CN113975398B - Drug delivery carrier composition for treating liver fibrosis and preparation method thereof - Google Patents

Drug delivery carrier composition for treating liver fibrosis and preparation method thereof Download PDF

Info

Publication number
CN113975398B
CN113975398B CN202111320300.4A CN202111320300A CN113975398B CN 113975398 B CN113975398 B CN 113975398B CN 202111320300 A CN202111320300 A CN 202111320300A CN 113975398 B CN113975398 B CN 113975398B
Authority
CN
China
Prior art keywords
target
composition
liver fibrosis
hpdna
nucleic acid
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202111320300.4A
Other languages
Chinese (zh)
Other versions
CN113975398A (en
Inventor
赵灵之
徐澍
顾家玉
彭娟娟
田坤
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
China Pharmaceutical University
Original Assignee
China Pharmaceutical University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by China Pharmaceutical University filed Critical China Pharmaceutical University
Priority to CN202111320300.4A priority Critical patent/CN113975398B/en
Publication of CN113975398A publication Critical patent/CN113975398A/en
Application granted granted Critical
Publication of CN113975398B publication Critical patent/CN113975398B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/62—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being a protein, peptide or polyamino acid
    • A61K47/64—Drug-peptide, drug-protein or drug-polyamino acid conjugates, i.e. the modifying agent being a peptide, protein or polyamino acid which is covalently bonded or complexed to a therapeutically active agent
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/335—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin
    • A61K31/357—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having two or more oxygen atoms in the same ring, e.g. crown ethers, guanadrel
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7028—Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages
    • A61K31/7034—Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages attached to a carbocyclic compound, e.g. phloridzin
    • A61K31/704—Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages attached to a carbocyclic compound, e.g. phloridzin attached to a condensed carbocyclic ring system, e.g. sennosides, thiocolchicosides, escin, daunorubicin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7042—Compounds having saccharide radicals and heterocyclic rings
    • A61K31/7048—Compounds having saccharide radicals and heterocyclic rings having oxygen as a ring hetero atom, e.g. leucoglucosan, hesperidin, erythromycin, nystatin, digitoxin or digoxin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/43—Enzymes; Proenzymes; Derivatives thereof
    • A61K38/46—Hydrolases (3)
    • A61K38/465—Hydrolases (3) acting on ester bonds (3.1), e.g. lipases, ribonucleases
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/30—Macromolecular organic or inorganic compounds, e.g. inorganic polyphosphates
    • A61K47/34—Macromolecular compounds obtained otherwise than by reactions only involving carbon-to-carbon unsaturated bonds, e.g. polyesters, polyamino acids, polysiloxanes, polyphosphazines, copolymers of polyalkylene glycol or poloxamers
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/54—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/54—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
    • A61K47/549—Sugars, nucleosides, nucleotides or nucleic acids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/62—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being a protein, peptide or polyamino acid
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/0008—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'non-active' part of the composition delivered, e.g. wherein such 'non-active' part is not delivered simultaneously with the 'active' part of the composition
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/16—Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Public Health (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Epidemiology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Genetics & Genomics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biotechnology (AREA)
  • Inorganic Chemistry (AREA)
  • Immunology (AREA)
  • Biochemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Preparation (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

The invention discloses a drug delivery carrier composition for treating hepatic fibrosis and a preparation method thereof, wherein the drug delivery carrier composition comprises a composite nanomaterial obtained by self-assembly, a target peptide of a target hepatic stellate cell connected with the composite nanomaterial through click reaction, a composition for performing target cutting on target nucleic acid, and a chemical drug loaded in the composite nanomaterial for treating hepatic fibrosis. Targeting peptides targeting hepatic stellate cells using ligand-receptor binding mediated targeting, the composite nanomaterial specifically targets activated hepatic stellate cell surface receptors in the liver, thereby accurately delivering drug carriers into hepatic stellate cells; after entering cells, the target sequence is cut by the composition for carrying out targeted cutting on the target nucleic acid on the surface of the carrier, and the chemical medicine loaded in the hydrophobic core is slowly released for a long time.

