CN113980902A

CN113980902A - In vitro culture method for efficiently inducing macrophage polarization

Info

Publication number: CN113980902A
Application number: CN202111421803.0A
Authority: CN
Inventors: 杨欢; 王国华; 王洲; 孙祥琳; 姜正林
Original assignee: Nantong University
Current assignee: Nantong University
Priority date: 2021-11-26
Filing date: 2021-11-26
Publication date: 2022-01-28

Abstract

The invention discloses an in vitro culture method for efficiently inducing macrophage polarization, which comprises the following steps: step 1, stimulating THP-1 monocytes with PMA and GM-CSF under serum-free conditions to differentiate into macrophages; step 2, inducing the macrophages differentiated in the step 1 by using 20 ng/mL IFN-gamma and 100 ng/mL LPS for 24h to obtain M1 type macrophages; step 3, inducing the macrophage differentiated in the step 1 by using 20 ng/mL IL-4 and 20 ng/mL IL-10 for 24h to obtain M2 type macrophage. The invention adopts an economic and perfect model of polarization after PMA and GM-CSF induce THP-1 monocyte to differentiate into macrophage, and identifies induced differentiated macrophage and polarized M1 and M2 type macrophage through detecting a plurality of markers (CD 11b, CD86, CD206, iNOS, CD206, Agr-1, IL-1 beta).

Description

In vitro culture method for efficiently inducing macrophage polarization

Technical Field

The invention belongs to the technical field of biological medicines, and particularly relates to an in vitro culture method for efficiently inducing macrophage polarization and a marker for macrophage polarization analysis.

Background

Macrophages have a wide range of biological effects, such as anti-infection, anti-tumor, participation in immune response and immune regulation, and the like, are important immune cells connecting the natural immunity and specific immunity of human bodies, are widely distributed in various tissues and organs of human bodies, play an important role in many infectious and non-infectious diseases, and are mainly used for phagocytosis and digestion of cell debris and pathogens in a fixed or free form, and activate lymphocytes or other immune cells to make them react to the pathogens.

Currently, there are three ways to obtain the macrophages required for an experiment: (1) obtaining primary macrophages directly from an animal or human; (2) inducing differentiation of primary monocytes into macrophages using colony stimulating factors; (3) macrophages were induced using continuous cell lines. Although the direct use of primary macrophages and monocytes is closer to physiological status, the use of continuous cell lines to induce differentiation into macrophages remains the current major route for obtaining macrophages due to the difficulty of obtaining primary cells from animal or human bodies, short in vitro survival periods, coupled with the expense and difficulty of controlling inter-individual differences. However, different differentiation induction methods have a large influence on the functions and properties of macrophages formed by differentiation.

Macrophages are differentiated from monocytes, have a unique cellular phenotype, and express several specific cellular markers. Generally, macrophages are classified into two types, M1 and M2, according to their different functional properties and the induction of Th1 and Th2 responses. Th1 cytokines IFN-gamma, IL-2, IL-3, IL-12, TNF-a, bacterial components such as Lipopolysaccharide (LPS) and Toll-like receptor (TLR) agonists, etc. can induce macrophage polarization to M1. M1 type macrophages secrete proinflammatory factors such as L-1 beta, IL-6, IL-12, IL-23, iNOS, TNF-a, CXCL-9, CXCL-10 and the like, and express major histocompatibility complex class I (MHC I) and class II (MHC II) molecules, involved in inflammatory responses. Th2 cytokines IL-4, IL-10, IL-13, TNF-a, TGF-beta, GM-CSF, immune complex and TLRs and the like induce macrophage polarization to M2 type, secrete a plurality of anti-inflammatory molecules and angiopoietins, such as IL-4, IL13, IL-10, TGF-beta, glucocorticoid, VEGF, angiotensin ANG1, ANG2 and the like, and play roles of anti-inflammation and promoting tissue repair. In the context of cancer, macrophages of the M1 type exert an anti-tumor effect through cytotoxicity and phagocytosis, macrophages of the M2 type are associated with a poor prognosis, and their angiogenic and immunosuppressive functions promote tumor growth.

