CN113975376A

CN113975376A - Application method of nanoparticle-based targeted Piezo1 protein in acute lung injury

Info

Publication number: CN113975376A
Application number: CN202111293922.2A
Authority: CN
Inventors: 施勤; 凌春华; 刘欣欣; 何家辰
Original assignee: First Affiliated Hospital of Suzhou University
Current assignee: First Affiliated Hospital of Suzhou University
Priority date: 2021-11-03
Filing date: 2021-11-03
Publication date: 2022-01-28

Abstract

The invention discloses an application method of targeted Piezo1 protein in acute lung injury based on nanoparticles, which comprises the following steps: s1, preparing materials; s2, processing the material; s3, detecting gene expression by RT-PCR; s4, detecting protein expression by Western blotting; s5, detecting the levels of TNF-alpha and IL-1 beta inflammatory factors by ELISA; s6, determination of serum LDH level; s7, staining lung tissues and pathological scores of mice by HE; s8, detecting the expression of mouse lung tissue Piezo1 by an immunohistochemical method and immunofluorescence; s9, detecting total protein and total cell number in mouse BALF; s10, lung tissue wet/dry mass ratio; s11, detecting lung tissue cell apoptosis by Tunel staining; s12, preparing a GsMTx4 BSA/chitosan nanoparticle carrier (NC-GsMTx 4); s13, characterization and biological effects of NC-GsMTx 4; s14, and detecting the biocompatibility of NC-GsMTx 4; s15, intervention effect of nebulization inhalation NC-GsMTx4 on LPS-induced Acute Lung Injury (ALI) mice; s16, counting; the method has the advantages of clear target, accurate intervention, quick response and small side effect.

Description

Application method of nanoparticle-based targeted Piezo1 protein in acute lung injury

Technical Field

The invention belongs to the technical field of medical treatment, and particularly relates to an application method of a nanoparticle-based targeted Piezo1 protein in acute lung injury.

Background

Acute Lung Injury (ALI) and Acute Respiratory Distress Syndrome (ARDS) are critically ill respiratory diseases characterized pathologically by diffuse alveolar injury and clinically manifested by respiratory distress, which are the major causes of morbidity and mortality in ICU. Epidemiological investigations have shown that nearly 196000 ALI patients account for 360 million hospitalizations each year in the united states, resulting in 75000 deaths, with ARDS mortality still reaching as high as 40%. Therefore, the pathogenesis of the ALI/ARDS is deeply researched, and the search of a treatment means aiming at the pathological basic mechanism of the ALI/ARDS is a main clinical problem at present.

The pathogenesis of ALI is not clear at present, and it is considered that the pathogenesis of ALI is a continuous dynamic process, including recruitment and activation of inflammatory cells, release of inflammatory factors, secretion of proteases, induction of apoptosis, fibrinolysis and coagulation, among which a continuously amplified inflammatory response is the root cause of ALI. In the early stage of ALI, a large number of local neutrophils and macrophages infiltrate and release various cytokines such as IL-6, TNF-alpha and IL-1 beta, damaging lung epithelial cells and lung vascular endothelial cells, causing damage to the alveolar endothelium and epithelial barrier. The damaged pulmonary vascular endothelial-alveolar epithelial barrier leads to the increase of the permeability of lung tissues, and further leads to the seepage of a large amount of exudates rich in protein and inflammatory cells, thus leading to the increase of the pulmonary edema degree. The lung tissue compliance decreases and oxygenation dysfunction, even refractory hypoxemia, occurs under the above pathological changes. In addition to inflammatory cells and cytokines, NF-. kappa.B and MARK/ERK1/2 signaling pathways and activation states also play important roles in the pathogenesis of ALI. The major function of NF-. kappa.B is to promote gene transcription, including cytokines, growth factors, adhesion molecules, immunoreceptors, and acute phase proteins. The transcriptional levels of various inflammatory factors in ALI depend on the degree of NF-. kappa.B activation, including IL-1. beta. and TNF-. alpha. MAPK/ERK1/2 belongs to serine/threonine protein kinase, is normally expressed in cytoplasm, and activated ERK is phosphorylated, dimerized and translocated to nucleus as transcription factor to regulate gene expression. Research proves that ERK1/2 activation is involved in organ injury caused by sepsis, and an ERK1/2 inhibitor (PD 98059) can obviously reduce the lung injury degree of ALI mice.

When ALI occurs in an organism, the respiratory distress symptom occurs in the organism due to the oxygenation dysfunction, alveolar cells are subjected to abnormal mechanical expansion, the metabolism of the cells is regulated and controlled by the mechanosensitive ion channel protein on cell membranes in a feedback manner to intervene the condition progress of the ALI, and the biological effect of the mechanosensitive ion channel is expected to become a new target for intervening the ALI. Researchers find that the specific inhibitor GSK2193874 of the mechanical sensitive ion channel protein TRPV4 can effectively reduce the serum inflammatory factor (TNF-alpha and IL-1 beta) level in ALI mice induced by LPS, protect endothelial cell function and further improve the survival rate of the ALI mice.

The mechanical sensitivity ion channel Piezo1 is a cell membrane transmembrane protein newly discovered in 2010, is a mixture similar to a three-bladed propeller and comprises a central pore structure domain and three peripheral expansion wings, the expansion wings surround a central pore to form a plasma membrane ion channel complex to be embedded into a cell membrane, and a mechanical signal transmits a signal to a pore nucleus through the deformation of the expansion wings to stimulate the opening of the channel and the inflow of ions. Piezo1 can convert physical stimuli such as squeezing, touching, pulling, blood flow, etc. into chemical and electrical signals within milliseconds to regulate cellular metabolism.

Studies have demonstrated that Piezo1 regulates cellular inflammation and apoptotic responses through feedback mechanical stimulation. Researchers simulate an obstructive acute pancreatitis model by pumping buffer solution into a mouse pancreatic duct, find that pancreatic cells Piezo1 are obviously increased, and inject Piezo1 inhibitor (GsMTx 4) into the abdominal cavity to reduce the expression of Piezo1, reduce pancreatic cell apoptosis and reduce the concentration of serum amylase and Lactate Dehydrogenase (LDH). In addition, down-regulation of Piezo1 inhibits IL-1 β secretion by nucleus pulposus cells, and downstream mechanisms are related to NF-kB pathway. In bone metabolic diseases, Piezo1 is proved to regulate and control apoptosis protein Bcl-2 to influence chondrocyte apoptosis through ERK1/2 pathway, and inhibition of the expression of the protein can relieve trauma-induced cartilage damage. In ALI, alveolar tissue continued to shrink and expand abnormally, and whether Piezo1 was involved in ALI progression and how its potential role lacked a systematic study.

Current ALI treatment regimens include: the traditional Chinese medicine composition can control primary diseases, respiratory support treatment, body fluid management, drug treatment and the like, but no specific treatment means is available. The aerosol inhalation is a common treatment means of ALI, the medicine is subjected to ultrasonic vibration to form aerosol which can be uniformly distributed in an air flue and an alveolar region, the concentration of the medicine on a local focus is increased, the onset time is shortened, the dosage is reduced, the influence on the blood coagulation function of other visceral organs can be effectively reduced, and the medicine safety is high. The ALI treatment by atomizing and inhaling glucocorticoid or heparin and other medicaments is applied clinically. In recent years, with the rapid development of materials science, the intersection of medicine and materials is more and more, and the nano material is constructed to carry the medicine to play the targeted therapeutic effect and has been applied in the field of biological medicine. The nano biomedical Carriers (NC) are used as a novel drug delivery and sustained and controlled release system and have good biocompatibility, biodegradability, mucosa adsorbability and targeting property, so that the nano biomedical Carriers can effectively pass through tissue gaps and biological barriers in organisms to reach lesion sites, and carry out targeted delivery and controlled release on the loaded drugs, thereby increasing the bioavailability of the drugs, avoiding the premature loss or enzymolysis of the drugs in the traditional single oral administration or injection administration process, and weakening the toxic and side effects of the drugs on tissues and organs. Therefore, the NC carrying system is an ideal carrier for anti-tumor, antibacterial and active biomacromolecule drugs and is considered as a drug delivery and sustained-release carrier with great potential. Researchers find that NC wrapped drugs such as curcumin, resveratrol, simvastatin, dexamethasone and the like overcome the defects of poor water solubility and low stability of the traditional drugs, and can effectively relieve ALI progress. There is a lot of evidence that NC has played a good role in the treatment of ALI as a good drug delivery system.