Description

Drug delivery carrier composition for treating liver fibrosis and preparation method thereof
Technical Field
The invention belongs to the technical field of biological medicines, and particularly relates to a drug delivery carrier composition for treating hepatic fibrosis and a preparation method thereof.
Background
Liver fibrosis is a chronic liver injury caused by toxins, pathogens, metabolic diseases or autoimmune diseases, is prone to repeated tissue accumulation, and may further progress to cirrhosis, liver failure, and even liver cancer. Chronic liver injury of any cause can lead to liver fibrosis, interfering with normal tissue function.
Activation of Hepatic Stellate Cells (HSCs) is a key factor in liver fibrosis. In the normal liver, HSCs are in a quiescent state. Following fibrogenic stimulation, HSCs are activated and then transformed into myofibroblasts expressing smooth muscle actin (α -sma), resulting in shrinkage of liver tissue and production of large amounts of extracellular matrix (ECM) and matrix metalloproteinase inhibitor (TIMP). The synthesis and degradation of ECM in the liver are unbalanced, abnormal collagen fiber deposition is increased, and the development of liver fibrosis is promoted. Thus, activated HSCs are important targets for drug intervention therapy for liver fibrosis.
Numerous studies have shown that in fibrotic liver many receptors are overexpressed on the surface of activated HSCs, so one targeting approach currently in common use is to modify specific ligands on the nanoparticle surface that bind to HSC surface receptors, exploiting ligand-receptor binding mediated targeting, and thus accurately deliver the nanoparticles into HSCs.
The traditional medicines for treating liver fibrosis are various, and the purpose of resisting liver fibrosis is mainly achieved by acting on different links of the occurrence of liver fibrosis, wherein the medicines comprise medicines for hepatic stellate cells, medicines for cytokines, medicines for influencing collagen synthesis and metabolism, medicines for protecting and preventing liver injury and the like. However, part of the drugs have certain toxicity when used alone, and have poor specificity, low bioavailability and short half-life.
The nanometer drug delivery system is a new drug preparation at present, and through reasonable design, the nanometer carrier can accurately deliver the drug to the target part and target cells, prolong the systemic circulation time of the drug, improve the treatment effect, reduce adverse reaction and provide a new method and a new thought for treating hepatic fibrosis.
The nano material has great development prospect in the fields of materials, biology, medicine and the like as a multifunctional material. In addition, as a hotspot of research in the medical community today, nanomaterials have been widely used in the construction of drug delivery systems. The composite nano material obtained by self-assembly refers to core-shell structure nano particles which simultaneously contain hydrophilic chain segments and hydrophobic chain segments and can be self-assembled in water phase. The hydrophilic shell is used for avoiding being recognized by reticuloendothelial system, prolonging the body circulation time, and the hydrophobic core can encapsulate the hydrophobic drug and improve the solubility and stability of the hydrophobic drug. The surface of the nano carrier can also be subjected to various modified or connected modified specific targeting molecules, so that the specific targeting of the medicine to the lesion site is realized.
For example, chinese patent CN 102961360B discloses a liver targeting nano drug delivery system of oxymatrine and a preparation method thereof, the system uses polyethylene glycol-polycaprolactone block polymer as a carrier, prepares polymer nanoparticles by a thin film dispersion method, a reverse evaporation method or an organic solvent injection method, encapsulates oxymatrine in the polymer nanoparticles, and then modifies ligand neoglycoprotein or cyclooctapeptide on the surface of the nanoparticles as a ligand to construct a liver fibrosis resistant nano targeting drug delivery system for hepatic stellate cells, the system can increase the chance that the nanoparticles enter the liver through blood circulation, is beneficial to target distribution of drugs in the focus of the liver, is beneficial to absorption of drug-loaded nanoparticles in the lesion of the liver and uptake of hepatic stellate cells so as to improve the liver fibrosis treatment effect. However, after the drug delivery system enters cells, the target sequence cannot be efficiently cut, for example, free probes and enzymes are used for colliding target substrates, the collision probability is low, and off-target conditions are very easy to occur.
Gene editing is an emerging relatively accurate genetic engineering technique or process that can modify a specific target gene of a specific genome of an organism. To date, many gene editing systems have been reported, such as zinc finger ribonuclease (ZFN) systems, transcription activation-like effector nuclease (TALEN) systems, clustered regularly interspaced short palindromic repeat systems (CRISPR-Cas) systems, and the like. CRISPR-related systems have been applied to genomic and epigenetic modifications of cells, animals and plants, presenting great potential. However, almost all CRISPR-associated systems today require PAM (protospacer adjacent motif) sequences to target, which limits the target space in the human genome. On the other hand, critical Cas9 and Cas12 proteins of CRISPR-related systems are inconvenient to package and transport in vivo due to their large volumes. In addition, the literature reports that Cas9 protein can cleave DNA sequences and Cas13 protein can cleave RNA sequences, but none Cas protein can cleave DNA and RNA at the same time well, which may limit its application.
There has been reported in the literature a novel gene editing system, designated as HpSGN system, a composition for targeted cleavage of arbitrary nucleic acids, comprising two main components: component A: oligonucleotide probes: the oligonucleotide probe consists of two parts, one part is complementary to the target substrate, and the other part has a stem-loop nucleic acid secondary structure; component B: endonuclease molecules: the endonuclease molecule can recognize the nucleic acid secondary structure of the oligonucleotide probe in the component A so as to be combined with the probe, and can also cut DNA or RNA substrates. The system has the advantages of no target gene sequence limitation, small volume, high reaction efficiency and better specificity.