The THP-1 cell line is separated from peripheral blood of an acute monocytic leukemia patient, and compared with leukemia cell lines such as U937, HL-60, ML-2 and the like, the THP-1 cell line has morphological and functional characteristics (including cell differentiation markers) more similar to human primary monocytes. Compared with human Peripheral Blood Mononuclear Cells (PBMC), the THP-1 is easier to culture and amplify in a laboratory, has more stable gene background, does not have the problem of individual difference of the PBMC, and is favorable for the reproduction of experimental results. Therefore, THP-1 is an acute monocytic leukemia cell line commonly used in various laboratories, and is an ideal tool for researching biological effects such as immunity, inflammation and the like. In the existing method, phorbol ester (PMA) and Human Platelet Lysate (HPL) are used for inducing THP-1 cells to be differentiated into macrophages, the obtained macrophages have stable biological characteristics and high cell quality, but the induction process is complex and takes long time, and the HPL is rich in various cytokines, hormones and proteins and is easy to cause interference and influence on subsequent use and the like. Other methods mainly use PMA, but the PMA is used in a wide range (2.5 nM to 350 nM), the induction time is uncertain (24 h to 72 h), and the problems of mature state of macrophages, large difference of biological characteristics after further culture and the like are caused. Based on the differentiation of THP-1 into macrophages, macrophages can be induced to be polarized into M1 type by further using cytokine combinations such as interferon-gamma (IFN-gamma), Lipopolysaccharides (LPS) and the like. The macrophage polarization can be induced to be M2 type by using cytokine combinations such as interleukin-4 (interleukin-4, IL-4), interleukin-13 (interleukin-13, IL-13), interleukin-10 (interleukin-10, IL-10) and the like, but the cytokine combinations used by the existing macrophage polarization method have the problems of unfixed components, uncertain concentration and uncertain induction time.

The model of PMA induced differentiation of THP-1 monocyte into macrophages is widely used at present, but the influence of PMA on final cell quality (i.e. marker expression and secretion of M1 and M2 type macrophages) due to the combination of PMA concentration and time, polarization-inducing cytokines and concentration and time is lack of systematic research. The description of the specific preparation method for inducing the differentiation of the THP-1 monocyte lineage into macrophages and polarizing the macrophage models as M1 and M2 is not comprehensive enough. Under the actual condition, a complete culture scheme for inducing M1 and M2 macrophages needs to be established, and an efficient and economic experimental model is established.

Disclosure of Invention

The purpose of the invention is as follows: aiming at the problems or the defects in the prior art, the invention provides an in vitro culture method for efficiently inducing macrophage polarization and a marker for macrophage polarization analysis, wherein the scheme adopts the most efficient and economic culture scheme to induce THP-1 cells into macrophages, and then the macrophages are polarized into M1 and M2 types of macrophages; the culture scheme comprises optimal concentration and induction time of GM-CSF and PMA, optimal cytokine combination for inducing polarization, concentration and induction time; combining a plurality of markers (CD 11b, CD86, CD206, iNOS, Agr1 and IL-10) and carrying out cytomorphological analysis to identify induced M1 and M2 type macrophages, laying a foundation for research on genes, functions and the like of M1 and M2 type macrophages, and providing an ideal experimental model.

In order to achieve the above objects, an embodiment of the present invention provides an in vitro culture method for efficiently inducing macrophage polarization, comprising: the method comprises the following steps:

step 1, stimulating THP-1 monocytes with PMA and GM-CSF under serum-free conditions to differentiate into macrophages;

step 2, inducing the macrophages differentiated in the step 1 by using 20 ng/mL IFN-gamma and 100 ng/mL LPS for 24h to obtain M1 type macrophages;

step 3, inducing the macrophage differentiated in the step 1 by using 20 ng/mL IL-4 and 20 ng/mL IL-10 for 24h to obtain M2 type macrophage.

Further, the THP-1 monocytes are differentiated into macrophages in step 1 by the following steps: THP-1 monocyte is firstly cultured and expanded in RPMI1640 culture medium containing 10% fetal bovine serum, then is replaced by serum-free culture medium, and is stimulated by 100 ng/mL PMA and 10 ng/mL GM-CSF for 24h to differentiate into macrophage.

Further, the macrophages differentiated in the step 1 are placed in RPMI1640 medium to be cultured for standby.

