan product shows the energy storage capacity of stably and slowly releasing glucose for a long time in an in-vitro digestion simulation experiment, and the property can meet the requirement on the glucose storage capacity in the fields of foods, health products, cosmetics and the like.

Drawings

FIG. 1 shows the optimum temperature for the 4, 6-alpha-glucosyltransferase GtfD.

FIG. 2 shows the optimum pH of 4, 6-alpha-glucosyltransferase GtfD.

FIG. 3 shows the substrate specificity of 4,6- α -glucosyltransferase GtfD, M represents the standard, and the longitudinal G1-G7 represent the standard sample glucose and maltobiose to maltoheptaose, respectively; the horizontal G1 to G7 represent glucose and maltobiose to maltoheptaose, respectively, S represents sucrose, G2 'represents isomaltobiose, G3' represents isomaltotriose, N represents aspergillus niger disaccharide, P represents panose, and Pol represents a polysaccharide polymer.

FIG. 4 is the product specificity of the 4, 6-alpha-glucosyltransferase GtfD; represents a nuclear magnetic resonance one-dimensional hydrogen spectrum¹HNMR。

FIG. 5 is the product specificity of the 4, 6-alpha-glucosyltransferase GtfD; high performance gel filtration chromatography HPGFC is shown.

FIG. 6 is a simulated glucose hydrolysis curve for the in vitro digestion of the 4, 6-alpha-glucosyltransferase GtfD alpha-glucan product.

Detailed Description

The media formulations described in the examples are as follows:

LB medium (g/L): peptone 10, yeast extract 5, NaCl 10.

TB medium (g/L): peptone 10, yeast powder 24, glycerol 5, K₂HPO₄.3H₂O 16.43，KH₂PO₄ 2.31。

RM medium (g/L): 5.0 yeast extract, 10.0 tryptone, 10.0 NaCl, 90.0 sorbitol and 70.0 mannitol.

The high-temperature resistant pullulanase described in the examples is purchased from Shandong Kete enzyme preparation Co., Ltd, and the enzyme activity is 2000U/mL.

The gel recovery kit is purchased from Tiangen Biochemical technology (Beijing) Co., Ltd, and the plasmid extraction kit is purchased from Tiangen Biochemical technology (Beijing) Co., Ltd.

Enzyme activity definition and determination method:

iodine assay of mutant Total enzyme Activity of 4, 6-alpha-glucosyltransferase: 1g/L amylose mother liquor: adding 2mL of distilled water into 40mg of amylose for fully wetting, adding 2mL of 2M NaOH solution, and carrying out vortex oscillation for fully dissolving; when in use, 500. mu.L of amylose mother liquor is added with 250. mu.L of 2M HCI solution, and then 3250. mu.L of phosphate-citrate buffer solution (pH7.0) is added to prepare 0.125% of substrate.

Lugol iodine solution: 0.26g iodine and 2.60g potassium iodide were dissolved in a 10mL volumetric flask (prepared 3 days in advance to ensure complete dissolution of iodine); when in use, 100 mu L of Lugol iodine solution is taken, 50 mu L of 2M HCl solution is added, and then water is supplemented to 26mL to prepare iodine color developing solution.

In the reaction, 200. mu.L of the substrate was placed in a 1.5mL centrifuge tube and incubated at 35 ℃ for 10 min. Adding 200 μ L of 4,6- α -glucosyltransferase enzyme solution, reacting at 35 deg.C for 10min, adding 200 μ L of reaction solution into 3800 μ L iodine color development solution after reaction, displaying for 5min, and measuring absorbance at 660nm with spectrophotometer. The control buffer was used instead of the enzyme solution, and 200. mu.L of the buffer was added to 3800. mu.L of the iodine developing solution for 5 min.

A relative enzyme activity unit is defined as that the unit time light absorption value is reduced by one percent to be an enzyme activity unit.

The enzyme activity calculation formula is as follows:

enzyme activity (U/mL) ([ 100 Xdilution multiple × (A))_Control-A_{Experiment of})]/[10minх0.1mLх(A_Control-A_{Blank space})]。

Thin Layer Chromatography (TLC) detection method: thin Layer Chromatography (TLC) analysis was performed on TLC silica gel 60F254, aluminum sheets 20X 20cm, and n-butanol was selected: acetic acid: a solvent system of water (2: 1: 1, v/v) as a developing solvent. 20-30. mu.g of the reaction mixture and the mixed standard (G1-G7) were spotted separately onto TLC plates, which were then run in developing solvent for 8-10 h. The developer was removed from natural dryness as it approached the top of the TLC plate and the process was repeated twice to completely isolate G1-G7. Spraying 5% ethanol sulfate solution, heating at 95 deg.C for 10-30 min, and observing spots.