Currently, the research on the potential mechanism of liver fibrosis disease development is quite mature, and the fibrosis development involves multiple signal paths, so that single-drug and single-target anti-fibrosis treatment effects are often limited. Therefore, strategies for treating liver fibrosis by combined administration are widely studied, and the combined use of two or more therapeutic methods with different action mechanisms or action targets is expected to show synergistic anti-fibrosis effects.
Disclosure of Invention
The invention aims to provide a drug delivery carrier composition for treating liver fibrosis and a preparation method thereof, wherein the drug delivery carrier composition comprises a composite nano material obtained by self-assembly, a target peptide for targeting hepatic stellate cells, a composition (HpSGN system) for performing target cutting on target nucleic acid and a chemical drug for treating the liver fibrosis, and the multiple channels are mutually matched and cooperate to achieve the aim of jointly improving the treatment effect of the liver fibrosis.
The specific technical scheme of the invention is as follows: a drug delivery carrier composition for treating hepatic fibrosis comprises a composite nanomaterial obtained by self-assembly, a target peptide for targeting hepatic stellate cells, a composition for performing targeted cleavage on target nucleic acid and a chemical drug for treating hepatic fibrosis, wherein the chemical drug for treating hepatic fibrosis is loaded inside the composite nanomaterial, and the target peptide for targeting hepatic stellate cells and the composition for performing targeted cleavage on target nucleic acid are connected to the surface of the composite nanomaterial.
Further, the self-assembled composite nano material is obtained by self-assembling a silicon source and an amphiphilic polymer, and the particle size is 1-200nm.
Further, the targeting peptide for targeting hepatic stellate cells is one of vitamin A, cyclic RGD peptide, mannose-6-phosphate (M6P), PDGF beta-receptor recognition peptide (pPB) and CTCE 9908.
Preferably, the receptor for targeting hepatic stellate cells comprises one of retinol-binding protein (RBP) receptor, collagen type vi receptor (CVIR), mannose-6-phosphate/insulin like growth factor ii (M6P/igfii) receptor, platelet-derived growth factor receptor (platelet derived growth factor receptors, PDGFR) and chemokine receptor 4 (CXC chemokine receptor, cxcr 4).
Further, the composition for performing targeted cleavage of a target nucleic acid comprises an endonuclease molecule and an oligonucleotide probe;
preferably, the endonuclease molecule is a partial domain or a holoenzyme fragment of any one of AfuFEN, pfuFEN, mjaFEN, mthFEN, homoSapiensFEN;
preferably, the oligonucleotide probe consists of two parts: one part is complementary to the target nucleic acid substrate, the otherPart of the nucleic acid has a stem-loop secondary structure; the stem-loop nucleic acid secondary structure refers to an inverted repeat sequence existing in a nucleic acid molecule, and long-chain segments can be folded back to form a secondary structure due to hydrogen bond pairing between complementary bases, as shown in the figure2The number of oligonucleotide probes is 1 or 2 as shown.
Further, the chemical for treating liver fibrosis is any one or a combination of at least two of silybin, glycyrrhizic acid, picroside, baicalein, curcumin, sodium ferulate, oxymatrine, quercetin, ceone, tetrandrine, tanshinone IIV, colchicine, rosiglitazone, pioglitazone, nilotinib, genistein, imatinib mesylate, dasatinib, sorafenib, vitamin C, ursodeoxycholic acid, obeticholic acid, pirfenidone, losartan and polyunsaturated phosphatidylcholine.
The preparation method of the drug delivery carrier composition for treating liver fibrosis comprises the following steps: firstly, synthesizing a composite nano material obtained by self-assembly by utilizing a silicon source and an amphiphilic polymer; then, connecting the target peptide of the target hepatic stellate cells with the composite nanomaterial through click reaction to obtain the composite nanomaterial of the target hepatic stellate cells; then the medicine for treating hepatic fibrosis is loaded into the composite nano material by using an ultrasonic loading method; and the composition for performing targeted cleavage on the target nucleic acid is connected with the composite nanomaterial through click reaction, so that the drug delivery carrier composition for treating liver fibrosis is obtained.
Further, the click reaction includes an azide-alkyne reaction and/or a thiol-double bond reaction.
Compared with the prior art, the invention has the following advantages:
1. the drug delivery carrier composition combines chemical drugs with gene therapy to comprehensively improve the treatment effect of hepatic fibrosis, the targeting peptide connected to the composite nanomaterial can specifically target hepatic stellate cell surface receptors activated in the liver, and further accumulate in a large amount in the damaged liver, so that longer retention time is shown, probes in the composition for carrying out targeted cutting on target nucleic acid connected to the surface of the composite nanomaterial are paired with target sequences, corresponding endonuclease accurately shears the target sequences, and meanwhile, the chemical drugs loaded in the hydrophobic core of the composite nanomaterial which are accurately delivered to hepatic stellate cells and enriched in the fibrotic liver are slowly released, so that the effects of drug loading, efficient liver feeding and long-acting release in the liver are realized;
2. the protein molecules for cutting the target nucleic acid substrate are much smaller than the molecular weight of Cas protein families such as Cas9, cas12, cas13 and the like, so that the preparation and in-vivo delivery of the composition are facilitated;
3. the cleaved target nucleic acid substrates to which the present invention relates are free of sequence or type limitations;