The invention also provides a group of markers for identifying macrophage gene level, which is characterized by comprising IL-1 beta, iNOS, Arg1, CD206 and CD86, wherein the IL-1 beta, iNOS and CD86 are M1 type macrophage surface markers, and the Agr1 and CD206 are M2 type macrophage surface markers.

The technical scheme of the invention has the following beneficial effects:

(1) the invention adopts an economic and perfect model of polarization after PMA and GM-CSF induce the THP-1 monocyte to differentiate into macrophages, and systematically and completely expounds a specific preparation method of the model of PMA and GM-CSF induce the THP-1 monocyte to differentiate into macrophages. The differentiation-inducing macrophages and the polarized M1 and M2 macrophages were identified by detecting multiple markers (CD 11b, CD86, CD206, iNOS, CD206, Agr-1, IL-1. beta.). Cell differentiation and polarization typing are identified by technical means such as cell morphology analysis, immunofluorescence detection, protein immunoblotting analysis and the like. And a solid foundation is laid for the next gene and function researches through macrophages, M1 and M2 type macrophages. The invention provides a new scheme for preparing a macrophage model and lays a foundation for researching an ideal tool for immunity and inflammation.

(2) According to the method, animal serum is not used in the induction process, expression of differentiation and polarization key genes and cell survival rate are systematically detected by combining culture time and inducer concentration variables, the induction effect of different inducer combinations is comparatively evaluated, and parameters such as the combination, concentration and induction time of inducers are optimized. The optimized scheme is verified through immunofluorescence, western blotting and flow cytometry detection, the obtained optimized scheme is proved to have high induction efficiency and high stability and is superior to the existing scheme, and a set of complete culture scheme and identification system of the THP-1 cell in-vitro induced macrophage polarization model is established.

Drawings

FIG. 1 is a cell culture protocol of the present invention.

FIG. 2 shows the results of the culture protocol for induced differentiation of THP-1 into macrophages. Wherein: FIG. 2A shows that different concentration gradients of PMA induce 24h or 48 h of CD11b expression in cells; FIG. 2B shows that different concentration gradients of PMA induce cell viability for 24h or 48 h; FIG. 2C shows that different concentration gradients of GM-CSF and PMA induced CD11b expression in cells for 24 h; FIG. 2D shows that different concentration gradients of GM-CSF and PMA induced 24h cell survival.

FIG. 3 shows the results of the morphological analysis of THP-1 induced differentiation into macrophages. Wherein: FIG. 3A is a microscopic photograph of differently treated cells, with Control being THP-1 cells; FIG. 3B shows the results of cell area analysis; FIG. 3C shows the results of cell elongation factor analysis. P <0.05, P <0.01, P < 0.001.

FIG. 4 shows the results of protocol validation of IFN-. gamma.and LPS to polarize macrophages to M1 type. Wherein: FIG. 4A shows the expression of polarization markers after 24h of macrophage induction by IFN-gamma and LPS at different concentrations; FIG. 4B shows the expression of polarization markers after 20 ng/mL IFN-. gamma.and 50 ng/mL LPS induced macrophages for 24h, 48 h or 72 h; FIG. 4C shows the expression of polarization markers after 20 ng/mL IFN-. gamma.and 100 ng/mL LPS induced macrophages for 24h, 48 h or 72 h; untreated macrophages were used as controls in all of the above; FIG. 4D shows the cell viability after 24h, 48 h or 72 h of IFN- γ induction of macrophages with LPS at different concentrations.

FIG. 5 shows the optimized assay results for the protocol in which macrophages are polarized to M2 type. Wherein: FIG. 5A shows the expression of cellular polarization markers after 72 h induction with different concentrations of cytokine or combination of cytokines; FIG. 5B shows the expression of the cellular polarization markers induced by cytokines in each group at different induction times, and the total concentration of cytokines in each group was 40 ng/mL.

FIG. 6 shows the results of protocol validation of IL-4 and IL-10 to polarize macrophages into M2 type. Wherein: FIG. 6A shows the expression of polarization markers in cells after 24h induction according to different protocols; FIG. 6B shows the expression of polarization markers in cells after 48 h induction according to different protocols; FIG. 6C shows the expression of polarization markers of cells after 72 h induction according to different protocols; untreated macrophages were used as controls above: FIG. 6D shows the cell survival rate after macrophage induction for 24h, 48 h or 72 h according to different protocols.