Based on the above background, we constructed an ALI model and investigated the potential role and related mechanisms of Piezo1 in ALI. Meanwhile, a drug loading system based on BSA/chitosan nanoparticle coated GsMTx4 (NC-GsMTx 4) is constructed, and the treatment effect of NC-GsMTx4 on ALI mice is evaluated in an aerosol inhalation mode. We found that Piezo1 is expressed in ALI in an elevated way, and the generation and development of ALI are regulated through ERK1/2 and NF-kB channels. The NC-GsMTx4 has uniform size and good biocompatibility, and the atomized inhalation of the NC-GsMTx4 not only has an inhibiting effect on the inflammation of the early lung tissue of ALI, but also can relieve the degree of the later pulmonary fibrosis (Scheme 1), and is expected to become a new medicine for treating ALI.

Disclosure of Invention

The invention aims to provide an application method of a nanoparticle-based targeted Piezo1 protein in acute lung injury, so as to solve the problems in the background technology.

In order to achieve the purpose, the invention adopts the following technical scheme:

the application method of the nanoparticle-based targeted Piezo1 protein in acute lung injury comprises the following steps:

s1, preparing materials;

s2, processing the material:

2.1.1LPS treatment of A549 cells;

human type II alveolar epithelial line a549 cells were set to: 1. PBS group, LPS (1, 2.5, 5, 10, 20) μ g/mL group, treating A549 cells for 24 h; 2. PBS group and LPS (2.5 μ g/mL) group, treating for 12h, 24h and 36h respectively, and collecting cells for later use;

2.1.2 intervention effect of GsMTx4 on LPS-induced A549 cell damage;

a549 cells were set to: 1. PBS group, LPS (2.5. mu.g/mL) group, LPS + GsMTx4 (pretreated with Pizol1 inhibitor GsMTx 42. mu.g/mL for 1h and co-cultured with LPS 2.5. mu.g/mL for 24 h), GsMTx4 (2. mu.g/mL) group; 2. PBS group, LPS (2.5. mu.g/mL) + PD98059 (10. mu. mol/mL) group, and after 24 hours, cell supernatant and cells were collected for subsequent experiments;

2.2, experimental animals and treatment;

ethical claims of animals:

C57/BL mice 8-10 weeks old and weighing 20-22g were raised under laboratory conditions: keeping the temperature at 20-24 ℃, freely drinking water, feeding standard feed, and alternately performing illumination for 12 hours and darkness for 12 hours in the illumination period; after the mice adapt to the environment, carrying out an experiment for about 7 days; animal experiments are strictly carried out according to experimental animal management regulations, and experimental operations meet the requirements of animal ethics of Suzhou university;

2.2.1 LPS-induced mouse ALI model;

C57/BL mice were set as: 1. NS group, LPS group; an ALI model is induced by injecting Lipopolysaccharide (LPS) into an abdominal cavity, the concentration of the LPS is 5mg/kg, an equal volume of Normal Saline (NS) is injected into an NS group, and a lung tissue and a serum sample are left after 24 hours;

2.2.2 Effect of intraperitoneal injection of GsMTx4 on intervention of ALI mice induced by LPS;

C57/BL mice were set as: NS group, LPS + GsMTx4 group and GsMTx4 group, LPS induction ALI model is injected in abdominal cavity, NS group is injected with NS with equal volume, LPS + GsMTx4 group is GsMTx4270 mug/kg, LPS is injected in abdominal cavity after 1h of intraperitoneal injection pretreatment, GsMTx4 group is injected with GsMTx4270 mug/kg, lung tissue and serum sample are left after 24h, wherein the concentration of LPS is 5 mg/kg;

2.2.3, collecting a specimen;

anaesthetizing 4% chloral hydrate, picking eyeball and taking blood, standing at room temperature for 90min, centrifuging at 1500 Xg for 15min, preparing serum, taking left lung filter paper to suck dry surface blood, and using the left lung filter paper to measure the wet/dry ratio of lung tissue; fixing the right upper lung in 4% paraformaldehyde, and performing HE staining; instantly freezing the middle and lower lobes of the right lung with liquid nitrogen, and storing in a refrigerator at-80 deg.C to extract protein and mRNA;

s3, detecting gene expression by RT-PCR;

after C57/BL mice are injected with LPS or NS24h in the abdominal cavity, the concentration of the LPS is 5mg/kg, 100mg of right lung tissue is taken, Trizol reagent is used for extracting various groups of total RNA, then cDNA is synthesized by using a reverse transcription kit, real-time quantitative PCR reaction is carried out according to the method provided by the kit to detect the mRNA level of each group, and GADPH is used as an internal reference; setting circulation conditions: pre-denaturation at 95 deg.C for 2min, reaction at 95 deg.C for 5s and 60 deg.C for 40 cycles, relative gene expression level using GADPH as reference gene, and 2^−ΔΔCTMeasuring the method;

s4, detecting protein expression by Western blotting;

after the A549 cells or mice are treated for 24 hours, the RIPA reagent extracts total protein of each group of samples from the cells or the lung tissues of the mice, the BCA kit quantifies, SDS-PAGE electrophoresis is carried out according to the quantitative result and the sample loading amount of 20 mug/hole, the concentration of separation gel is 100mL/L, the proteins are transferred to a nitrocellulose membrane by adopting a semi-dry transfer membrane method, the temperature of a closed liquid is closed, and related primary antibody is added after 2 hours; incubating in a refrigerator at 4 ℃ overnight, cleaning for 3 times by using TBST buffer solution on day 2, adding corresponding secondary antibody, incubating for 2h at room temperature, exposing and developing by using ECL color development solution, analyzing relative expression of protein by using a gel imager, and measuring the gray value of a protein band by using ImageJ image processing software according to the experimental result;

s5, detecting the levels of TNF-alpha and IL-1 beta inflammatory factors by ELISA;

after the A549 cells or mice are treated for 24 hours, the concentrations of cell supernatant or serum TNF-alpha and IL-1 beta inflammatory factors are detected by an ELISA method, and the detection method is carried out according to an ELISA kit;

s6, determination of serum LDH level;

after the mice are treated for 24 hours, collecting serum, and measuring the LDH level of the mouse serum by a full-automatic biochemical analyzer, wherein all operations are carried out according to the operation instructions;

s7, staining lung tissues and pathological scores of mice by HE;

after the mice are treated for 24 hours, fixing lung tissue samples by 4% paraformaldehyde for 24 hours, dehydrating by adopting ethanol, embedding by using paraffin, and then slicing, wherein the thickness of the slices is 5 mu m; sections were HE stained and lung injury scored;

s8, detecting the expression of mouse lung tissue Piezo1 by an immunohistochemical method and immunofluorescence;

after a mouse is treated for 24 hours, a lung tissue sample is fixed by 10% neutral formalin solution, dehydrated, paraffin-embedded and sliced in a thickness of 3-5 mu m, antigen is repaired, antibody is incubated, DAB color development, hematoxylin counterstaining, dehydrated, transparent and mounted, the staining intensity is observed by a microscope, and semi-quantitative analysis is carried out; making an immunofluorescence reference immunofluorescence kit instruction, and observing and shooting under a laser confocal microscope;

s9, detecting total protein and total cell number in mouse BALF: performing alveolar lavage on tracheal intubation to obtain alveolar lavage fluid, centrifuging the recovered alveolar lavage fluid, sucking supernatant, and detecting the total protein level by using a BCA method; after removing the supernatant of BALF, the cell mass is dispersed and then resuspended by PBS, and the total cell number is counted;

s10, lung tissue wet/dry mass ratio;

detecting and taking the left lung, sucking the surface moisture of the lung tissue by using filter paper, weighing the wet mass (W), placing the lung tissue in an oven at 70 ℃ for 48h until the weight is constant, measuring the dry mass (D), and calculating the wet/dry mass ratio (W/D) of the lung tissue;

s11, detecting lung tissue cell apoptosis by Tunel staining;

after the A549 cells or mice are treated for 24 hours, staining and sealing the slices according to the method provided by the Tunel apoptosis kit, and observing the apoptosis condition by using an optical microscope;