4. in the composition disclosed by the invention, when the composition for carrying out targeted cutting on the target nucleic acid connected to the surface of the composite nano material is used for cutting different target nucleic acid substrates, the cutting on different nucleic acids can be realized without changing enzymes only by changing corresponding probes, so that the treatment on different diseases is realized, and the composition has better universality;
5. when the composition disclosed by the invention acts on a human body, when the composite nano material is accurately delivered to hepatic stellate cells and is enriched in fibrotic livers, the medicine loaded in the hydrophobic core of the composition can be slowly released, so that the systemic circulation time of the medicine is prolonged, the treatment effect is improved, adverse reactions are reduced, the process of high-efficiency medicine loading into livers and long-term medicine release in the livers is realized, and the treatment effect is better;
6. according to the composition disclosed by the invention, the surface of the composite nano material is connected with the HpSGN system, and endonuclease FEN1 and the hpDNA probe are simultaneously modified on the surface of the composite nano material, so that the distance between the two probes is shortened, and the probability of the FEN1 and the hpDNA connected to the composite nano material colliding with a target substrate is larger than the probability of the FEN1 and the hpDNA two independently diffused molecules simultaneously colliding with the target substrate, so that the gene editing efficiency can be effectively improved.
Drawings
FIG. 1 is a flow chart of the preparation of a drug delivery vehicle composition for the treatment of liver fibrosis;
FIG. 2 is a graph showing particle sizes of SCLMs, MAL-SCLM, CTSCLMs and FEN1-hpDNA-CTSCLMs prepared in example 1, respectively, corresponding to four panels A-D;
FIG. 3 is a graph showing comparison of cleavage efficiency of FEN1-hpDNA-SCLMs and free FEN1-hpDNA obtained in example 2;
FIG. 4 is a graph showing the biodistribution of FEN1-hpDNA-SCLMs and FENI-hpDNA-CTSCLMs in carbon tetrachloride-induced liver fibrosis mice obtained in example 3;
FIG. 5 is a graph showing the treatment of CCl for each treatment of example 4 4 Statistical graphs of the effect of TIMP1 mRNA expression levels in induced liver fibrosis mice;
FIG. 6 is a graph showing the treatment of CCl for each treatment of example 5 4 Statistical graphs of the effect of ALT, AST, hyp levels in induced liver fibrosis mice;
FIG. 7 is a graph showing the treatment of CCl for each treatment of example 5 4 Pathological detection results of induced liver fibrosis mice, including liver HE and Masson staining results.
Detailed Description
The following description of the present invention is provided with reference to the accompanying drawings, but is not limited to the following description, and any modifications or equivalent substitutions of the present invention should be included in the scope of the present invention without departing from the spirit and scope of the present invention.
The room temperature in the examples below is 25-28 ℃; the raw materials and the reagents are all commercial products.
All statistical analyses were performed using SPSS 22.0 for two independent sample T-tests.
Example 1
< Synthesis of related composite nanomaterial >
Synthesis of composite nanomaterials (SCLMs) obtained by self-assembly of silica and amphiphilic polymers
Taking out
Figure BDA0003344931800000061
(abbreviated as F108 hereinafter, F108 is a triblock copolymer of ethylene oxide-propylene oxide-ethylene oxide PEO-PPO-PEO, PEO is hydrophilic, PPO is hydrophobic, mw,14.6kDa,0.25 g) was dissolved in HCl (7.5 mL) at room temperature2.0M) was stirred for 15min to dissolve it well. 240. Mu.L of cyclohexane was added and sonicated for 2min to allow sufficient mixing until the solution appeared milky, and stirring was continued at room temperature for 0.5h to allow sufficient dissolution. 268. Mu.L of tetraethyl silicate was added and stirred at room temperature for 4h, and 40. Mu.L of dimethyldiethoxysilane DEDMs was added. After 24h of reaction, the solution was collected and dialyzed overnight against deionized water using a dialysis membrane with molecular weight 20000D to remove impurities.
The composite nanomaterial obtained was subjected to rotary evaporation at 50℃under 150mbar for 30min under suspension to remove cyclohexane. After spin steaming, centrifuging at 5000rpm/min for 10min, collecting supernatant to obtain SCLMs, and after assembly, forming PPO into hydrophobic core.
Synthesis of Mal-F108-Mal
Tetrahydrofuran THF (20 mL), triphenylphosphine PPh3 (392 mg), N-hydroxymaleimide (112.5 mg) and F108 (Mw, 14.6kDa,7.4 g) were added sequentially to a 100mL flask and cooled to 0 ℃. Diisopropyl azodicarboxylate DIAD (73.6. Mu.L) was dissolved in THF (2 mL), and was added dropwise to the flask, and the reaction was continued at 0℃for 30min. Subsequently, the mixture was warmed to room temperature and stirred overnight. Thereafter, the solvent was removed by evaporation under reduced pressure, and the precipitate was resuspended in a mixed solution of n-hexane and ethyl acetate (n-hexane: ethyl acetate, 50:50). The crude product was filtered and washed 3 times with a mixture of n-hexane and ethyl acetate (n-hexane: ethyl acetate, 50:50) and finally dried to give the product Mal-F108-Mal.
Synthesis of SCLMs (CTSCLMs) to which CTCE9908 peptide is linked
F108 (0.215 g) and Mal-F108-Mal (0.035 g) were mixed in HCl (7.5 mL, 2M) solution and stirred at room temperature for 15min, followed by the same procedure as described above for the synthesis of SCLMs, and the synthesized nanomaterial was represented by Mal-SCLMs (i.e., a maleimide-supported composite material for subsequent ligation by click reaction with thiol groups in the targeting peptide or in the composition for targeted cleavage of the target nucleic acid). CTCE9908 (1.8 mg) was then added to Mal-SCLMs, and after stirring at room temperature for 2h, the solution was collected and dialyzed overnight under the same dialysis conditions as above. After the dialysis was completed, the solution in the collection bag was centrifuged at 5000rpm for 10min, and the supernatant was taken to obtain CTSCLMs.
CTCE9908 peptide sequence: lys-Gly-Val-Ser-Leu-Ser-Tyr-Arg-Cys-Arg-Tyr-Ser-Leu-Ser-Val-Gly-Lys