FIG. 7 shows the result of morphological analysis of macrophages after polarization induction by the optimized protocol. Wherein: FIG. 7A is a photomicrograph of cells after various treatments, Control is untreated macrophages; FIG. 7B shows the results of cell area analysis; FIG. 7C shows the results of cell elongation factor analysis. P <0.05, P < 0.01.

FIG. 8 is a graph showing the results of the difference in surface molecular markers between THP-1 cells induced into macrophages in vitro and polarized into M1 and M2 types. Wherein: fig. 8A is a cell surface molecular marker staining analysis with bar = 50 μm; FIG. 8B is a graph showing that the difference of CD11B expression before and after the induction of THP-1 by PMA and GM-CSF is detected by flow cytometry, and A549 cells negative to CD11B are used as a control; fig. 8C and 8D show Western Blot analysis of CD86 and CD206 expression in cells after different induction treatments, with β -actin as an internal reference, p <0.05 and p < 0.01.

Detailed Description

The invention is described in further detail below with reference to the figures and specific experiments, but the invention should not be construed as being limited thereto. Modifications or substitutions to methods, procedures, or conditions of the invention may be made without departing from the spirit and scope of the invention. The experimental method without specific conditions and the reagents without formula in the experimental process are all according to the conventional conditions in the field.

The in vitro culture method for efficiently inducing macrophage polarization disclosed by the invention comprises the following processes as shown in figure 1: the method comprises the following steps:

step 1, culturing THP-1 mononuclear cells by using RPMI1640 culture medium containing 10% fetal bovine serum, inducing the culture for the first 24h by using serum-free culture medium, and differentiating the THP-1 mononuclear cells into macrophages after stimulating the THP-1 mononuclear cells for 24h by using GM-CSF (10 ng/mL) and PMA (100 ng/mL);

step 2, inducing the macrophages for 24 hours by using IFN-gamma (20 ng/mL) and LPS (100 ng/mL) to obtain M1 type macrophages;

step 3, inducing the macrophages for 24h by using IL-4 (20 ng/mL) and IL-10 (20 ng/mL) to obtain M2 type macrophages.

Example 1

THP-1 is a monocyte leukemia cell, macrophages derived from the monocyte highly express CD11b, and the THP-1 cell is induced to differentiate into the macrophages, and then the morphology is remarkably changed, and the THP-1 cell changes from a nearly circular suspension cell into a multi-protrusion adherent cell.

The invention detects the expression condition of CD11b of cells by a real-time quantitative gene amplification fluorescent detection system (q-PCR) and identifies the condition of induced differentiation of THP-1 cells into macrophages by cell morphology analysis.

First, the optimum PMA dosage was verified: PMA treatment groups with different concentration gradients are set, a blank (PMA concentration is 0) is used as a negative control, and the expression condition of the CD11b of the cells is detected by q-PCR, wherein the sequences of the used primers are shown in a table 1; cell viability was also measured by the MTT method.

The experimental results are shown in fig. 2A and fig. 2B, and it can be seen from fig. 2A that the expression of CD11B of THP-1 cell increases with the increase of PMA concentration, the expression of CD11B significantly increases after 100 ng/mL PMA induction, the expression of CD11B of cell tends to balance after PMA concentration is higher than 100 ng/mL, and there is no significant difference in the expression of CD11B of PMA induction at 24h and 48 h; as shown in FIG. 2B, the cell survival rate was higher when PMA was induced at 24h and at an induction concentration of not higher than 100 ng/mL, and the cell survival rate gradually decreased as the PMA induction time was prolonged and the concentration was increased.

The combination of the above results proves that PMA concentration of 100 ng/mL and induction of 24h are suitable experimental conditions.

Example 2

On the basis of the experiment of example 1, the effect of GM-CSF on THP-1 induced differentiation into macrophages is verified, and GM-CSF groups with different concentration gradients are added under the condition of adding certain concentration PMA and inducing for 24 hours, so as to detect the expression and the survival rate of cells CD11b, and the result is shown in FIG. 2C and FIG. 2D. As can be seen from FIGS. 2C and 2D, when the concentration of GM-CSF was higher than 5 ng/mL, the expression of cellular CD11b was significantly increased, far exceeding the induction effect of PMA alone, and the cell viability decreased gradually as the concentration of GM-CSF was further increased.