s12, preparing NC-GsMTx4 BSA/chitosan nanoparticles;

preparing chitosan nanoparticles by adopting a desolventizing technology: 50mg of Bovine Serum Albumin (BSA) was dissolved in 5mL of ddH₂In O, uniformly mixing the solution by a magnetic stirrer; pumping 20mL of absolute ethyl alcohol by a micro pump at the speed of 2mL/min, and continuously stirring overnight; pumping 20mL of chitosan solution (prepared by 1mg/mL of 1% acetic acid solution) at the speed of 2mL/min by a micro pump, pumping 5mL of absolute ethyl alcohol at the speed of 0.5mL/min, and uniformly stirring for 10h to obtain a chitosan-stabilized BSA nano particle carrier (NC); centrifuging at 12000r/min for 20min by a high-speed centrifuge, collecting, and cleaning the collected nanoparticles with 50% ethanol solution for 2-3 times;

adding 50ul of 1 mu g/mu l of GsMTx4 solution into 5mL of 10mg/mL BSA solution, performing the rest steps according to the steps to obtain a GsMTx 4-coated BSA/chitosan nanoparticle carrier (NC-GsMTx 4), and storing at 4 ℃ for use;

s13, characterization and biological effects of NC-GsMTx 4;

13.1 Transmission Electron microscopy, TEM, and scanning Electron microscopy, SEM;

fully and uniformly mixing NC-GsMTx4 nano particles by absolute ethyl alcohol, dropwise adding the mixed solution onto a climbing sheet, drying the climbing sheet in a 37 ℃ oven, coating a film by an ion sputtering instrument, and observing the treated sample in a Hitachi SU-8010 scanning electron microscope; placing NC-GsMTx4 nano particles into sterile deionized water, uniformly mixing for 5 minutes, and allowing the nano particles to freely move to form a suspension; dropwise adding the suspension into 1-2% phosphotungstic acid (PTA, pH6.5-7.0) of copper mesh, dyeing for 5-10s, and observing in H-7650 type transmission electron microscope; the software of ImageJ reads and analyzes the data and calculates the diameter distribution;

13.2 biological effects in vitro;

respectively and fully mixing 30mLF-12 culture medium with 100mg NC-GsMTx4 and NC nano particles uniformly, standing for 24h at 4 ℃, centrifuging for 20min at 12000r/min, taking supernatant, filtering for sterilization, adding 10% FBS and 1% double antibody according to the proportion, preparing a solution into an F-12 complete culture medium containing NC or NC-GsMTx4 release components, and storing for use at 4 ℃;

a549 cells were set to either: 1. NC group, NC-GsMTx4 group, LPS (2.5. mu.g/mL) + NC-GsMTx4 group; after co-culturing for 24h, fixing each group of cells by using paraformaldehyde fixing solution to perform Tunel staining and quantitative analysis; 2. after the NC group, the GsMTx4 group, the LPS (20 mu g/mL) + GsMTx4 group, the LPS (20 mu g/mL) + NC group and the LPS (20 mu g/mL) + NC-GsMTx4 group are cultured for 24 hours, CCK-8 detects the cell proliferation activity, and the operation method refers to the CCK-8 kit step;

s14, and detecting the biocompatibility of NC-GsMTx 4;

C57/BL mice were set as: NS group, NC-GsMTx4 group; weighing 100mgNC and NC-GsMTx4 nanoparticles, diluting with 20mL of physiological saline, atomizing and inhaling 1mLNS, NC and NC-GsMTx4 for each group of mice, normally feeding, and collecting lung, heart, liver and kidney tissues for HE staining after 24 h;

s15, intervention effect of nebulization inhalation NC-GsMTx4 on LPS-induced Acute Lung Injury (ALI) mice;

C57/BL mice were set as: 1. NC group, LPS + NC group and LPS + NC-GsMTx4 group, injecting LPS (5 mg/kg) into the abdominal cavity for molding, and injecting equal volume of normal saline into NC group; weighing 100mgNC and NC-GsMTx4 nanoparticles, diluting with 20mL of physiological saline, immediately atomizing and inhaling 1mLNC, NS, NC and NC-GsMTx4 mixed solution after molding 4 groups of mice, and collecting lung tissue, alveolar lavage fluid and serum after 24 h; 2. the method comprises the following steps of carrying out continuous 3d intraperitoneal injection on an NC group, an LPS + NC group and an LPS + NC-GsMTx4 group at the dose of LPS5mg/kg to induce a pulmonary fibrosis model after lung injury, and injecting an equal volume of physiological saline into a control group; weighing 100mgNC and NC-GsMTx4 nanoparticles, diluting with 20mL of physiological saline respectively, atomizing and inhaling mixed liquid of NC, NS, NC and NC-GsMTx4 respectively at the 1 st day of an experiment, and collecting lung tissues and serum at the 7 th day of the experiment;

s16, counting;

the data analysis adopts SPSS statistical software, the data is expressed by Mean + -standard deviation (Mean + -SD), the comparison of Mean between groups adopts one-factor variance analysis, and the comparison of two-two between groups adopts t test, so as toP<A difference of 0.05 is statistically significant.

Preferably, in S10, when the dry mass (D) is measured after the sample is placed in an oven at 70 ℃ for 48h to a constant weight, the dry mass (D) is measured 2 times, and the difference between the measured values of 2 times is less than 0.05 mg.

The invention has the technical effects and advantages that: aiming at the problems of complex pathogenesis and unclear intervention target of Acute Lung Injury (ALI) and the like of the application method of the nanoparticle-based targeted Piezo1 protein in the acute lung injury, 1) the method discovers that a mechanical sensitivity ion channel Piezo1 participates in ALI formation for the first time; 2) on the basis, the method uses the inhibitor of the nanoparticle-loaded Piezo1 to make an aerosol inhalation delivery system for the first time to intervene in the target of Piezo1, so as to achieve the purposes of treating ALI and preventing pulmonary fibrosis. The system has the advantages that: has definite target spot, accurate intervention, quick response and small side effect.

Drawings

FIG. 1 is a schematic representation of NC-GsMTx4 intervention in ALI by targeting Piezo 1;

FIG. 2 is a graph showing that LPS induces the increase of the expression of Piezo1 in mouse lung tissue;

FIG. 3 is a schematic diagram showing that LPS induces the increase of the expression of Piezo1 protein in A549 cell line;

FIG. 4 is a schematic representation of LPS induction of apoptosis of A549 cells by Piezo 1;

FIG. 5 is a schematic diagram of Piezo1 modulating LPS-mediated ERK1/2 and NF-. kappa.B pathways;

FIG. 6 is a schematic diagram of the construction and characterization of NC-GsMTx 4;

FIG. 7 is a schematic representation of the early anti-inflammatory effect of nebulized inhalation NC-GsMTx4 on ALI mice;

FIG. 8 is a schematic illustration of the therapeutic effect of nebulized inhalation NC-GsMTx4 on ALI combined lung fibers;

FIG. 9 is a schematic of the intraperitoneal injection of GsMTx4 to alleviate LPS-induced ALI;

FIG. 10 is a graph showing that intraperitoneal injection of GsMTx4 inhibits the level of inflammation and apoptosis in ALI mice;

fig. 11 is a schematic illustration of the biocompatibility testing of NC-gs mtx 4.