Synthesis of HpSGN (FEN1+hpDNA) -linked composite nanomaterial
FEN1 (an endonuclease with a nucleotide sequence shown as SEQ ID NO.1 and an encoded amino acid sequence shown as SEQ ID NO. 2) is dissolved in a non-amine buffer solution (pH=8.0), and 0.1-5mM EDTA is added into the buffer solution to chelate divalent metals in the solution and prevent oxidization of sulfhydryl groups. Depending on the size and concentration of FEN1 and the desired level of thiolation, 2-iminothiolane hydrochloride is added to the solution in a 2-20 fold molar excess and incubated for 1 hour at room temperature to give FEN1-SH.
And modifying sulfhydryl group at the 5' end of the hpDNA probe to obtain the hpDNA-SH.
FEN1-SH (400 pmol), hpDNA-SH (3600 pmol) was added to SCLMs (0.78 mg), and reacted at room temperature for 2 hours to obtain a solution, namely FEN1-hpDNA-SCLMs. The method of connecting the CTSCLMs of the HpSGN system (FEN1+hpDNA) is the same as described above and is denoted FEN1-hpDNA-CTSCLMs. The method of ligating the control sequence NThpDNA (i.e., the negative control group having the stem-loop secondary structure sequence without the complementary functional sequence to the target nucleic acid substrate) is identical to that described above and is denoted FEN1-NThpDNA-CTSCLMs.
The SCLMs prepared in this example were characterized by Dynamic Light Scattering (DLS), mal-SCLMs, CTSCLMs, FEN1-hpDNA-CTSCLMs. As can be seen from the four panels A-D in FIG. 2, the particle sizes of SCLMs, MAL-SCLMs, CTSCLMs, FEN1-hpDNA-CTSCLMs are all about 80nm, and the distribution is relatively uniform, which indicates that the introduction of maleimide, and the modification of CTCE9908 and the HpSGN system (FEN1+hpDNA) do not cause significant change in particle size.
Example 2
< cleavage efficiency of HpSGN (FEN1+hpDNA) attached to SCLMs was higher than that of free HpSGN (FEN1+hpDNA) >
FEN1-hpDNA-SCLMs were synthesized as in example 1, with fluorescent Cy2 labeling the 5-terminus of the target substrate S2, matching the hpDNA probe hp-2-SH with a stem-loop structure.
The complete sequence of the running probe is as follows (thiol 5'-3', wherein the underlined sequence of the part is fixed
hp-2-SH:
AAAAAAAAAACCGAAGGGCATGAGCTGCTAGAGTCGGCCTTTTGGCCGACTCTC；
Running gel substrate (5 '-3')
S2:
Cy2-CGUGCAGCUCAUCAUGCAGCAGCUCAUGCCCUUCGG
From hpDNA, single stranded RNA (ssRNA) substrate (10 pmol), 3- (N-morpholino) propanesulfonic acid MOPS (10 mM), 0.05% Tween 20Tween-20,0.01% ethylphenyl polyethylene glycol nonidet P-40, mgCl 2 (7.5 mM) and an appropriate amount of FEN1 were formulated into 10. Mu.L of a reaction mixture, and reacted at 37℃for 2 hours. The 5' end of the substrate ssRNA is labeled with fluorescent FAM. The products obtained from the above reaction were analysed by polyacrylamide gel electrophoresis (PAGE) under denaturing conditions. The loading buffer contained 90% formamide, 0.5% edta, 0.1% xylene cyanogen, and 0.1% bromophenol blue. Before loading, 10. Mu.L of loading buffer was added to 10. Mu.L of the reaction mixture, and 20. Mu.L of the sample was reacted in boiling water for 5 minutes, and then cooled on ice. The samples were then loaded onto a 20% PAGE gel at room temperature and run in a buffer containing urea (8.7M) and tri-borate (89 mM). The electrophoresis speed was 9.6V/cm for 2 hours. The gel was imaged using an Amersham Imager 600 (GE Healthcare). The running method of FEN1-hpDNA-SCLMs is identical to the method of free FEN1-hpDNA. As shown in FIG. 3, the remaining RNA substrate after cleavage was counted at the same dilution ratio, and as can be seen from panel C in FIG. 3, FEN1-hpDNA-SCLMs were significantly more efficient than free FEN1-hpDNA.
Example 3
<FEN1-hpDNA-SCLMs and FENI-hpDNA-CTSCLMs in carbon tetrachloride (CCl) 4 ) Biodistribution in induced liver fibrosis mice>
Synthesis of FEN1-hpDNA-SCLMs and FEN1-hpDNA-CTSCLMs modified Cy5.5:
cy5.5 is a near infrared fluorescent dye with maximum excitation light and emission light of 675nm and 694nm respectively. Cy5.5 (2 mg) was weighed in 1mL anhydrous Dimethylformamide (DMF) and stored at-20deg.C in the dark. mu.L of aminopropyl triethoxysilane (APES) was added to 18. Mu.L of DMF, and the mixture was mixed well, 2. Mu.L of the above mixed solution was added to 50. Mu.L of Cy5.5 (2 mg. Multidot. ML-1) solution, and reacted at room temperature under a dark condition for 24 hours. Under the condition of avoiding light, 100 mu L of triethanolamine solution (triethanolamine: deionized water mass ratio 1:1) is added into 5mL of FEN1-hpDNA-SCLMs (20 mg.mL-1) solution, then pretreated Cy5.5 solution is added, and the mixture is stirred for 24 hours at room temperature in a dark place. After the reaction is finished, the solution is taken out and transferred into a dialysis bag with the molecular weight of 20000D, and is placed into deionized water for light-shielding dialysis overnight, and the solution in the bag is collected to obtain the FEN1-hpDNA-SCLMs loaded with Cy5.5.
The method for obtaining FEN1-hpDNA-CTSCLMs loaded with Cy5.5 is the same as above.
ICR mice of 6-8 weeks of age were given intraperitoneal injections of 10% CCl 4 Corn oil solution (10 mL kg) -1 ) Twice weekly for 4 weeks, a mouse fibrosis model was established. After the end of the molding, the model mice were randomly divided into two groups, and FEN1-hpDNA-SCLMs and FENI-hpDNA-CTSCLMs (4 mg. ML-1,0.2 mL) labeled with Cy5.5 were injected into the tail vein, respectively. After 2h, 12h, 24h, 48h, 96h, mice were sacrificed, heart, liver, spleen, lung and kidney tissues of each group of mice were collected, and images were acquired using a small animal living imaging system.
As shown in FIG. 4, from the organ distribution, both FEN1-hpDNA-SCLMs and FENI-hpDNA-CTSCLMs labeled by Cy5.5 injected through tail vein are mainly distributed in liver, and fluorescence intensity of FEN1-hpDNA-CTSCLMs in liver is significantly higher than that of FEN1-hpDNA-SCLMs. The results indicate that FEN1-hpDNA-CTSCLMs have significant targeting in injured livers. Fluorescence of Cy5.5-labeled FEN1-hpDNA-CTSCLMs was still detectable 96h after injection, indicating long in vivo circulation time after intravenous injection. The above results suggest that FEN1-hpDNA-CTSCLMs can accumulate in large amounts and exhibit longer residence times in the damaged liver as a drug delivery system.
Example 4