Therefore, it is concluded that the degree of differentiation and cell activity of macrophages obtained by inducing 24 hours together with 100 ng/mL PMA and 10 ng/mLGM-CSF are suitable, and that they can be used as culture conditions for inducing differentiation of THP-1 cells into macrophages.

The macrophages formed by the THP-1 cells induced 24h by 100 ng/mL PMA and 24h differentiation induced by 100 ng/mL PMA together with 10 ng/mL GM-CSF were observed under an inverted light microscope and photographed. The cell area and cell elongation factor (length of the cell major axis divided by length of the minor axis) were measured using Image J software, and the results are shown in fig. 3.

Experimental results prove that after induction, cells are changed from a suspension nearly spherical shape into an adherent multi-protuberant shape, the cell area is remarkably increased, and cell elongation factors are remarkably increased, which shows that suspended THP-1 cells are differentiated towards macrophages, wherein the cell morphology change is more obvious after the PMA and GM-CSF are simultaneously induced, namely the macrophage differentiation characteristic is more obvious.

In conclusion, it was determined that the 24h induction of 100 ng/mL PMA and 10 ng/mL LGM-CSF together is the culture condition for inducing the differentiation of THP-1 cells into macrophages.

Example 3

The invention designs a method for detecting the expression change of macrophage marker gene level by q-PCR to identify a macrophage polarization model.

The invention screens 5 genes closely related to macrophage polarization: IL-1 beta, iNOS, Arg1, CD206 and CD86, wherein the IL-1 beta, iNOS and CD86 are macrophage surface markers of M1 type, and Agr1 and CD206 are macrophage surface markers of M2 type. Primer sequences for amplifying genes were designed as shown in Table 1 below.

TABLE 1 amplification primer pair sequences

Primer name	Forward primer (5'->3')	Reverse primer (5'->3')
			CD11b	ACTTGCAGTGAGAACACGTATG	TCATCCGCCGAAAGTCATGTG
IL-1β	ATGATGGCTTATTACAGTGGCAA	GTCGGAGATTCGTAGCTGGA
			iNOS	TTCAGTATCACAACCTCAGCAAG	TGGACCTGCAAGTTAAAATCCC
CD206	GCCGGTGACCTCACAAGTAT	ACGAAGCCATTTGGTAAACG
			Agr1	GTGGAAACTTGCATGGACAAC	AATCCTGGCACATCGGGAATC
CD86	CTGCTCATCTATACACGGTTACC	GGAAACGTCGTACAGTTCTGTG
			GAPDH	GTAAGAAACCCTGGACCACCC	AGGGAGATGCTCAGTGTTGG

The existing method for polarizing macrophages into M1 type mainly uses IFN-gamma and LPS, but the dosage and induction time of the LPS are not consistent. The effective concentration range of LPS screened in the early stage is 10-500 ng/mL, on the basis, the different LPS dosages and induction time are compared systematically, and the optimal M1 type cell polarization scheme is verified.

First, LPS (10, 50, 100, 200, 500 ng/mL) and 20 ng/mL IFN-gamma were used as treatment groups with different concentration gradients, respectively, to induce 24h, and untreated macrophages were used as controls to detect the expression of M1-type macrophage polarization marker by PCR.

As shown in FIG. 4, the M1 type polarization results showed that the expression of CD86, IL-1. beta. and iNOS-1 was increased in each treatment group as compared with the control group, indicating that the cells were polarized to M1 type (FIG. 4A). Particularly, when the concentration of LPS is more than 50 ng/mL, the expression of IL-1 beta and iNOS-1 of the cells is increased more obviously, and the M1 type characteristics of the cells are more obvious; by increasing LPS concentration, the expression of CD86, IL-1 beta and iNOS-1 in cells tends to be balanced.

In a further example, the time required for cells to polarize to M1 type was explored, using 50 ng/mL or 100 ng/mL LPS and 20 ng/mL IFN-. gamma.as treatment groups to induce 24, 48, 72 h, respectively, and the expression of macrophage polarization markers was examined. As shown in FIGS. 4B and 4C, it was found that 48 h expression of some of the cellular polarization markers (IL-1. beta. and iNOS-1) was balanced at an LPS concentration of 50 ng/mL, whereas 24h expression of all of the cellular polarization markers was balanced at an LPS concentration of 100 ng/mL. Finally, the cell viability at different times was measured for each treatment group, and the results are shown in FIG. 4D. The experimental result shows that when the concentration of the LPS is 100 ng/mL, the cell viability rate is more than 90% in 72 h, the cell viability rate is not obviously influenced by the 100 ng/mL LPS, and when the concentration of the LPS is further increased (200 ng/mL), the cell viability rate is gradually reduced along with the prolonging of the culture time. Combining the expression conditions of the polarization markers, different culture times and comparative studies of cell viability, 100 ng/mL LPS and 20 ng/mL IFN-gamma are proved to be the optimal scheme for macrophage polarization to M1 type together for inducing 24 h.

Existing methods for the polarization of macrophages to M2 type: mainly, IL-13 or IL-10 and IL-4 are used for induction, but the concentration of each factor used and the induction time are different. The present invention systematically compares different cytokine combinations, dosages and induction times to screen for an optimal M2 type cell polarization protocol, and the results are shown in fig. 5. As can be seen from FIG. 5A, the expression of the cell polarization marker induced by the combination of cytokines is higher than that of the cytokine alone at the same total concentration, which suggests that the induction effect of the combination of cytokines is more desirable, wherein the induction effect of the combination of IL-4 and IL-13, and the induction effect of the combination of IL-4 and IL-10 are the best; the expression of the cell polarization marker is obviously increased along with the increase of the total concentration of the cell factors, and the expression of the cell polarization marker is balanced after the concentration reaches 40 ng/mL, which indicates that 40 ng/mL is the ideal use concentration of the cell factors. Comparing the expression of the polarization markers in each group of cells under different induction times in FIG. 5B, it can be seen that the cells can reach the polarization peak value in about 24h by using IL-10 or the combination containing IL-10, wherein the induction effect of the combination of IL-4 and IL-10 is the most ideal; while the remaining IL-4 and IL-13 groups required longer induction times. The screening shows that the induction of IL-4 and IL-10 (20 ng/mL each and 40 ng/mL total concentration) for 24h is a high-efficiency M2 type macrophage induction scheme.

The optimal M2 type macrophage polarization scheme screened out above is verified: several of the reported protocols were compared to the optimal protocol of the present invention and the results are shown in FIGS. 6A-6D. As is clear from FIGS. 6A to 6C, the expression of CD206 and Arg-1 was increased in each treatment group as compared with the control group, indicating that the cells were polarized to M2 type. At 24h, the polarization of cells was most evident with the combination of 20 ng/mL IL-4 and 20 ng/mL IL-10, with increasing time, the polarization of 20 ng/mL IL-4 and 20 ng/mL IL-13 increased gradually, and finally approached the combination of 20 ng/mL IL-4 and 20 ng/mL IL-10. Cell viability was measured by MTT for each protocol and it was shown that each cytokine combination that induced macrophage polarization to M2 type had little effect on cell viability within 72 h (fig. 6D). Taken together, the present invention demonstrates that the combination of 20 ng/mL IL-4 and 20 ng/mL IL-10 induces 24h as an optimal solution for macrophage M2-type polarization.

Example 4

The present invention uses cellular morphology to analyze the characteristics of macrophage polarization phenotype.

Macrophages induced by the optimized protocol as well as M1, M2 polarized macrophages were observed under an inverted light microscope and photographed. The cell area and cell elongation factor (length of the cell major axis divided by length of the minor axis) were measured using Image J software, and the results are shown in fig. 7. Compared with macrophages formed by differentiation, after the macrophages are acted by polarization inducers IFN-gamma and LPS, the cell protrusions are reduced, the shapes are rounded, and analysis shows that the cell area is reduced, the elongation factors are obviously reduced, and the typical M1 type polarization characteristic is presented; after the polarization inducers IL-4 and IL-10 act, the cells are further elongated, the change of the cell area is not large, but the elongation factor is obviously increased, and the cells have the typical polarization characteristics of M2. The results of the above morphological observation and analysis show that an effective macrophage polarization model can be obtained by using the optimization scheme of the invention.

Example 5

The invention designs and combines Immunofluorescence (IF), Flow Cytometry (FCM) and western immunoblotting (WB) to identify the differentiation and polarization states of macrophages.

Specific antibodies used for detection include: PE-labeled murine monoclonal antibody to CD11b (1: 200 dilution, Santa cruz, USA); alexa Fluor 488-labeled murine monoclonal antibody to CD86 (1: 200 dilution, Santa cruz, USA); APC-labeled murine monoclonal antibody to CD206 (1: 200 dilution, Santa cruz, USA). Wherein, CD11b is a classical marker of differentiated and mature macrophages and is used for identifying whether the macrophages are differentiated and mature; CD86 is a marker protein of M1 type macrophages, CD206 is a marker protein of M2 type macrophages, and the M1 type polarization and the M2 type polarization are identified by CD86 and CD206 respectively.

The expression condition of macrophage classical markers is detected by adopting IF and FCM, the expression tendency of macrophage polarization marker molecules is detected by adopting WB verification, the THP-1 cell optimized induction scheme obtained in the previous step is verified by the detection methods, whether the prepared macrophages are in proper differentiation and polarization states is determined, and the obtained result is shown in figure 8.

Immunofluorescence (IF) detection results show that M1 and M2 type cells induced in vitro both express macrophage marker CD11b, M1 type cells express CD86, and M2 type cells express CD206 (FIG. 8A).

Flow Cytometry (FCM) results showed that the THP-1 cells induced by PMA and GM-CSF showed right shift of CD11B expression peak, indicating that CD11B expression is increased and THP-1 differentiates into macrophages (FIG. 8B).

The result of Western Blotting (WB) shows that the cell CD206 expression of macrophages is increased after IL-4 and IL-10 induction, and M2 type characteristics appear; the expression of cellular CD86 increased after LPS and IFN-. gamma.induction, and M1-type characteristics appeared (FIG. 8C, D). The results show that the optimization scheme can successfully prepare differentiated mature macrophages and M1 and M2 polarized macrophages in vitro.

On the existing traditional model for PMA to induce THP-1 monocyte to differentiate into macrophage, the differentiation and polarization often fail, and the difference between experimental batches is huge. The reason for this is that the concentration of the inducer is high, animal serum is used in the culture process, and experimental parameters such as induction time are different and account for a great factor. In the invention, animal serum is not used in the induction process, and the induction effect of different inducer combinations is comparatively evaluated by means of differentiation, identification of polarization key marker genotypes, cytomorphological analysis and the like, so that parameters such as the concentration of the inducer, the induction time and the like are optimized. The optimized scheme is verified through immunofluorescence, western blotting and flow cytometry detection, the obtained optimized scheme is proved to have high induction efficiency and high stability and is superior to the existing scheme, and a set of complete culture scheme and identification system of the THP-1 cell in-vitro induced macrophage polarization model is established.

While the foregoing is directed to the preferred embodiment of the present invention, it will be understood by those skilled in the art that various changes and modifications may be made without departing from the spirit and scope of the invention as defined in the appended claims.

Claims

1. An in vitro culture method for efficiently inducing macrophage polarization is characterized in that: the method comprises the following steps:

2. The in vitro culture method according to claim 1, characterized in that: the THP-1 monocytes in step 1 are differentiated into macrophages by the following steps: THP-1 monocyte is firstly cultured and expanded in RPMI1640 culture medium containing 10% fetal bovine serum, then is replaced by serum-free culture medium, and is stimulated by 100 ng/mL PMA and 10 ng/mL GM-CSF for 24h to differentiate into macrophage.

3. The in vitro culture method according to claim 1, characterized in that: and (3) culturing the macrophages differentiated in the step 1 in an RPMI1640 culture medium for later use.

4. A group of markers for identifying macrophage gene level is characterized by comprising IL-1 beta, iNOS, Arg1, CD206 and CD86, wherein the IL-1 beta, the iNOS and the CD86 are M1 type macrophage surface markers, and Agr1 and CD206 are M2 type macrophage surface markers.