Detailed Description

The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. The specific embodiments described herein are merely illustrative of the invention and do not delimit the invention. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

s1, preparing materials;

s2, processing the material:

2.1.1LPS treatment of A549 cells;

2.1.2 intervention effect of GsMTx4 on LPS-induced A549 cell damage;

2.2, experimental animals and treatment;

ethical claims of animals:

2.2.1 LPS-induced mouse ALI model;

2.2.3, collecting a specimen;

s3, detecting gene expression by RT-PCR;

after C57/BL mice are injected with LPS or NS24h in the abdominal cavity, the concentration of the LPS is 5mg/kg, 100mg of right lung tissue is taken, Trizol reagent is used for extracting various groups of total RNA, then cDNA is synthesized by using a reverse transcription kit, real-time quantitative PCR reaction is carried out according to the method provided by the kit to detect the mRNA level of each group, and GADPH is used as an internal reference; setting circulation conditions: pre-denaturation at 95 deg.C for 2min, reaction at 95 deg.C for 5s and 60 deg.C for 40 cycles, relative gene expression level using GADPH as reference gene, and 2^−ΔΔCTMeasuring the method; the primer sequence is synthesized by Suzhou Jinwei Zhi bioengineering, Inc., and the base sequence is shown in the following table 1;

TABLE 1 primer sequences

m-GAPDHF-GGTTGTCTCCTGCGACTTCA

R-GGTCCAGGGTTTCTTACTCC

m-Piezo1F：CATTGATGTCACCGTCACCCTC

R：AATGAACTGCATGGCTAGTGGATAG

S4, detecting protein expression by Western blotting;

s6, determination of serum LDH level;

s7, staining lung tissues and pathological scores of mice by HE;

s10, lung tissue wet/dry mass ratio;

s11, detecting lung tissue cell apoptosis by Tunel staining;

s12, preparing NC-GsMTx4 BSA/chitosan nanoparticles;

preparing BSA/chitosan nanoparticles by adopting a desolventizing technology: 50mg of Bovine Serum Albumin (BSA) was dissolved in 5mL of ddH₂In O, uniformly mixing the solution by a magnetic stirrer; pumping 20mL of absolute ethyl alcohol by a micro pump at the speed of 2mL/min, and continuously stirring overnight; pumping 20mL of chitosan solution (1 mg/mL, prepared by 1% acetic acid solution) at a rate of 2mL/min by a micro pump, pumping 5mL of absolute ethyl alcohol at a rate of 0.5mL/min, and uniformly stirring for 10h to obtain the BSA nano-material with stable chitosanParticulate carriers (NC); centrifuging at 12000r/min for 20min by a high-speed centrifuge, collecting, and cleaning the collected nanoparticles with 50% ethanol solution for 2-3 times;

s13, characterization and biological effects of NC-GsMTx 4;

13.2 biological effects in vitro;

s14, and detecting the biocompatibility of NC-GsMTx 4;

s16, counting;

the data analysis adopts SPSS statistical software, the data is expressed by Mean + -standard deviation (Mean + -SD), the comparison of Mean between groups adopts one-factor variance analysis, and the comparison of two-two between groups adopts t test, so as toP<0.05 is statistically significant;

2 analysis and results:

please refer to fig. 1: schematic representation of NC-GsMTx4 intervention in ALI by targeting Piezo 1;

NC-GsMTx 4: GsMTx4 is carried on BSA/chitosan nanoparticles; LPS: a lipopolysaccharide; GsMTx 4: a Piezo1 blocker; PD 98059: ERK1/2 blockers; ERK 1/2: extracellular signal-regulated

kinases

1 and 2; NF-. kappa.B: homo/heterodimers are formed by p65 and p50, forming a trimeric complex in the cytoplasm due to binding to the arrestin ikb; TNF- α: tumor necrosis factor-alpha; IL-1. beta.: interleukin-1 beta; bcl-2: b-lymphocytoma-2 gene; bax: the pro-apoptotic protein can form heterodimer with Bcl-2, and has a repression effect on Bcl-2.

2.1LPS induces the mouse lung tissue Piezo1 expression to be increased;

after 24H of LPS (5 mg/kg) intraperitoneal injection treatment of C57/BL mice, significant inflammatory cell infiltration and tissue structure destruction can be seen by lung tissue H & E staining, and the lung injury score is significantly higher than that of NS group (see area A in figure 2) and area B in figure 2. The lung wet/dry ratio is one of indexes for evaluating the degree of pulmonary vascular permeability, and the LPS group is higher than the NS group, so that the increase of the degree of lung injury and pulmonary edema of a mouse after the LPS (5 mg/kg) is injected in an abdominal cavity is prompted, the pathological physiological process of ALI is met, and the success of LPS induction of the ALI model is prompted.

The expression level of the lung tissue Piezo1mRNA is detected by RT-PCR, and the result shows that the expression level of the LPS group is 5.57 times that of the NS group, which indicates that the LPS induces the mouse lung tissue Piezo1 transcription level to be increased. The NS group is found to be expressed based on Piezo1 by immunohistochemical staining, positive staining is mainly concentrated on alveolar epithelium and bronchial epithelium, positive staining area and staining intensity of the LPS group Piezo1 are obviously increased, particularly, the increase of the Piezo1 on the alveolar epithelium is obvious, and the immunohistochemical semi-quantitative analysis LPS group is higher than the NS group by referring to a B area in a figure 2. Since ATII is a progenitor cell of the alveolar epithelial cell and alveolar epithelial stability is maintained through self-proliferation and differentiation, wherein surfactant protein C (SP-C) is a marker protein of ATII, the experiment shows that Piezo1 is mainly expressed on the ATII cell through the observation of Piezo1 and SPC immunofluorescence co-staining mode, while the fluorescence co-staining degree of Piezo1 and SPC in the LPS group is obviously enhanced compared with that in the NS group, see a C area in FIG. 2, which indicates that the LPS induces the expression of mouse ATII cell Piezo 1.

Please refer to fig. 2 and fig. 9: the expression of mouse lung tissue Piezo1 is induced to be increased by LPS;

LPS (5 mg/kg) or physiological saline (NS) was intraperitoneally injected into C57/BL mice, and lung tissue was collected 24 hours later. In the figure: A) lung tissue HE staining; B) immunohistochemistry for Piezo1 (brown for positive); C) immunofluorescence of Piezo1 (ATII specific marker (SP-C) labeled green, red stained Piezo1 positive cells); D) histopathological scoring of lung tissue; E) lung tissue wet/dry ratio; F) lung tissue Piezo1mRNA expression level;G) immunohistochemical semi-quantitative score of lung tissue Piezo 1. (***P<0.001，n=5）

2.2LPS induces an inflammatory response of A549 cells by Piezo 1;

to examine the effect of LPS on the Piezol expression of A549 cells, we first treated A549 cells with different concentrations of LPS (1.0, 2.5, 5, 10, 20. mu.g/mL) for 24h, and the results suggest that LPS (1. mu.g/mL) does not significantly induce Piezo1 expression, that LPS induction increases significantly when the concentration reaches 2.5. mu.g/mL, and that the expression of Piezo1 in the LPS (2.5. mu.g/mL) group is 3.4 times that in the PBS group. LPS (5. mu.g/mL) and LPS (10. mu.g/mL) induced less than in the LPS (2.5. mu.g/mL) group, but still higher than in the PBS group, whereas LPS (20. mu.g/mL) did not significantly induce Piezo1 expression, see region A in FIG. 2. Therefore in the subsequent experiments we chose 2.5. mu.g/mL LPS to intervene in A549. We next investigated the effect of LPS on the expression of Piezo1 at different times. Western blotting results showed that Piezo1 began to rise 12h after LPS stimulation, with the highest expression level at 24h and the expression began to drop at 36h, but still higher than in the PBS group, see region B in FIG. 2. The above results indicate that LPS stimulates the expression of Piezo1 in A549 cells in a certain concentration and time dependence.

To investigate whether LPS upregulation of piozo 1 was involved in LPS-mediated inflammatory responses, we examined the role of piozo 1 in LPS-mediated a549 inflammatory responses with a piozo 1 inhibitor (GsMTx 4). A549 cell strain is pretreated with GsMTx4 for 1h, then incubated with LPS (2.5 mu g/mL) for 24h, the levels of TNF-alpha and IL-1 beta of cell supernatant are detected by an ELISA method, and the expression of the cell Piezo1 is detected by Western blotting. ELISA results found that compared with PBS group (15.09 +/-1.39 pg/mL) and GsMTx4 group (18.82 +/-4.90 pg/mL), the TNF-alpha release level of LPS group is obviously increased (708.71 +/-22.39 pg/mL), while the TNF-alpha expression level of GsMTx4 pretreatment (419.60 +/-22.59 pg/mL) is significantly reduced and the TNF-alpha release level is reduced by 41%. See region A in FIG. 3, while IL-1 β levels (78.15. + -. 1.50 pg/mL) were also significantly higher in LPS group than in PBS group (0.75. + -. 0.15 pg/mL), GsMTx4 group (0.39. + -. 0.08 pg/mL), and GsMTx4 pretreated IL-1 β release levels (47.90. + -. 1.51 pg/mL) were significantly lower in LPS group by 38%, see region A in FIG. 3;

western blotting results show that the expression of Piezo1 in the LPS + GsMTx4 group is reduced by 40% compared with that in the LPS group, which indicates that GsMTx4 pretreatment can inhibit the induction effect of LPS on Piezo1 and can down-regulate the expression of Piezo1, see a B region in a figure 3, and the down-regulation ratio of Piezo1 is close to that of TNF-alpha and IL-1 beta. The results show that Piezo1 participates in LPS-mediated inflammatory reaction, and GsMTx4 can relieve LPS-mediated Piezo1 and reduce inflammatory reaction.