<CTSCLMs combined with HpSGN system (FEN1+hpDNA) in CCl 4 mRNA for TIMP1 can be significantly reduced in induced liver fibrosis miceExpression of>
ICR mice of 6-8 weeks of age were given intraperitoneal injections of 10% CCl 4 Corn oil solution (10 mL kg) -1 ) Twice weekly for 4 weeks, a mouse fibrosis model was established. The third week of molding begins with the injection of each group of therapeutic drugs via the tail vein, each CCl 4 The following day of injection, tail intravenous drug injections of Free FEN1-hpDNA, FEN1-NThpDNA-CTSCLMs, FEN1-hpDNA-CTSCLMs were performed for two weeks. After the treatment, the liver tissue was taken and added to Trizol for lysis, and total RNA in the cells was extracted and quantified using an RNA extraction kit according to the instructions. After RNA extraction, RNA cDNA was reverse transcribed using a reverse transcription kit and the expression level of TIMP1 gene was quantitatively analyzed using a 2- ΔΔct method with β -actin as a control, in strict compliance with the kit instructions.
hpDNA of sheared TIMP:
5’-AAAAAAAAAAGGCCCGTGATGAGAAACTCTTAGAGTCGGCCTTTTGGCCGACTCTC-3′
NThpDNA:
5’-AAAAAAAAAAACGTGACACGTTCGGAGAAAGAGTCGGCCTTTTGGCCGACTCTC-3′
qPCR sequence
mTIMP1
5’-GCAACTCGGACCTGGTCATAA-3’
5’-CGGCCCGTGATGAGAAACT-3’
mβ-actin：
5’-GGCTGTATTCCCCTCCATCG-3’
5’-CCAGTTGGTAACAATGCCATGT-3’
The results are shown in FIG. 5, and CCl is compared with healthy mice 4 Induced liver fibrosis mice had significantly elevated TIMP1 mRNA levels. After treatment of each group, there was no significant change in TIMP1 mRNA levels in Free FEN1-hpDNA, FEN1-NThpDNA-CTSCLMs groups compared to the model groups, and FEN1-hpDNA-CTSCLMs groups were significantly reduced compared to the model groups. The CTSCLMs are good vectors for delivering a treatment system, the HpSGN system needs to pair corresponding hpDNA with a target sequence, and FEN1-hpDNA-CTSCLMs can effectively cut TIMP1 mRNA and effectively treat hepatic fibrosis.
Example 5
<The chemical drugs Rosiglitazone (RGZ), the HpSGN system (FEN1+hpDNA) and the combination of the two in CCl 4 Therapeutic effects in induced liver fibrosis mice>
Preparation of RGZ-loaded nano drug delivery system
RGZ 5mg was weighed out and dissolved in dimethyl sulfoxide DMSO (50. Mu.L). Then 10. Mu.L of CTSCLMs (20 mg. ML) were added to 1mL of CTSCLMs under vigorous sonication -1 ) Is in the PPO hydrophobic core of (c). CTSCLMs for load RGZ are denoted rgz@ctsclms. The RGZ-loaded FEN1-hpDNA-CTSCLMs method is consistent with the above, and the obtained target product is expressed as RGZ@FEN1-hpDNA-CTSCLMs.
ICR mice of 6-8 weeks of age were given intraperitoneal injections of 10% CCl 4 Corn oil solution (10 mL kg) -1 ) Twice weekly for 4 weeks, a mouse fibrosis model was established. The animal experiments are divided into eight groups, namely Control and CCl 4 Free RGZ, free FEN1-hpDNA, FEN1-NThpDNA-CTSCLMs, RGZ@CTSCLMs, FEN1-hpDNA-CTSCLMs, RGZ@FEN1-hpDNA-CTSCLMs. The third week of molding begins with the injection of each group of therapeutic drugs via the tail vein, each CCl 4 The following day after injection, tail vein drug injection was performed for two weeks, and mice were observed for state changes and body weights were recorded. Blood of mice is collected by eyeball blood collection method after treatment, and after standing, the mice are centrifuged at 3000rpm/min for 10min, and the supernatant is taken to obtain serum. Detecting the content of glutamic pyruvic transaminase (ALT) and glutamic oxaloacetic transaminase (AST) in serum according to the experimental operation method of each kit; liver was taken and the hydroxyproline (Hyp) content was measured with a kit to evaluate the effect of each group. Part of the liver was fixed in paraformaldehyde, paraffin embedded and sections were HE stained and Masson stained.
ALT and AST in serum are key indicators for assessing liver function impairment. Hydroxyproline is one of the main components of collagen, and thus the condition of collagen in liver tissue can be evaluated by measuring the content of hydroxyproline.
As shown in FIG. 6, compared with healthy mice, CCl was passed through 4 The ALT, AST, hyp level of mice was significantly increased after molding. Compared with the injection of Free RGZ, the level and the content of ALT, AST, hyp are obviously reduced after the injection of RGZ@CTSCLMs, which indicates the targeting drug delivery function of the CTSCLMsCan obviously enhance the therapeutic effect of the medicine. The treatment effect of the FEN1-hpDNA-CTSCLMs group is also obviously stronger than that of the Free FEN1-hpDNA and FEN1-NThpDNA-CTSCLMs groups. When RGZ@FEN1-hpDNA-CTSCLMs are continuously given for combined treatment, the level and content of ALT, AST, hyp are obviously reduced compared with the RGZ@CTSCLMs or FEN1-hpDNA-CTSCLMs, which indicates that the combined treatment of the RGZ@CTSCLMs and the FEN1-hpDNA-CTSCLMs can enhance the treatment effect on hepatic fibrosis.
As shown in fig. 7, HE staining shows that the liver tissue structure of mice in the model group is disordered, inflammatory cells infiltrate obviously, and a large number of cells are steatosis; compared with other treatment groups, the RGZ@FEN1-hpDNA-CTSCLMs group has the optimal treatment effect and obviously reduces the liver fibrosis degree. As can be seen from the Masson staining results, a large amount of blue collagen deposition was seen in liver tissue of the model mice compared to control mice, suggesting that in CCl 4 After molding, liver tissue endocrine excess collagen and deposits at the liver injury. Compared with the mice in the model group, the collagen deposition conditions of liver tissues of the mice in the RGZ@CTSCLMs, FEN1-hpDNA-CTSCLMs and RGZ@FEN1-hpDNA-CTSCLMs are improved, and the collagen areas of blue collagen are reduced to different degrees. Of these, the most remarkable degree of collagen reduction was observed in the RGZ@FEN1-hpDNA-CTSCLMs group, and the results indicate that the combination treatment of both the chemical drug and the HpSGN system can enhance the therapeutic effect on hepatic fibrosis.
The foregoing description is only illustrative of the present invention and is not intended to limit the scope of the invention, and all equivalent structures or equivalent processes or direct or indirect application in other related technical fields are included in the scope of the present invention.