Example 1: recombinant expression of 4, 6-alpha-glucosyltransferase GtfD

(1) Construction of recombinant plasmid pHY300PLK-gtfd

A target gene 4, 6-alpha-glucosyltransferase gene (gtfD) segment with a nucleotide sequence shown as SEQ ID NO.2 is chemically synthesized, and a recombinant plasmid pHY300PLK-gtfD is constructed. The method comprises the following specific steps:

PCR primers:

D-F：CCATGGggAGTTCCGGGCCAGAGCTTG，SEQ ID NO.3；

D-R：AAGCTTAACGAACCGTTACCGCGAAGT，SEQ ID NO.4。

the PCR system is as follows: mu.L of each of 20. mu.M primers D-F and D-R, 0.5. mu.L of dNTPmix, 10. mu.L of 5xPS Buffer, 0.5. mu.L of 2.5U/. mu.L PrimeStar polymerase, 0.5. mu.L of template, and 50. mu.L of double distilled water.

PCR conditions were as follows: pre-denaturation at 94 ℃ for 4 min; denaturation at 98 ℃ for 10s, annealing at 55 ℃ for 10s, extension at 72 ℃ for 4min, 30 cycles.

The PCR product is recovered by glue, added with A for purification, then connected with a cloning vector pMD18T at 16 ℃ overnight, transformed into E.coli JM109, coated on an LB plate containing ampicillin (100 mug/mL) resistance, cultured at 37 ℃ for 10-12h, a transformant is selected, a recombinant plasmid is extracted and subjected to double enzyme digestion verification, then the DNA sequence of the correctly verified recombinant plasmid is determined, and the positive clone, namely pMD18T-gtfD-JM 109.

Carrying out double enzyme digestion on the recovered target gene, carrying out double enzyme digestion on the recovered target gene and an expression vector pHY300PLK, connecting at 16 ℃ overnight, transforming E.coli JM109, coating an LB plate containing kanamycin (100 mu g/mL) resistance, culturing at 37 ℃ for 10-12h, selecting a transformant, extracting a recombinant plasmid, carrying out double enzyme digestion verification, and then determining a DNA sequence of the correctly verified recombinant plasmid, wherein a positive clone is pHY300 PLK-gtfD.

(2) Bacillus subtilis transformation of recombinant plasmid pHY300PLK-gtfD

The recombinant plasmid pHY300PLK-gtfD is transformed into a strain of Bacillus subtilis CCTCC NO which is prepared in advance: m2016536 is competent to obtain genetically engineered bacterium Bacillus subtilis CCTCC M2016536 (pHY300PLK-gtfD), spread on LB plate containing kanamycin resistance (100 μ g/mL), and cultured at 37 deg.C for 10-12 h. Single colonies were picked into 10mL of liquid LB medium containing kanamycin resistance (100. mu.g/mL), cultured at 37 ℃ for 8 hours, and after the sequencing was confirmed to be correct, the tubes were stored in a-80 ℃ freezer.

(3) Shake flask fermentation for producing enzyme

Inoculating the recombinant bacillus subtilis strain obtained in the step (2) into an LB culture medium, culturing at 37 ℃ for 8h, transferring into 50mL of TB fermentation medium by 5% of inoculum size, and culturing at constant temperature of 37 ℃ and 200rpm for 1-2h at the bacterial body OD₆₀₀The mixture is transferred to 33 ℃ at the time of 0.5 to 1.0 and is subjected to shake flask induction fermentation for 48 hours at 200 rpm. And after the fermentation is finished, carrying out ultrasonic crushing on the fermentation liquor and then centrifuging, wherein the supernatant is the 4, 6-alpha-glucosyltransferase liquid produced by the recombinant bacillus subtilis.

The enzyme activity of the enzyme solution is determined, and the enzyme activity of the 4, 6-alpha-glucosyltransferase GtfD is 213.5U/mL.