Please refer to fig. 3: a schematic diagram of the induction of an a549 cell inflammatory response by LPS via Piezo 1;

a549 cells were pretreated with GsMTx4 for 1h and incubated with LPS (2.5. mu.g/mL) for 24h before cell and cell supernatant were collected. A) Levels of inflammatory factors (TNF- α and IL-1 β) in cell supernatants; B) cells express Piezo1 protein. (***p<0.001, experiment repetition 3 times, results are representative experiments)

2.3LPS Induction of apoptosis of A549 cells by Piezo1

Previous studies prove that Piezo1 participates in apoptosis by regulating apoptosis protein family Bcl-2, and then experiments discuss the effect of Piezo1 in LPS induction of A549 cell apoptosis response. Tunel staining shows that a plurality of positive cells can be seen in the LPS group, which indicates that a great amount of A549 cells are induced to be apoptotic after the LPS (2.5 mu g/mL) is treated for 24 hours; the GsMTx4 pretreatment of apoptosis positive cells decreased by about 25% compared with LPS group, indicating that the down-regulation of Piezo1 inhibited LPS-mediated apoptosis reaction, see region A in FIG. 4.

Subsequently, Western blotting detection of apoptosis protein Bcl-2/Bax further understood the mechanism of Piezo1 mediated A549 cell apoptosis. The results show that compared with the PBS group and the GsMTx4 group, the LPS significantly stimulates the expression of the pro-apoptotic protein Bax and inhibits the expression of the anti-apoptotic protein Bcl-2, while the GsMTx4 pretreatment can relieve the stimulation effect of the LPS, and as shown in the B region in figure 4, Bax is reduced by 57% compared with the LPS group, Bcl-2 is increased by 73% compared with the LPS group, and further prove that Piezo1 promotes Bcl-2/Bax to mediate A549 cell apoptosis.

Please refer to fig. 4: LPS induction of a549 cell apoptosis by Piezo 1;

a549 cells are pretreated with GsMTx4 for 1h and then incubated with LPS (2.5 mu g/mL) for 24h, and the cells are collected. A) Tunel staining image and quantitative analysis, apoptotic cells were stained with green, nuclei were stained with DAPI: (Blue) dyeing; B) cell Bcl-2/Bax expression. (***p<0.001, repeat the experiment 3 times)

2.4Piezo1 participates in ALI through ERK1/2 and NF- κ B pathway;

we further investigated the molecular mechanism of Piezo1 participating in ALI by detecting the influence of Piezo1 on the involvement of ERK1/2 and NF- κ B pathways by Western blotting. The results show that the NF-kappa Bp-p65 and p-ERK1/2 levels in LPS group are obviously higher than those in PBS group and GsMTx4 group, which indicates that LPS promotes the activation of the two channels, while the NF-kappa Bp 65 and p-ERK1/2 levels in LPS + GsMTx4 group are lower than those in LPS group, which indicates that intervention Piezo1 inhibits the activation of ERK1/2 and NF-kappa B channels, and indicates that Piezo1 is a key protein for mediating ERK1/2 and NF-kappa B channels in ALI. To further investigate the relevance of Piezo1 to the ERK1/2 signaling pathway, experiments were conducted with a reversion experiment with an ERK1/2 phosphorylation inhibitor (PD 98059). The results show that PD98059 significantly inhibited LPS-induced ERK1/2 phosphorylation, but had no significant effect on pizo 1 and NF- κ Bp-p65 expression, see region B in fig. 5, indicating that activation levels of the ERK1/2 pathway had no significant effect on pizo 1 expression, whereas pizo 1 may mediate enhanced activation of the ERK1/2 pathway, thus presuming that pizo 1 may be an upstream regulatory protein of the ERK1/2 pathway in ALI. Studies have demonstrated that Piezo1 modulates inflammatory responses through the NF-. kappa.B pathway, and in combination with the above results, Piezo1 promotes LPS-induced activation of the ERK1/2 and NF-. kappa.B pathways, which may be a molecular mechanism by which Piezo1 promotes ALI progression.

Please refer to fig. 5: piezo1 regulates LPS-mediated ERK1/2 and NF-kB pathway schematic;

a549 cells are pretreated with GsMTx4 for 1h and then incubated with LPS (2.5 mu g/mL) for 24h, and the cells are collected. A) Western blotting detection cells ERK1/2, P-ERK1/2, P65, P-P65, B, Western blotting detection cells ERK1/2, P-ERK1/2, P65, P-P65, and Piezo1 (A. aboutp<0.001, repeat the experiment 3 times)

2.5 construction and characterization of nanoparticle loading GsMTx4 (NC-GsMTx 4);

the above shows that Piezo1 is a key protein for promoting ALI progression, and the down-regulation of Piezo1 can inhibit inflammation and apoptosis reaction in ALI, thereby providing experimental basis for treating ALI by targeting Piezo 1. Next, we constructed a GsMTx4 (NC-GsMTx 4) drug loading system based on BSA/chitosan nanoparticles, observed the characterization of the drug loading system, and perfected the evaluation of the in vitro biological effect. First, the experiments were performed using the desolventizing technique to make chitosan NC-GsMTx4, see area A in FIG. 6. And then the NC-GsMTx4 is observed by SEM and TEM, and the result shows that NC-GsMTx4 is in a quasi-circular shape, has no obvious adhesion, is uniform in size and has the average particle size of 354.60 +/-74.29 nm, and the physicochemical property is favorable for the transmembrane transport of NC-GsMTx4 to be combined with the lesion.

To explore the biological effect of NC-GsMTx4 in vitro, NC and NC-GsMTx4 nanoparticles were mixed with F-12 medium and left stand for 24h to construct NC or NC-GsMTx4/F-12 medium, and two media containing NC or NC-GsMTx4/F-12 were tested for their effect on cell proliferation and apoptosis by CCK-8 and Tunel staining experiments. CCK-8 results show that LPS remarkably inhibits cell proliferation, indicating that the cell viability is reduced, and NC, NC-GsMTx4 and GsMTx4 can relieve the inhibition effect of the LPS and promote the cell viability to recover, wherein the NC-GsMTx4 relieving effect is most remarkable, which is shown in a H area in figure 6. Tunel staining finds that NC-GsMTx4/F-12 culture medium does not cause significant apoptosis of A549 cell line, which indicates that NC-GsMTx4 has no obvious cytotoxicity and is consistent with related literature reports. While the level of apoptosis of LPS + NC-GsMTx4 was significantly lower than that of the LPS + NC group, see region F, G in FIG. 6, suggesting that NC-GsMTx4 inhibits LPS-induced apoptosis in vitro. In conclusion, the NC-GsMTx4 constructed by the experiment has uniform size and no obvious cytotoxicity, and can relieve the influence of LPS on the proliferation and apoptosis of A549 cells in vitro;

please refer to fig. 6: construction and characterization schematic diagram of NC-GsMTx 4:

A) constructing NC-GsMTx4 by a desolventizing method; B) NC-GsMTx410000 times Scanning Electron Microscope (SEM) observation; C) NC-GsMTx450000 times Scanning Electron Microscope (SEM) observation; D) NC-GsMTx4 Transmission Electron Microscope (TEM) observation; E) NC-GsMTx4 particle size distribution; F) tunel stained images, apoptotic cells stained with green and nuclei stained with DAPI (blue); G) quantitative analysis of Tunel staining positive cells; H) and (4) detecting the CCK-8 of the cells. (***p<0.001, repeat the experiment 3 times)

2.6 Aerosol inhalation NC-GsMTx4 protects ALI mice by targeting Piezo1

Experiments prove that the lung injury and pulmonary edema degree of ALI mice induced by LPS can be reduced by carrying out intraperitoneal injection GsMTx4 (270 mu g/kg) on the mice for 1h, and referring to the attached figure 3, targeted intervention of Piezo1 is prompted to have a protective effect on ALI. Compared with intraperitoneal injection, aerosol inhalation belongs to local medicine, and the aerosol inhalation directly acts on respiratory tracts, can improve the utilization rate of the medicine and has small side effect. This section of the experiment evaluated the potential therapeutic effect of NC-gs mtx4 on ALI by nebulization. First, HE staining was used to detect pathological changes and investigate the protective effect of NC-GsMTx4 on LPS-induced ALI. The pathological observation of the lung tissues of the mice in the NC group is normal tissues without obvious abnormality, which indicates that the lung tissues have no obvious side effect by only inhaling NC. And lung tissues of mice in LPS and LPS + NC groups are typical lung injury lesions, diffuse alveolar cavity congestion and edema can be seen under a light microscope, alveoli collapse and atrophy can be seen, and a large amount of inflammatory cell infiltration can be seen, while the lung tissue injury degree of the mice in the LPS + NC-GsMTx4 group is obviously reduced, especially the inflammatory cell infiltration is obviously reduced, which prompts that atomized NC-GsMTx4 reduces the lung inflammatory reaction of the mice. LDH is a sensitivity index for clinically reacting the injury degree of an organism, and experiments show that the serum LDH levels of an LPS group and an LPS + NC group are obviously higher than those of the NC group, and the serum LDH of the ALI mouse is reduced compared with the LPS group and the LPS + NC group after the ALI mouse is atomized and inhaled into NC-GsMTx4, which shows that the atomized and inhaled NC-GsMTx4 can reduce the general injury induced by LPS. In addition, the lung tissue wet/dry ratio, the total cell number and the total protein concentration of LPS and LPS + NC groups are obviously increased compared with the NC group, and the indexes are obviously reduced after NC-GsMTx4 is atomized and inhaled, so that the lung edema degree of ALI mice can be reduced by the atomized and inhaled therapeutic drug. The immunohistochemical result indicates that the lung tissue Piezo1 protein expression of mice in the LPS and LPS + NC group is remarkably increased compared with that in the NC group, while the lung tissue Piezo1 protein expression of the LPS + NC-GsMTx4 group is reduced compared with that in the LPS and the LPS + NC group, and indicates that NC-GsMTx4 can be adsorbed and combined with alveolar tissue and can down-regulate the Piezo1 expression. The above suggests that nebulization inhalation of NC-gs mtx4 is effective in reducing the extent of ALI lung injury, and that downstream mechanisms are associated with targeted intervention of Piezo 1.

Please refer to fig. 7: schematic representation of early anti-inflammatory effect of nebulization inhalation NC-gs mtx4 on ALI mice;

mice were injected with LPS (5 mg/kg) intraperitoneally and then inhaled with NC and NC-GsMTx4 by atomization, and lung tissue and serum samples were retained after 24h intervention. A) Lung tissue HE staining; B) of Piezo1Immunohistochemistry (brown for positive); C) histopathological scoring of lung tissue; E) (iii) serum LDH levels; F) lung tissue wet/dry (W/D) ratio; G) balbca concentration; H) total number of BALF cellsp<0.05，***p<0.001，n=5）

2.7 nebulization inhalation of NC-GsMTx4 relieves ALI from merging with lung fibers;

pulmonary fibrosis is a common complication of ALI, and reducing the degree of pulmonary fibrosis is beneficial to improving the prognosis of ALI. Animal models find that ALI can generate pulmonary fibrosis reaction in early stage, wherein 3d-7d and 14-21 d are the most rapid time periods for the pulmonary fibrosis to progress. Studies indicate that repeated attacks of LPS can simulate the early pulmonary fibrosis of ARDS. We set the mice as NC group, LPS + NC-gs mx 4 group, i.e. C57/BL mice were intraperitoneally injected with LPS (5 mg/kg) for 3 consecutive days in the model group on day 1 of the start of the experiment, normal control groups were intraperitoneally injected with NS, and four groups of mice were given nebulization inhalation NC, NS, NC-gs mx 4, respectively, on day 1, and the experiment was started for 7d to observe lung tissue pathology and measure serum LDH levels to evaluate the effect of nebulization inhalation NC-gs mx 4 on post-ALI pulmonary fibrosis.

Firstly, HE staining finds that the lung tissue of a mouse in an NC group is a normal tissue, while the lung tissue of an LPS group and an LPS + NC group is in severe alveolar inflammation expression, inflammatory cells are obviously infiltrated, an alveolar structure is seriously damaged, bleeding and edema can be seen in alveolar spaces, part of tissue is replaced by fibrous connective tissue, collagen fibers can be seen in lung interstitium, and severe fibrosis expression is shown; compared with the LPS group and the LPS + NC group, the LPS + NC-GsMTx4 group has relatively reduced alveolar septal edema degree and inflammatory cell infiltration, reduced damaged lung epithelial cells, reduced collagen fiber exudation and reduced lung tissue structure destruction degree, and the A, D area in figure 8 is shown. Masson staining indicates that lung tissues of mice in an NC group can be slightly stained with blue collagen, lung intervals of an LPS group and an LPS + NC group are damaged and widened, fibrocyte proliferation can be seen, blue collagen is obviously increased, the blue collagen is mainly concentrated on the periphery of a large airway and blood vessels, and pulmonary fibrosis is shown. The collagen in the alveolar spaces and pulmonary interstitium of the LPS + NC + GsMTx4 group was reduced and the degree of pulmonary fibrosis was reduced, see region B, E in fig. 8. The lung tissue pathological observation indicates that the proliferation and activation of fibroblasts are inhibited after ALI mice are atomized and inhaled into NC + GsMTx4, the secretion of collagen is reduced, and the degree of pulmonary fibrosis is reduced. In addition, the LDH level in the LPS + NC-GsMTx4 group was also decreased compared to the LPS and LPS + NC groups, as shown in the D region of FIG. 8.

The immunohistochemical staining shows that the lung tissue Piezo1 expression of ALI mice is remarkably reduced after the mice are inhaled into NC-GsMTx4 compared with that of LPS group and LPS + NC group, and the C, F area in figure 8 shows that NC-GsMTx4 can play a slow-release effect after being adsorbed into the alveolar tissue to continuously inhibit the Piezo1 expression.

The results show that the atomized inhalation NC-GsMTx4 can continuously play a role in relieving lung injury and inflammatory reaction and has a relieving effect on the middle and later-stage pulmonary fibrosis of ALI/ARDS.

Please refer to fig. 8: schematic representation of therapeutic effect of nebulized inhalation NC-gs mx 4 on ALI associated pulmonary fibers;

C57/BL mice were injected intraperitoneally for 3 consecutive days (LPS 5 mg/kg) and nebulized to NS, NC or NC-GsMTx4, and lung tissue and serum specimens were retained at experiment 7 d.

A) Lung tissue HE staining; B) masson staining of lung tissue; C) immunohistochemistry for Piezo1 (brown for positive); D) histopathological scoring of lung tissue; E) a fibrosis score for lung tissue; F) immunohistochemical semi-quantitative score of Piezo 1; G) serum LDH levels. (*p<0.05，***p<0.001，n=5）

Discussion:

ALI is a respiratory failure disease characterized by acute diffuse alveolar injury, which is acute in onset and rapid in progression, and can induce ARDS and even MODS to threaten life if intervention is not timely performed. ALI/ARDS was found to be a central complication and major cause of death in patients with COVID-19 infection. Therefore, the pathogenesis of ALI is deeply explored, and a new treatment means is very necessary to be searched. Firstly, an experiment adopts an intraperitoneal LPS (5 mg/kg) injection mode to construct a mouse ALI model, and the result shows that the lung tissue Piezo1 expression of the ALI mouse is increased, mainly the ATII cell increase, which indicates that Piezo1 participates in the ALI pathological process induced by LPS. Researchers prove that the expression of macrophage Piezo1 can be enhanced by LPS through TLR4 signals, further the CaMKII-Mst1/2-Rac axis is activated, the ingestion and killing of pathogens by macrophages are promoted, and the Piezo1 is a key protein in TLR4 signal-mediated immune response of organisms, and probably is a molecular mechanism for the LPS to promote the expression of lung epithelial cells Piezo1 to be enhanced. The expression of A549 cells Piezo1 is induced by adopting different LPS conditions, and Western blotting results show that LPS (2.5 mu g/mL) remarkably stimulates Piezo1 to increase, but the protein expression of Piezo1 is reduced along with the increase of the stimulation concentration of the LPS, and the LPS concentration reaches (20 mu g/mL), so that the Piezo1 is not obviously induced, possibly because the biological activity of cells is inhibited to generate senescence or apoptosis along with the increase of the stimulation concentration of the LPS, and the stimulation of the LPS exceeds a certain action range. On the other hand, when the A549 cell strain is treated by LPS (2.5 mu g/mL) at different time points (12 h, 24h and 36 h), the expression of Piezo1 is increased after 12h treatment, the stimulation effect is most obvious at 24hLPS, and then the expression of Piezo1 is reduced, but the expression level is still higher than that of the PBS group, probably because the LPS tolerance phenomenon of the A549 cell strain appears after 24h treatment of LPS, and the sensitivity to LPS is reduced.

Researchers specifically knock out macrophages Piezo1 in the lung of a mouse, and infect the knock-out mice with pseudomonas aeruginosa, and compared with normal mice, the mice find that the infiltration of neutrophils in lung tissues is reduced, and the bacterial titer of the lung and the liver is obviously reduced, which indicates that the inhibition of the function of Piezo1 has the effect of promoting the inflammation to subside. The uncontrolled inflammatory response induces the initiation factor of ALI, wherein TNF-alpha and IL-1 beta are key factors for starting and amplifying inflammatory storm, and can activate immune cells to release inflammatory factors such as IL-6, IL-8 and the like and recruit PMN, multinucleated giant cells and lymphocytes to be recruited in lung tissues. Elevated levels of TNF-alpha and IL-1 beta in the serum and BALF of patients with ARDS are negatively correlated with prognosis. Inhibit the secretion of TNF-alpha and IL-1 beta, can reduce excessive systemic inflammatory reaction, and reduce the damage of inflammatory cells and inflammatory mediators to lung tissue structure cells. In vitro experiments show that GsMTx4 pretreatment can reduce the release level of TNF-alpha and IL-1 beta in LPS groups, and the inhibition of Piezo1 can reduce the inflammatory stimulation effect of LPS. In vivo experiments also prove that the pretreatment of intraperitoneal injection of GsMTx4 can reduce the serum TNF-alpha and IL-1 beta levels of ALI mice and relieve lung injury and pulmonary edema degree.

The release of inflammatory factors and mediators leading to death of a large number of lung structural cells, particularly ATII, is another important pathogenesis of ALI. ATII apoptosis is accompanied in three pathological changes of ALI/ARDS, namely, exudation stage, proliferation stage and fibrosis stage. Clinical observation shows that alveolar epithelial cells of patients with ARDS show the characteristics of apoptosis such as chromatin condensation, DNA fragmentation and the like, and the expression of Bcl-2 family proteins of the alveolar epithelial cells is increased. Excessive ATII apoptosis will directly result in a breakdown in the integrity of the alveolar epithelial barrier, promoting protein-rich edema in the alveoli, exacerbating the ALI condition, which is also responsible for ALI dyspnea and hypoxemia. The alveolar epithelial barrier is also a line of defense within the lung against the invasion of external pathogens, and barrier function disruption will exacerbate the risk of infectious invasion. Furthermore, increased levels of apoptosis in lung epithelial cells are an important factor in ALI associated pulmonary fibrosis. Thus, blocking ATII apoptosis in ALI at different levels may be one of the important means of mitigating ALI progression. In vitro Tunel staining finds that the LPS promotes the apoptosis of A549 cells, and GsMTx4 relieves the apoptosis stimulation effect of the LPS, which indicates that the inhibition of Piezo1 expression can reduce the lung epithelial apoptosis induced by the LPS.

The mechanism by which ATII apoptosis occurs in ALI is not yet understood. Bcl-2 plays an anti-apoptotic role by controlling the permeability of the mitochondrial outer membrane, Bcl-2 can promote the killing effect of cells to tolerate various cytotoxic factors, delay and reduce apoptosis, and can induce the cells to recover proliferation after the toxic factors are removed. The expression of ATII cells Bcl-2/Bax apoptosis protein family is increased in lung tissue biopsy of patients with ARDS death, and the Bcl-2/Bax protein is presumed to be involved in the apoptosis reaction in ALI. In addition, LPS can induce apoptosis in a549 and mouse lung epithelial cells, and its mechanism is also associated with down-regulation of the anti-apoptotic protein Bcl-2. Our Western blotting results showed that LPS inhibited anti-apoptotic Bcl-2 expression, stimulated pro-apoptotic protein Bax expression, while down-regulation of piozo 1 alleviated the above-described stimulatory effect of LPS, suggesting that piozo 1 mediates ATII apoptosis through the mitochondrial apoptosis pathway in ALI.

When ALI occurs in organisms, NF-kB and ERK1/2 pathways are activated and carry out target gene transcription, and the regulation and control of cell inflammation and apoptosis are important signaling centers in the ALI. The NF-kB pathway is a core signal pathway for regulating and controlling the systemic inflammatory reaction, has a key regulation and control effect on the expression of inflammatory factors, chemotactic factors, adhesion molecules and the like, and is often used as a biomarker for reacting the inflammatory level in scientific research. Researchers believe that the ERK1/2 pathway is an upstream activator of the NF-kappa B pathway and has a synergistic effect in ALI induced by LPS, and activation of ERK1/2 can promote phosphorylation of I kappa B and accelerate nuclear induction of inflammatory response of NF-kappa B, and is considered to be one of the reasons for inducing the NF-kappa B to enter the nucleus by LPS. The NF-kB and ERK1/2 pathways can be involved in lung epithelial cell apoptosis in ALI through the Bcl-2 protein family. It was found that low intensity pulsed ultrasound (LICUS) stimulated increased osteoblast ERK1/2 phosphorylation and Piezo1 expression, whereas the sh-RNA-Piezo1 or GsMTx4 cell groups did not show significant increase and cell proliferation capacity was affected. In addition, the knock-down of vascular endothelial cells Piezo1 can relieve the inflammatory response in atherosclerosis, and the downstream mechanism is related to the inhibition of NF-kB pathway. However, in ALI, the association of Piezo1 with the ERK1/2 and NF-. kappa.B signaling pathways has not been elucidated. In vitro experiments show that the down-regulation of Piezo1 weakens the stimulation effect of LPS on ERK1/2 and NF-kB signal pathways, and the suggestion that Piezo1 mediates the LPS-induced activation of ERK1/2 and NF-kB signal pathways and is possibly a key protein for regulating the two pathways. In contrast, a reversion experiment is carried out to find that PD98059 remarkably inhibits the LPS-induced ERK1/2 phosphorylation, but has no remarkable influence on the expression of Piezo1 and NF-kappa Bp-p5, so that Piezo1 is presumed to be an upstream regulatory protein of an ERK1/2 channel in ALI. In addition, in vivo experiments also prove that the level of lung inflammation and apoptosis of ALI mice is reduced by down-regulating Piezo1, and the regulation mechanism is related to the inhibition of ERK1/2 and NF-kB signal channel activation. The above shows that Piezo1 promotes activation of ERK1/2 and NF-kB signaling pathways in ALI, and may be a molecular mechanism of Piezo1 for promoting inflammatory and apoptotic responses in ALI. It is noted that PD98059 did not inhibit NF-. kappa.B activation in vitro, which is inconsistent with other literature results and may be the result of different LPS treatment conditions.

The above results indicate that GsMTx4 has a protective effect on ALI by targeting Piezo1, while GsMTx4 is a spider venom peptide which is easy to decompose, has short half-life, cannot continuously act on inflammatory injury sites to exert drug effect, and needs to improve the drug availability through a drug delivery system. The average particle size of NC-GsMTx4 constructed by experiments is 354.60 +/-74.29 nm, the size is uniform, the adhesion is not easy, a chitosan ligand on NC-GsMTx4 is easy to be combined with proteoglycan on the surface of a cell in a non-specific electrostatic manner, and the physicochemical property is favorable for improving the cell uptake and transmembrane transport capacity of NC-GsMTx 4. CCK-8 and Tunel staining find that NC-GsMTx4 can relieve the influence of LPS on the proliferation and apoptosis of A549 cells, and has no obvious cytotoxicity, which indicates that NC-GsMTx4 is a biological agent for effectively inhibiting the inflammatory action of LPS. In addition, no obvious abnormality is found in pathological observation of main organs such as lungs, hearts, livers, kidneys and the like of a body after the mice are atomized and inhaled into NC or NC-GsMTx424, and the NC-GsMTx4 is further proved to have good biocompatibility. After the ALI mice are given NC-GsMTx4 by aerosol inhalation, the lung injury degree and the serum LDH level are reduced, the lung tissue Piezo1 expression is reduced, and the fact that NC-GsMTx4 can be effectively attached to the lung injury part and plays an anti-inflammatory role through targeting Piezo1 is shown.

Of the lethal factors of ARDS, the refractory pulmonary fibrosis accounts for about 40% -70%. The degree of pulmonary fibrosis in patients with ARDS is a significant cause of poor prognosis of ALI/ARDS. Therefore, the composition can inhibit or delay the pulmonary fibrosis change of ALI/ARDS in time, prevent or delay the development of hypoxemia, and has important significance for improving the prognosis of ALI patients and reducing the fatality rate. Studies have demonstrated that inhibition of early inflammation and apoptotic responses in ALI can alleviate the levels of later-stage pulmonary fibrosis. In vitro and in vivo, it is proved that the down-regulation of Piezo1 can relieve inflammation and apoptosis reaction induced by LPS, but the inhibition of Piezo1 has no proved effect on the protection of the degree of pulmonary fibrosis in the later stage of ALI. We found that after ALI mice are subjected to aerosol inhalation of NC-GsMTx4, the lung tissue Piezo1 expression and the degree of pulmonary fibrosis are reduced, which indicates that NC-GsMTx4 continuously acts on the ALI mice to inhibit the later-stage pulmonary fibrosis formation of ALI, but the specific mechanism still needs to be clinically further verified.

The current experimental study has limitations. First, a549 cells are human lung adenocarcinoma cell lines and the stimulatory effect of LPS on a549 may differ from normal ATII. Secondly, functional detection means such as lung function and blood gas analysis are lacked in animal experiments to evaluate whether the GsMTx4 has an improvement effect on the hypoxemia in the ALI. Finally, GsMTx4 is a pharmacological inhibitor of Piezo1, and the non-targeting effect of chemical inhibitors cannot be excluded. Therefore, the lung epithelial cell conditioned knockout mouse model is utilized to further verify that the research result has important significance.

In summary, our studies demonstrated that Piezo1 is a key regulatory protein in LPS-induced ALI, and nebulization of NC-gs tx4 reduced the extent of ALI damage, including early reduction in inflammation and late fibrosis, and is expected to be a new approach to treating ALI.

Please refer to fig. 3: the graph shows that the expression of the Piezo1 protein of the A549 cell line is induced to be increased by LPS;

cells were collected after 24h treatment of A549 cells with LPS (1, 2.5, 5, 10, 20. mu.g/mL) and 12h, 24h, 36h treatment of A549 cells with LPS (2.5. mu.g), respectively.

A) Westernblotting test Piezo 1; B) westernblotting detection of Piezo1 (. + -)pLess than or equal to 0.001, repeat the experiment for 3 times)

Please refer to fig. 9: a schematic of intraperitoneal injection of GsMTx4 in relief of LPS-induced ALI;

C57/BL mice were pretreated by GsMTx4 (270. mu.g/kg) intraperitoneal injection for 1h, then LPS (5 mg/kg) intraperitoneal injection is given, and lung tissue and serum samples are left after 24 h.

A) Lung tissue HE staining; B) immunohistochemistry for Piezo1 (brown for positive); C) histopathological scoring of lung tissue; D) immunohistochemical semi-quantitative score of Piezo 1E) serum LDH level; F) lung tissue wet/dry ratio; G) BALF protein concentration; H) total number of BALF cells. (*p<0.05，***p<0.001，n=5）

Referring to figure 10, intraperitoneal injection of GsMTx4 inhibited the level of inflammation and apoptosis in ALI mice;

C57/BL mice were pretreated by GsMTx4 (270. mu.g/kg) intraperitoneal injection for 1h, then LPS (5 mg/kg) intraperitoneal injection is given, and lung tissue and serum samples are collected after 24 h.

A) Tunel staining images; B) quantitative analysis of Tunel staining image positive (apoptotic) cells; C) serum inflammatory factor (TNF-alpha and IL-1 beta) levels; D) cells ERK1/2, P-ERK1/2, P65, P-P65, Bcl-2/Baxp<0.001，n=5）。

Referring to fig. 11: a schematic diagram of the biocompatibility detection of NC-GsMTx 4;

biocompatibility verification of NC-GsMTx 4:

the lung, heart, liver and kidney tissues are collected after the mice are atomized and inhaled into NS, NC and NC-GsMTx424 h. HE staining of lung, heart, liver and kidney tissues of mice.

In conclusion, based on the application method of the nanoparticle targeted Piezo1 protein in acute lung injury, aiming at the problems of complex pathogenesis and unclear intervention target of Acute Lung Injury (ALI), 1) the method discovers that the mechanically sensitive ion channel Piezo1 participates in ALI formation for the first time; 2) on the basis, the method uses the inhibitor of the nanoparticle-loaded Piezo1 to make an aerosol inhalation delivery system for the first time to intervene in the target of Piezo1, so as to achieve the purposes of treating ALI and preventing pulmonary fibrosis. The system has the advantages that: has definite target spot, accurate intervention, quick response and small side effect.

Finally, it should be noted that: although the present invention has been described in detail with reference to the foregoing embodiments, it will be apparent to those skilled in the art that modifications may be made to the embodiments or portions thereof without departing from the spirit and scope of the invention.

Sequence listing

<110> Suzhou university affiliated first hospital

<120> application method of nanoparticle-based targeted Piezo1 protein in acute lung injury

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 26

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

<210> 2

<211> 39

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

<210> 3

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

<210> 4

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

Claims

1. The application method of the nanoparticle-based targeted Piezo1 protein in acute lung injury is characterized by comprising the following steps:

s1, preparing materials;

s2, processing the material:

2.1.1LPS treatment of A549 cells;

2.1.2 intervention effect of GsMTx4 on LPS-induced A549 cell damage;

2.2, experimental animals and treatment;

ethical claims of animals:

2.2.1 LPS-induced mouse ALI model;

2.2.3, collecting a specimen;

s3, detecting gene expression by RT-PCR;

s4, detecting protein expression by Western blotting;

s6, determination of serum LDH level;

s7, staining lung tissues and pathological scores of mice by HE;

s10, lung tissue wet/dry mass ratio;

s11, detecting lung tissue cell apoptosis by Tunel staining;

s12, preparing NC-GsMTx4 BSA/chitosan nanoparticles;

preparing BSA/chitosan nanoparticles by adopting a desolventizing technology: 50mg of Bovine Serum Albumin (BSA) was dissolved in 5mL of ddH₂In O, uniformly mixing the solution by a magnetic stirrer; pumping 20mL of absolute ethyl alcohol by a micro pump at the speed of 2mL/min, and continuously stirring overnight; pumping 20mL of chitosan solution (prepared by 1mg/mL of 1% acetic acid solution) at the speed of 2mL/min by a micro pump, pumping 5mL of absolute ethyl alcohol at the speed of 0.5mL/min, and uniformly stirring for 10h to obtain a chitosan-stabilized BSA nano particle carrier (NC); centrifuging at 12000r/min for 20min by a high-speed centrifuge, collecting, and cleaning the collected nanoparticles with 50% ethanol solution for 2-3 times;

s13, characterization and biological effects of NC-GsMTx 4;

13.2 biological effects in vitro;

s14, and detecting the biocompatibility of NC-GsMTx 4;

s16, counting;

2. The method for applying the nanoparticle-targeted Piezo 1-based protein to acute lung injury according to claim 1, wherein when the dry mass (D) is measured after the sample is placed in an oven at 70 ℃ for 48h to constant weight in S10, the dry mass (D) is measured 2 times, and the difference between the two measurements is less than 0.05 mg.