Claims (3)

1. The drug delivery carrier composition for treating liver fibrosis is characterized by comprising a composite nano material obtained by self-assembly, a target peptide for targeting hepatic stellate cells, a composition for performing targeted cleavage on target nucleic acid and a chemical drug for treating liver fibrosis, wherein the chemical drug for treating liver fibrosis is loaded inside the composite nano material, and the target peptide for targeting hepatic stellate cells and the composition for performing targeted cleavage on target nucleic acid are connected to the surface of the composite nano material;
the self-assembled composite nano material is obtained by self-assembling a triblock copolymer of tetraethyl silicate, dimethyl diethoxysilane and ethylene oxide-propylene oxide-ethylene oxide with the molecular weight of 14.6 kDa;
the target peptide of the target hepatic stellate cells is CTCE9908;
the composition for performing targeted cleavage on the target nucleic acid comprises an endonuclease molecule and an oligonucleotide probe;
the nucleotide sequence of the endonuclease is shown as SEQ ID NO.1, and the coded amino acid sequence is shown as SEQ ID NO. 2;
the oligonucleotide probe consists of two parts, one part is complementary to the target nucleic acid substrate, and the other part has a nucleic acid secondary structure;
the sequence of the oligonucleotide probe is:
AAAAAAAAAACCGAAGGGCATGAGCTGCTAGAGTCGGCCTTTTGGCC GACTCTC；
the number of oligonucleotide probes is 1 or 2.
2. A drug delivery vehicle composition for treating liver fibrosis according to claim 1, wherein the chemical drug for treating liver fibrosis is any one or a combination of at least two of silibinin, glycyrrhizic acid, picroside, baicalein, curcumin, sodium ferulate, oxymatrine, quercetin, ceone, tetrandrine, tanshinone IIV, colchicine, rosiglitazone, pioglitazone, nilotinib, genistein, imatinib mesylate, dasatinib, sorafenib, veratemol, ursodeoxycholic acid, obeticholic acid, pirfenidone, losartan, polyunsaturated phosphatidylcholine.
3. A drug delivery vehicle composition for treating liver fibrosis according to claim 2, wherein the receptor for the targeting peptide of hepatic stellate cells comprises one of retinol binding protein receptor, collagen type vi receptor, mannose-6-phosphate/insulin-like receptor, platelet derived growth factor receptor and chemokine receptor 4.
CN202111320300.4A 2021-11-09 2021-11-09 Drug delivery carrier composition for treating liver fibrosis and preparation method thereof Active CN113975398B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202111320300.4A CN113975398B (en) 2021-11-09 2021-11-09 Drug delivery carrier composition for treating liver fibrosis and preparation method thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202111320300.4A CN113975398B (en) 2021-11-09 2021-11-09 Drug delivery carrier composition for treating liver fibrosis and preparation method thereof