Optimum pH and optimum temperature determination: determining the optimum pH of GtfD at 37 deg.C, ranging from pH4.0-10.0, wherein the pH4.0-8.0 is selected from citrate phosphate buffer, the pH8.0-9.0 is selected from Tris-HCl buffer, and the pH9.0-10.0 is selected from Gla-NaOH buffer; the optimum temperature is determined at pH7.0, in the range of 25 ℃ to 50 ℃.

Under the above conditions, the optimum pH and the optimum temperature of the GtfD enzyme were measured to be pH7.0 and 40 ℃ respectively (see FIGS. 1 and 2).

Example 2: study on substrate specificity of 4, 6-alpha-glucosyltransferase GtfD

The purified Geobacillus sp.12AMOR1CtfD enzyme was incubated separately with 25mM of sucrose, blackberry sugar, panose, isomaltose, isomaltotriose, glucose and malto-oligosaccharides with different degrees of polymerisation (G2-G7). All reactions were performed in phosphate-citrate buffer (containing 1mM CaCl) at pH 7.0. After 10 hours at 37 ℃ the reaction was stopped by heating the sample to 100 ℃ for 10 min. Finally, the progress of the reaction was checked by Thin Layer Chromatography (TLC).

Detection of GtfD under the above conditions failed to utilize isomaltobiose, isomaltotriose, sucrose, nigerose, panose, glucose, maltobiose, and maltotriose substrates alone, and GtfD was able to undergo transglycosylation/disproportionation reactions when the degree of polymerization of the substrates was maltotetraose and above (see fig. 3).

Example 3: use of enzymatic conversion of 4, 6-alpha-glucosyltransferase GtfD in the preparation of alpha-glucans

(1) The preparation of alpha-glucan comprises the following steps:

adding water into starch to prepare 20% suspension, heating to 60-80 ℃ for gelatinization, cooling to 37 ℃, adjusting the pH value to 7.0 +/-0.5, adding 30-50U/g of substrate of pullulanase, putting into a constant-temperature water bath shaking table, and reacting for 24 hours at 37 ℃;

② enzyme deactivation is carried out for 20min at 95 ℃ after the reaction is finished;

regulating the pH value to 5.0-7.5, adding 3500U/g substrate (starch) of 4, 6-alpha-glucosyltransferase 2500-;

inactivating enzyme at 95 deg.C for 20min after reaction;

cooling the reaction product, centrifuging at 8000rpm for 20min, collecting supernatant, filtering with 0.45 μm filter membrane, and spray drying to obtain light yellow powder.

(2) NMR spectroscopic analysis of alpha-glucan product

40mgGeobacillus sp.12AMORR 1 GtfD product is mixed with 500 mu L D₂O (99.9 at% D) was mixed and sonicated for 5 minutes to completely dissolve the sample. One-dimensional 1H and 13C Nuclear Magnetic Resonance (NMR) spectra of the samples were recorded on an AVANCE III 400MHz digital NMR spectrometer (Bruker Biospin International AG) at a temperature of 60 ℃. Trimethylsilylpropionic acid (TMSP 0.03%) was dissolved in the samples as an internal standard to calibrate the chemical shifts (δ) and to estimate the percentage of α -1,4 and α -1,6 bonds by integration of the signal peak areas at δ 5.36 and δ 4.96.

The percent of α -1,4 and α -1,6 linkages of the GtfD product detected under the above conditions was 58%: 42% (see FIG. 4)

The product has obvious branch type, and the product is alpha-glucan with a multi-branch structure.

(3) Molecular weight determination of alpha-glucan products

High Performance Gel Filtration Chromatography (HPGFC) was used to determine the molecular weight of the product. HPGFC analysis was performed using a Waters 1525 high performance liquid chromatography system equipped with 2414 differential refractive detector and the chromatographic data was recorded and processed with an Empower3 workstation. The separation was carried out using an Ultrahydrogel TM Linear (300 mm. times.7.8 mm, inner diameter. times.2) gel filtration column at a column temperature of 45 ℃. A50. mu.L sample was injected at a flow rate of 0.9ml/min and 0.1M NaNO3 was used as the mobile phase. From

The purchased Dextran standard solutions (180Da, 2700Da, 9750Da, 36800Da and 135350Da) were used asAnd (4) standard solution.

The average molecular weight of the GtfD product detected under the above conditions was 2618Da (see figure 5).

(4) Determination of alpha-glucan hydrolysis resistance by in vitro digestion simulation experiment

Preparation of mixed hydrolase: weighing 2g of porcine trypsin, adding 24mL of distilled water for suspension, oscillating for 10min by a vortex oscillator at 4 ℃, fully mixing, absorbing 20mL of supernatant after centrifugation (1500 Xg, 10min), adding 0.4mL of glucosidase and 3.6mL of distilled water, and fully mixing to obtain the mixed hydrolase.

Preparing an alpha-glucan product prepared by using 4, 6-alpha-glucosyltransferase GTFD and a starch substrate into 4% (w/v) concentrations respectively, taking 1mL of alpha-glucan product and starch substrate, putting 1mL of alpha-glucan product into a 5mL centrifuge tube, carrying out warm bath at 37 ℃ for 10min, adding 1mL of mixed hydrolase into a 5mL centrifuge tube, carrying out warm bath at 37 ℃, taking 0.1mL of reaction liquid into 0.3mL of 90% ethanol solution to terminate the reaction when carrying out 0min, 20min, 60min, 120min and 240min respectively, and centrifuging (10000 Xg, 10min) to take supernatant and determining the glucose content by a GOD method. Respectively calculating glucose conversion rates of the enzyme conversion product and the starch substrate under the hydrolysis action of the mixed hydrolase for 0min, 20min, 60min, 120min and 240 min.

Compared with starch, the product after GTFD enzyme conversion has improved digestion resistance to mixed hydrolase (figure 6), and releases glucose in a stable and slow manner within 0-240min under the action of the hydrolase. Compared to 66% glucose released within 60min from starch, the GTFD product released only 31% glucose, 80% of the starch was hydrolyzed to glucose after 240min, and only 55% of the glucose was released from the GTFD product. The alpha-glucan product of GTFD has the properties of storing energy and releasing glucose stably for a long time, the property is determined by the unique multi-branch structure, and the alpha, 1-4 and 6 branches of the product can effectively slow down the degradation of mixed hydrolysis and play a role in releasing glucose stably. The product can be added into functional sports food beverage, and can prevent rapid rise of blood sugar for a short time after eating, and release energy for a long time.

Although the present invention has been described with reference to the preferred embodiments, it should be understood that various changes and modifications can be made therein by those skilled in the art without departing from the spirit and scope of the invention as defined in the appended claims.

SEQUENCE LISTING

<110> university of south of the Yangtze river

<120> 4, 6-alpha-glucosyltransferase and application thereof in production of slow digestion energy storage type branched alpha-glucan

<130> BAA210342A

<160> 4

<170> PatentIn version 3.3

<210> 1

<211> 872

<212> PRT

<213> Artificial sequence

<400> 1

Met Gly Ser Ser Gly Pro Glu Leu Asp Asn Arg Val Ile Phe Gln Ser

1 5 10 15

Phe Ser Leu Tyr Gln Pro Tyr Glu Ser Asn Met Tyr Lys Ile Leu Ala

20 25 30

Thr Lys Gly Asp Leu Leu Lys Glu Trp Gly Ile Thr Asp Val Trp Leu

35 40 45

Pro Pro Ala Tyr Arg Ser Phe Asn Met Ala Arg Tyr Met Glu Gly Tyr

50 55 60

Ala Ile Ala Asp Arg Tyr Asp Leu Gly Glu Phe Asn Gln Gly Pro Asn

65 70 75 80

Asn Glu Arg Ala Thr Lys Tyr Gly Thr Ser Asp Glu Leu Lys Asp Met

85 90 95

Ile Asp Lys Leu His Ala Ala Gly Leu Lys Val Gln Leu Asp Leu Val

100 105 110

Pro Asn Gln Leu Leu Gly Leu Asn Gly Arg Glu Ala Val Tyr Val Thr

115 120 125

Arg Val Asp Asn Asn Gly Asp Leu Phe Lys Asn Pro Tyr Thr Thr Gly

130 135 140

Leu Thr Thr Arg Ile Arg Ala Asp Leu Tyr Leu Ala Tyr Thr Lys Gly

145 150 155 160

Gly Gly Gln Gly Gln Ala Lys Tyr Gly Tyr Ile Lys Glu Trp Asn Lys

165 170 175

Asn Tyr Phe Asn Gly Thr Ser Leu Gln Gly Gln Gly Met Gly Arg Val

180 185 190

Met Thr Asp Asp Asn Gly Lys Pro Tyr Arg Phe Phe Gly Pro Asn Asp

195 200 205

Pro Arg Asn Tyr Leu Pro Ser Trp Leu Glu Glu Ala Ala Ala Ala Asn

210 215 220

Lys Ile Asn Thr Val Asp Thr Tyr Leu Pro Val Asp Gly Trp Tyr Ala

225 230 235 240

Ala Lys Asp Ala Ala Thr Ser Asp Gln Tyr Trp Lys Pro Met Leu Ile

245 250 255

His Tyr Ala Lys Asp Lys Gly Tyr Leu Ser Phe Met Ser Gln His Gly

260 265 270

Phe Ala Thr Val Asp Asp Ile Ile Asn Gly Asp Asn Ala Glu Ile Ala

275 280 285

Lys Trp Thr Asn Ala Tyr Ile Gln Ser Arg Pro Glu Tyr Gly Phe Gly

290 295 300

Ser Glu Glu Arg Ser Tyr Lys Asn Asp Asn Thr Gly Val Asp Asp Gln

305 310 315 320

Asp Gln Phe Leu Phe Val Glu Glu Asn Gly Ser Thr Lys His Asn Ile

325 330 335

His Asn Thr Ile His Gly Asn Tyr Glu Phe Leu Val Gly Leu Asp Ile

340 345 350

Asp Asn Ser Asn Pro Thr Val Arg Lys Glu Gln Ile His Trp Met Asn

355 360 365

Trp Leu Leu Asp Thr Tyr Lys Phe Asp Gly Phe Arg Ile Asp Ala Ala

370 375 380

Thr His Phe Asp Lys Gln Val Leu Leu Asp Glu Ala Asp Val Arg Lys

385 390 395 400

Ala His Phe Gly Asn Asp Leu Asn Asn His Leu Ser Tyr Ile Glu Ser

405 410 415

Tyr Thr Ser Lys Ala Glu Lys Phe Glu Asn Glu Asn Gly Asn Pro His

420 425 430

Leu Thr Met Asp Trp Ala Leu Tyr Tyr Thr Leu Gln Asp Thr Leu Gly

435 440 445

Lys Gly Thr Pro Ser Gln Lys Leu Ser Thr Ile Ala Thr Asn Ser Val

450 455 460

Val Asn Arg Ser Gly Ser Gly Ser Ala His Ala Ile Pro Asn Trp Ser

465 470 475 480

Phe Val Asn Asn His Asp Gln Glu Lys Asn Arg Val Asn Thr Ile Met

485 490 495

Leu Asp Leu Tyr Gly Ile Lys Thr Gly Glu Lys Tyr Thr Thr Thr Pro

500 505 510

Pro Lys Ser Phe Ala Asp Leu Tyr Asp Lys Glu Thr Glu Lys Lys Ala

515 520 525

Leu Ala Ile Tyr Lys Asp Asp Met Lys Arg Val Asp Lys Lys Tyr Ala

530 535 540

Pro Asn Asn Val Val Ser Gln Tyr Ala Phe Leu Leu Thr Asn Lys Asp

545 550 555 560

Thr Val Pro Thr Ile Tyr Tyr Gly Asp Leu Tyr Gln Thr Asp Ala Ser

565 570 575

Tyr Met Ser Lys Pro Thr Leu Tyr Tyr Glu Pro Ile Thr Lys Leu Leu

580 585 590

Lys Met Arg Lys Ala Tyr Ala Tyr Gly Gly Gln Lys Ile Thr Gly Tyr

595 600 605

Thr Ser Asn Thr Ser Pro Glu Thr Ala Gly Gln Asp Leu Ile Ala Ser

610 615 620

Val Arg Tyr Gly Lys Asp Arg Tyr Thr Gly Val Ala Val Val Ile Gly

625 630 635 640

Thr Asn Pro Lys Thr Asp Thr Thr Ile Lys Val Asp Met Gly Thr Lys

645 650 655

His Ala Asn Gln Val Phe Lys Asp Ala Thr Gly Phe His Ser Glu Lys

660 665 670

Leu Val Ala Asp Asn Lys Gly Val Leu Thr Ile Arg Val Lys Gly Thr

675 680 685

Ala Asn Ala Leu Val Lys Gly Tyr Leu Gly Val Trp Val Pro Thr Lys

690 695 700

Asp Lys Ala Pro Gly Leu Ser Trp Asn Ser Ala Lys Thr Val Tyr Gln

705 710 715 720

Gly Lys Thr Val Lys Leu Ser Val Lys Leu Thr Asn Ser Ala Ser Lys

725 730 735

Ile Lys Thr Val Thr Phe Thr Ser Ser Asn Pro Ser Ile Ala Ser Val

740 745 750

Asp Lys Tyr Gly Asn Val Lys Gly Asn Lys Lys Thr Gly Lys Val Asn

755 760 765

Ile Tyr Ala Thr Val Thr Thr Ala Asp Asn Phe Val Leu Tyr Ser Ser

770 775 780

Lys Pro Ile Asp Val Lys Ala Asn Gln Val Thr Leu Lys Ala Asn Arg

785 790 795 800

Ala Thr Val Lys Arg Gly His Ser Thr Lys Ile Gln Ile Lys Ser Ser

805 810 815

Thr Asp Lys Ile Lys Ser Ala Ala Tyr Lys Ser Ser Asn Thr Arg Val

820 825 830

Ala Thr Val Ser Lys Ser Gly Val Val Thr Gly Lys Arg Pro Gly Lys

835 840 845

Ala Thr Ile Thr Ile Tyr Tyr Lys Thr Gln Gly Gly Tyr Thr Val Lys

850 855 860

Lys Tyr Phe Ala Val Thr Val Arg

865 870

<210> 2

<211> 2616

<212> DNA

<213> Artificial sequence

<400> 2

atggggagtt ccgggccaga gcttgataac cgcgtaattt ttcaatcgtt ctcgctgtat 60

cagccctacg aatccaacat gtacaagatt ttagccacga aaggtgatct tttgaaggaa 120

tggggtatta cggatgtctg gttacctccc gcatatcgct cttttaatat ggcgcgctac 180

atggaaggct acgctattgc agaccgttat gatctggggg agttcaacca aggacccaac 240

aacgagcgcg ctactaagta cggtaccagt gatgagttga aggacatgat tgataagtta 300

catgctgcag ggttgaaagt ccaactggat ctggtgccta atcagctgct tggtctgaat 360

ggccgcgagg cggtgtacgt tacccgtgtt gacaacaatg gagatttgtt caaaaaccct 420

tatacgacgg ggttaaccac gcgtattcgt gcagacttat acctggctta cactaagggg 480

gggggacaag ggcaggctaa atacggatac attaaggaat ggaacaagaa ttatttcaac 540

ggtactagtc tgcaaggcca aggcatgggt cgtgtgatga ctgacgacaa cggaaagcca 600

taccgttttt tcggtccgaa tgatcctcgc aactacctgc cctcatggct tgaggaagct 660

gcggcggcga acaaaattaa cactgttgac acgtatttac cggtggacgg ctggtacgca 720

gccaaagacg cggcgacatc cgaccagtat tggaagccta tgttaatcca ctatgcaaaa 780

gacaaaggct acctttcctt tatgtctcaa catggcttcg caactgtcga tgacattatt 840

aacggtgata acgcagagat cgcaaagtgg accaatgcct atatccagtc gcgccctgaa 900

tacgggtttg gaagcgagga gcgttcgtac aagaatgata acacgggagt agatgatcag 960

gatcaattct tatttgtgga ggagaatggt tcaacaaagc acaatattca taatacaatc 1020

cacgggaact acgagttcct tgtggggctg gatattgaca attcgaatcc tactgtgcgt 1080

aaagaacaga tccattggat gaattggctg ctggatacct acaagtttga tggattccgt 1140

attgatgcag ctacccattt tgacaaacaa gtgttgcttg atgaagcaga cgtccgtaag 1200

gctcattttg ggaatgatct gaacaaccat ttaagttaca ttgaatccta cacgagtaaa 1260

gcagaaaaat tcgaaaatga aaatggcaac ccgcacctga caatggattg ggctctttat 1320

tatactttac aggacacgct tggaaagggt accccaagcc agaaacttag cactatcgcc 1380

acaaacagcg ttgtgaatcg tagcggttca gggtctgccc acgcgatccc caattggagt 1440

ttcgtaaaca atcacgatca agagaagaac cgtgttaata ctattatgtt ggacctgtat 1500

gggatcaaaa ccggtgaaaa atacacgacg accccgccta aaagttttgc tgatttatac 1560

gacaaggaaa ccgaaaaaaa ggctttagcg atttacaagg atgacatgaa gcgcgttgac 1620

aaaaaatatg ccccgaataa cgtcgtaagc cagtatgcat ttttactgac gaacaaggat 1680

actgttccga ccatctatta tggcgatttg taccaaacag acgccagtta catgtccaag 1740

ccgacccttt attatgaacc tatcacaaag ttattgaaaa tgcgcaaggc gtatgcctac 1800

ggaggccaga aaattacggg ttacacatct aacacgagcc cggagacggc agggcaggac 1860

cttatcgcgt ctgtgcgcta tggaaaggac cgttatactg gggtggcggt agtcatcgga 1920

actaacccaa aaacggatac gaccattaag gtggatatgg gaaccaagca cgcaaaccag 1980

gtgttcaaag atgcgacagg gtttcattct gagaaacttg ttgcggataa taagggtgtg 2040

ttgacgattc gtgttaaagg taccgctaac gcgttagtta aaggatactt aggtgtatgg 2100

gttcctacaa aggacaaagc cccaggtttg tcctggaact ccgctaagac tgtgtaccaa 2160

ggtaagaccg taaagttaag tgtcaagtta accaactccg cgtctaaaat taagaccgtt 2220

acattcactt cgtcgaaccc gagtattgct tcggtggaca agtacggaaa cgtaaaggga 2280

aacaagaaga ccggaaaagt gaatatttac gccacagtga cgaccgcaga taatttcgtc 2340

ctgtatagca gcaagccgat cgacgttaaa gcgaaccaag ttacccttaa agccaatcgt 2400

gcgacggtta agcgcggtca ctcgacaaaa atccagatta aatcttcgac agacaaaatt 2460

aagagcgccg cgtacaaaag ctctaacacc cgtgtcgcca ccgtttccaa gtcgggagtc 2520

gtgactggca aacgtcccgg caaagcgaca attaccattt attataaaac acagggcggt 2580

tataccgtga agaaatactt cgcggtaacg gttcgt 2616

<210> 3

<211> 27

<212> DNA

<213> Artificial sequence

<400> 3

ccatggggag ttccgggcca gagcttg 27

<210> 4

<211> 27

<212> DNA

<213> Artificial sequence

<400> 4

aagcttaacg aaccgttacc gcgaagt 27

Claims

1. A method for producing alpha-glucan, characterized by producing alpha-glucan using 4, 6-alpha-glucosyltransferase having an amino acid sequence shown in SEQ ID NO.1, with starch, a starch derivative or a substance containing starch as a substrate.

2. The method according to claim 1, wherein the α -glucan is produced by heating a starch suspension to gelatinize the starch suspension, cooling the starch suspension, adding pullulanase to the starch suspension to perform a reaction to obtain a reaction solution, and adding the 4,6- α -glucosyltransferase to the reaction solution to perform a reaction to obtain a reaction solution containing α -glucan.

3. The method according to claim 2, wherein the 4,6- α -glucosyltransferase is added to the reaction solution in an amount of 2500-.

4. The method of claim 3, wherein the reaction is carried out at a pH of 5.0 to 7.5 and a temperature of 35 to 40 ℃ for 20 to 24 hours.

5. The method according to any one of claims 2 to 4, wherein the concentration of the starch suspension is 15 to 25% by mass/volume, and the temperature is raised to 60 to 80 ℃ to gelatinize the starch suspension.

6. The method according to claim 5, wherein pullulanase is added to the reaction solution after the gelatinization in an amount of 10 to 50U/g substrate to carry out the reaction.

7. The method according to claim 6, wherein the pullulanase is added and then reacted at a pH value of 5.0-7.5 and a temperature of 35-40 ℃ for 20-24 hours.

8. The method according to any one of claims 1 to 7, wherein the starch is a cereal starch, or a potato starch, or a starch derivative: the cereal starch is corn starch, wheat starch, rice starch, mung bean starch and pea starch; the potato starch is cassava starch, potato starch, sweet potato starch and other potato starches; the starch derivatives are maltodextrin, dextrin, soluble starch and other starch derivatives; the substance containing starch is rice protein peptide.

9. The 4, 6-alpha-glucosyltransferase with amino acid sequence shown as SEQ ID NO.1 or the gene with nucleotide sequence shown as SEQ ID NO.2 is applied to the fields of food, health care products or cosmetics.

10. The use of claim 9, wherein the use comprises preparing a slowly digestible energy storing branched α -glucan, or an α -glucan containing α -1,6 glycosidic linkages.