Publications (2)

Publication Number Publication Date
CN113975398A CN113975398A (en) 2022-01-28
CN113975398B true CN113975398B (en) 2023-07-04

Family

ID=79747378

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202111320300.4A Active CN113975398B (en) 2021-11-09 2021-11-09 Drug delivery carrier composition for treating liver fibrosis and preparation method thereof

Country Status (1)

Country Link
CN (1) CN113975398B (en)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114533883A (en) * 2022-02-28 2022-05-27 中国药科大学 Preparation method and application of liver-site-targeted macromolecular nitric oxide donor nano-drug
CN115927346B (en) * 2022-03-19 2023-11-21 三峡大学 Nucleic acid aptamer APT-Tan of targeted activated hepatic stellate cells and application thereof

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107686842A (en) * 2016-08-03 2018-02-13 南京大学 A kind of target polynucleotide edit methods and its application
CN108273061A (en) * 2018-03-02 2018-07-13 中国药科大学 A kind of anti-fibrosis medicine nanometer formulation and preparation method thereof
CN111172164A (en) * 2020-03-09 2020-05-19 中国药科大学 Composition and method for any nucleic acid editing

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107686842A (en) * 2016-08-03 2018-02-13 南京大学 A kind of target polynucleotide edit methods and its application
CN108273061A (en) * 2018-03-02 2018-07-13 中国药科大学 A kind of anti-fibrosis medicine nanometer formulation and preparation method thereof
CN111172164A (en) * 2020-03-09 2020-05-19 中国药科大学 Composition and method for any nucleic acid editing

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
Reversal of hepatic fibrosis by the co-delivery of drug and ribonucleoprotein-based genome editor;Jiayu Gu等;《Biomaterials 》;第2023卷(第298期);1-12 *

Also Published As

Publication number Publication date
CN113975398A (en) 2022-01-28

Similar Documents

Publication Publication Date Title
Tan et al. Nucleic acid-based drug delivery strategies
Abbasi et al. Co-encapsulation of Cas9 mRNA and guide RNA in polyplex micelles enables genome editing in mouse brain
Mohammadinejad et al. Shedding light on gene therapy: Carbon dots for the minimally invasive image-guided delivery of plasmids and noncoding RNAs-A review
CN113975398B (en) Drug delivery carrier composition for treating liver fibrosis and preparation method thereof
Shi et al. Carrier-free hybrid DNA nanoparticles for light-induced self-delivery of functional nucleic acid enzymes
CN101822838B (en) Nano-medicament carrier material for target recognition of tumor cell as well as preparation and application thereof
US20230355766A1 (en) Dna nanovaccine, preparation method therefor and use thereof
EP2436399B1 (en) Polymeric nano-particles for siRNA delivery using charge interaction and covalent bonding
BR112014016562B1 (en) DOUBLE HELIX OLIGO-RNA STRUCTURE, NANOPARTICLE AND PREPARATION METHOD
Liang et al. Specific activation of cGAS-STING pathway by nanotherapeutics-mediated ferroptosis evoked endogenous signaling for boosting systemic tumor immunotherapy
CN108220293A (en) A kind of small RNA and medical composition and its use
Eldredge et al. Dendritic peptide bolaamphiphiles for siRNA delivery to primary adipocytes
Li et al. pH-responsive DNA nanomicelles for chemo-gene synergetic therapy of anaplastic large cell lymphoma
Altangerel et al. PEGylation of 6-amino-6-deoxy-curdlan for efficient in vivo siRNA delivery
CN111265669A (en) Carrier composition for nucleic acid transfer and application thereof in preparation of small interfering RNA (ribonucleic acid) medicines
CN111481679A (en) siRNA nanocapsule and preparation method and application thereof
Yang et al. Stimuli-responsive nucleic acid nanostructures for efficient drug delivery
Asakiya et al. Current progress of miRNA-derivative nucleotide drugs: modifications, delivery systems, applications
Chen et al. The Hydrophobicity of AIE Dye Facilitates DNA Condensation for Carrier‐Free Gene Therapy
Chen et al. Polyethylenimine modified graphene oxide for effective chemo-gene-photothermal triples therapy of triple-negative breast cancer and inhibits metastasis
Ji et al. Stimuli-responsive delivery strategies for controllable gene editing in tumor therapeutics
US11976092B2 (en) RNA nanostructures, methods of making, and uses thereof
Gu et al. Reversal of hepatic fibrosis by the co-delivery of drug and ribonucleoprotein-based genome editor
KR101755680B1 (en) Polysaccharidic nanogel for protein drug delivery and preparation method thereof
Reina et al. The importance of molecular structure and functionalization of oxo-graphene sheets for gene silencing

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant