CN113957128A

CN113957128A - Nucleic acid integrity evaluation kit and evaluation method

Info

Publication number: CN113957128A
Application number: CN202111571482.2A
Authority: CN
Inventors: 辛秋红; 王洁; 贺文慧; 张亚飞; 林东旭
Original assignee: Meijie Transformation Medical Research Suzhou Co ltd
Current assignee: Meijie Transformation Medical Research Suzhou Co ltd
Priority date: 2021-12-21
Filing date: 2021-12-21
Publication date: 2022-01-21

Abstract

The invention discloses a nucleic acid integrity evaluation kit and an evaluation method. The kit comprises a primer mixed solution, a PCR enzyme, a PCR buffer solution, an internal reference and a calibrator, wherein the primer mixed solution comprises a primer pair for amplifying 4 housekeeping genes, the lengths of PCR products amplified by the primer pair are different, the length difference of 4 PCR products is not less than 90bp respectively, the length ranges are distributed between 50bp and 1000bp, the internal reference comprises nucleic acid fragments of the 4 housekeeping genes, the sequence of the nucleic acid fragment of the internal reference is increased by at least 2bp compared with the sequence of the nucleic acid fragment of the original housekeeping gene, the non-primer binding region of the primer pair amplified fragment is increased, and the calibrator comprises human standard genomic DNA. The nucleic acid integrity evaluation kit can quickly and accurately detect the integrity of nucleic acid.

Description

Nucleic acid integrity evaluation kit and evaluation method

Technical Field

The invention belongs to the technical field of biology, and relates to a nucleic acid integrity evaluation kit and an evaluation method.

Background

In molecular biological gene detection, the integrity of nucleic acid is one of the most important quality control indexes, such as whole genome sequencing, whole exon sequencing, PCR amplification and the like, which all require the integrity of nucleic acid, otherwise, the experiment has the risk of poor detection result and even failure. For gene detection, commonly used paraffin-embedded tissue samples and blood samples placed for a long time, and samples with serious degradation obtained by forensic identification are often poor in nucleic acid integrity, so that subsequent detection results are poor and even fail. Therefore, before performing the detection of the nucleic acid sample, the integrity of the nucleic acid needs to be evaluated, so an accurate and highly sensitive method for evaluating the integrity of the nucleic acid is needed.

The existing methods for detecting the integrity of nucleic acid mainly comprise a Nanodrop method, a Qubit method, a Q-PCR method, a gel electrophoresis method and the like. The Nanodrop method is to detect the concentration of nucleic acid by using a spectrophotometer, and has the principle that nucleic acid, nucleotide and derivatives thereof have conjugated double bond systems and can absorb ultraviolet light, and the ultraviolet absorption peaks of RNA and nucleic acid are at the wavelength of 260 nm, so that the method is simple, convenient and rapid to operate, but if a large amount of substances capable of absorbing ultraviolet light, such as nucleotide or protein, are mixed in a sample, the measurement error is larger, and the Nanodrop and other ultraviolet spectrophotometers all adopt ultraviolet absorbance for detection, so that complete nucleic acid, degraded nucleic acid, free nucleotide and other impurities cannot be distinguished; the Qubit is a new generation of nucleic acid and protein quantitative instrument, which can detect the concentration of specific target molecules by adopting fluorescent dye, the dye can emit fluorescence only after being combined with nucleic acid, RNA or protein, even if free nucleotide or degraded nucleotide exists, so the disadvantage is that the degraded nucleic acid can emit fluorescence as long as a double-stranded structure exists, and the effective concentration can be deviated; most of Q-PCR designs several pairs of internal reference primer probes to amplify samples respectively, and detects unknown sample concentration according to standard products, but has the defect that the reaction number is very large; the gel electrophoresis is to carry out electrophoresis on a sample, judge the degradation degree of the sample according to an electrophoresis strip, judge the concentration of the sample by a gel electrophoresis method to be rough, have large artificial interpretation error and very low sensitivity, and the strip can be obvious only when the concentration is more than 10 ng.

In summary, how to provide a product and a method capable of accurately and rapidly evaluating the integrity of nucleic acid is an urgent problem to be solved in the field of molecular biology.

Disclosure of Invention

Aiming at the defects and actual requirements of the prior art, the invention provides the nucleic acid integrity evaluation kit and the evaluation method, which can effectively evaluate the integrity of the nucleic acid in the sample, and have high sensitivity and high accuracy.

In order to achieve the purpose, the invention adopts the following technical scheme:

in a first aspect, the invention provides a nucleic acid integrity assessment kit, which comprises a primer mixture, a PCR enzyme, a PCR buffer solution, an internal reference and a calibrator, wherein the primer mixture comprises a primer pair for amplifying 4 housekeeping genes, the lengths of PCR products amplified by the primer pair are different, the length difference of the 4 PCR products is not less than 90bp respectively, the length ranges are distributed between 50bp and 1000bp, the internal reference comprises nucleic acid fragments of the 4 housekeeping genes, the sequence of the nucleic acid fragment of the internal reference is increased by at least 2bp compared with the sequence of the nucleic acid fragment of the original housekeeping gene, a non-primer binding region positioned in the amplified fragment of the primer pair is increased, and the calibrator comprises human standard genomic DNA.

The nucleic acid integrity evaluation kit provided by the invention is used for respectively carrying out PCR amplification on 4 housekeeping genes (such as a GAPDH gene, a TBXAS1 gene, an AF4 gene and a PLZF gene) of a sample to be detected and a calibrator, carrying out PCR amplification on internal references in the same system, and then carrying out capillary electrophoresis on all PCR products to evaluate the integrity of nucleic acid. The capillary electrophoresis result can respectively obtain the peak height of each gene of the sample to be detected and the peak height of the corresponding gene of the internal reference in the sample tube to be detected, and the peak height of each gene of the calibrator and the peak height of the corresponding gene of the internal reference in the calibrator tube, so that the peak height ratio of each gene and the corresponding gene of the internal reference in the sample to be detected and the calibrator, namely the peak height of each gene of the sample to be detected/the internal reference peak height of the corresponding gene and the peak height of each gene of the calibrator/the internal reference peak height of the corresponding gene, can be calculated. And comparing the peak height ratio of each gene in the sample to be detected with the peak height ratio of the corresponding gene in the calibrator, and judging the integrity of the nucleic acid of the sample. The nucleic acid fragment design of each housekeeping gene in the internal reference is increased by at least 2bp, so that the peak position of the nucleic acid fragment is different from that of a sample, and the nucleic acid fragment design is used as an internal control of a system and is used for correcting the difference between operation errors and capillary running and the difference caused by the influence of an inhibitor possibly existing in the sample or the system, and the detection accuracy can be obviously improved.

In the present invention, stable expression of housekeeping genes in cells is applicable to the technical scheme of the present invention.

Preferably, the 4 tubular genes comprise GAPDH gene, TBXAS1 gene, AF4 gene and PLZF gene.

Preferably, the nucleic acid sequence of the primer pair of the GAPDH gene comprises the sequences shown in SEQ ID NO. 5-SEQ ID NO. 6.

Preferably, the nucleic acid sequence of the primer pair of the TBXAS1 gene comprises a sequence shown in SEQ ID NO. 7-SEQ ID NO. 8.

Preferably, the nucleic acid sequence of the primer pair of the AF4 gene comprises a sequence shown in SEQ ID NO. 9-SEQ ID NO. 10.

Preferably, the nucleic acid sequence of the primer pair of the PLZF gene comprises a sequence shown in SEQ ID NO. 11-SEQ ID NO. 12.

Preferably, at least one primer of the primer pair has a modification of a fluorophore comprising FAM, VIC, HEX, ROX, CY3, CY5, PET, TAMRA, or NED.

Preferably, the length of the PCR product of the GAPDH gene is 100-120 bp (including but not limited to 101 bp, 102bp, 103 bp, 104 bp, 105 bp, 110 bp, 112 bp, 113 bp, 115 bp, 116 bp, 117 bp, 118 bp or 119 bp), the length of the PCR product of the TBXAS1 gene is 180-200 bp (including but not limited to 181 bp, 182 bp, 183 bp, 184 bp, 185 bp, 190 bp, 192 bp, 193 bp, 195 bp, 196 bp, 197 bp, 198 bp or 199 bp), the length of the PCR product of the AF4 gene is 280-300 bp (including but not limited to 281 bp, 282 bp, 283 bp, 284 bp, 285 bp, 290 bp, 292 bp, 293 bp, 295 bp, 296 bp, 297bp, 298 bp or 299 bp), and the length of the PCR product of the PLPDH gene is 380-400 bp (including but not limited to 381 bp, 103 bp, 104 bp, 105 bp, 185 bp or 199 bp), 382 bp, 383 bp, 384 bp, 385 bp, 390 bp, 392 bp, 393 bp, 395 bp, 396 bp, 397 bp, 398 bp, 399 bp or 400 bp).

In the invention, PCR products with different lengths are respectively designed aiming at 4 genes of GAPDH gene, TBXAS1 gene, AF4 gene and PLZF gene, the product length covers 100-400 bp, and the product length in the detection of conventional Q-PCR, digital PCR (ddPCR), NGS library construction and the like does not exceed 400bp generally, so the fragments with the lengths can meet the requirements of most detection experiments, and the coverage is relatively comprehensive. 1) The length of the PCR product of the PLZF gene is 380-400 bp, the integrity of nucleic acid within 400bp in a sample can be inspected, if the peak height ratio of the PLZF gene in the sample to be detected and the capillary electrophoresis peak height ratio of the corresponding internal reference is not lower than the peak height ratio of the PLZF gene in the calibrator, the integrity of the nucleic acid of the sample is very good, the score is 10 minutes, and the method can be safely used for subsequent detection of Q-PCR, ddPCR, NGS and the like; 2) the length of the PCR product of the AF4 gene is 280-300 bp, the integrity of nucleic acid within 300bp in a sample can be inspected, if the capillary electrophoresis peak height ratio of the PLZF gene and the corresponding internal reference in the sample to be detected is smaller than the peak height ratio of the calibrator, and the capillary electrophoresis peak height ratio of the AF4 gene and the corresponding internal reference is larger than or equal to the peak height ratio of the calibrator, the integrity of the nucleic acid of the sample is shown to be good, the score is 8, and no risk or less risk exists when the PCR product is used for subsequent detection of Q-PCR, ddPCR, NGS and the like; 3) the length of a PCR product of the TBXAS1 gene is 180-200 bp, the integrity of nucleic acid within 200bp in a sample can be inspected, if the capillary electrophoresis peak height ratio of PLZF gene and AF4 gene in the sample to be detected and corresponding internal references thereof is smaller than that of a calibrator, and the peak height ratio of TBXAS1 gene is not lower than that of TBXAS1 gene in the calibrator, the nucleic acid of the sample is degraded to a certain degree and scored for 6 minutes, the subsequent detection only for fragments not larger than 200bp is recommended, if the detection for fragments larger than 200bp is carried out, the sample loading amount needs to be correspondingly increased, so that the detection success rate is increased; 4) the length of a PCR product of the GAPDH gene is 100-120 bp, the integrity of nucleic acid within 100bp in a sample can be inspected, if the capillary electrophoresis peak height ratio of the PLZF gene, the AF4 gene and the TBXAS1 gene in the sample to be detected and corresponding internal references thereof is smaller than the peak height ratio of a calibrator, and the GAPDH gene peak height ratio is not lower than the peak height ratio of the calibrator, the nucleic acid of the sample is seriously degraded and scored for 4 minutes, the detection method is only recommended to be used for detecting fragments not larger than 100bp, if the detection of the fragments larger than 100bp is carried out, the sample loading amount needs to be correspondingly increased, so that the detection success rate is increased; 5) if the capillary electrophoresis peak height ratios of the PLZF gene, the AF4 gene, the TBXAS1 gene and the GAPDH gene in the sample to be detected and corresponding internal references thereof are all smaller than the peak height ratio of the calibrator, the nucleic acid of the sample is seriously degraded, the score is 0, the nucleic acid integrity evaluation is unqualified, and the method is not recommended to be used for the detection of molecular biological technologies such as subsequent Q-PCR, ddPCR, NGS and the like.

In the invention, the PCR product lengths of the GAPDH gene, the TBXAS1 gene, the AF4 gene and the PLZF gene can be selected and designed according to actual requirements.

Preferably, the length of the PCR product of the GAPDH gene is 102bp, the length of the PCR product of the TBXAS1 gene is 195 bp, the length of the PCR product of the AF4 gene is 297bp, and the length of the PCR product of the PLZF gene is 400 bp.

In a specific embodiment of the invention, the capillary electrophoresis result can have characteristic peaks of GAPDH gene, TBXAS1 gene, AF4 gene and PLZF gene products, which respectively correspond to the characteristic peaks of PCR products of 102bp, 195 bp, 297bp and 400bp, and the nucleic acid integrity evaluation can be carried out by comparing the peak height ratio of the sample to be detected and the corresponding gene of the internal reference and the peak height ratio of the calibrator and the corresponding gene of the internal reference. 1) If the capillary electrophoresis peak height ratios corresponding to the PCR products with the lengths of 4 of the sample to be detected are all larger than or equal to the standard peak height ratio of the calibrator, the sample has very good nucleic acid integrity and scores of 10 points, and can be safely used for the detection of subsequent PCR, NGS and other technologies; 2) if the fragments with the lengths of 4 are detected, the peak heights of PCR products with the lengths of only 102bp, 195 bp and 297bp in the sample to be detected are more than or equal to the peak height ratio of the calibrator, so that the sample has good nucleic acid integrity and scores of 8 points, and the PCR detection kit has no risk or less risk when used for subsequent PCR, NGS and other detections; 3) if the fragments with the lengths of 4 are fragments, the ratio of the peak height of the PCR product with the lengths of only 102bp and 195 bp to the capillary electrophoresis peak height of the internal reference is more than or equal to that of the calibrator, which indicates that the nucleic acid of the sample is degraded to a certain extent, and the score is 6, the method is only suggested to be used for detecting the fragments with the length of not more than 200bp, if the detection of the fragments with the length of more than 200bp is carried out, the sample loading amount needs to be correspondingly increased, so that the detection success rate is increased; 4) if the fragments with the lengths of 4 are detected, the ratio of the peak height of the capillary electrophoresis of the PCR product with the length of only 102bp of the sample to be detected to the peak height of the internal reference is more than or equal to the peak height of the calibrator, which indicates that the nucleic acid of the sample is seriously degraded, the score is 4, and the method is only suggested to be used for detecting the fragments with the length of not more than 100bp, if the fragments with the length of more than 100bp are required to be detected, the sample loading amount needs to be correspondingly increased so as to improve the detection success rate; 5) if the capillary electrophoresis peak height ratios corresponding to the PCR products with the lengths of 4 fragments are all smaller than the standard peak height ratio generated by the calibrator, the sample nucleic acid is very seriously degraded, the score is 0, the nucleic acid integrity is evaluated as unqualified, and the method is not recommended to be used for the detection of molecular technologies such as subsequent PCR, NGS and the like.

Preferably, the nucleic acid sequence of the GAPDH gene fragment of the internal reference comprises the sequence shown in SEQ ID No. 1.

Preferably, the nucleic acid sequence of the TBXAS1 gene fragment of the internal reference comprises the sequence shown in SEQ ID No. 2.

Preferably, the nucleic acid sequence of the AF4 gene fragment in the internal reference comprises a sequence shown in SEQ ID NO. 3.

Preferably, the nucleic acid sequence of the PLZF gene segment in the internal reference comprises the sequence shown in SEQ ID No. 4.

SEQ ID NO.1：

cttttgcgtcgccaggtgaagattcgggcggagagaaacccgggaggctagggacggcctgaaggcggcaggggcgggcgcaggccggatgtgttcgcgccgct。

SEQ ID NO.2：

aatggtcctggatgcccgacttattctgcaagtcccatgggcgtgcaagactttgacatcgtcagagacgttttctcctctactgggtgcaagccgaacccttcccggcaacaccagcccagccctatggccaggcctttgactgtggatgagattgtgggccaggccttcatcttcctcatcgctggctatgaaatcatcacca。

SEQ ID NO.3：

cagtagccacgctagtccattccttcagaaggaaatttttttttttaacaatgacttttggtaaagggttttgtggatgattttttttcttttgagttttgggagaaatatttgtttagtaacttctaatggccatctgtaaaccataagtaatgaaggactccactgtgccccactttctgccaatgaacagtggcttgataataccaagtattgttgtaatttataaaattgaaggcaacccccgctcctgccgcccccaatctccccattgcctagagcgctgcacattgaccccagctctgactt。

SEQ ID NO.4：

tcctcttccaccgcaatagtcaacactttatactttggacttcctctcgccaaagaccttccagcagattctggagtatgcatatacagccacgctgcaagccaaggcggaggacctggatgacctgctgtatgcggccgagatcctggagatcgagtacctggaggaacagtgcctgaagatgctggagaccatccaggcctcagacgacaatgacacggaggccaccatggccgatggcggggccgaggaagaagaggaccgcaaggctcggtacctcaagaacatcttcatctcgaagcattccagcgaggagagtgggtatgccagtgtggctggacagagcctccctgggcccatggtggaccagagcccttcagtctccacttcatttggtctttcagcc。

SEQ ID NO.5：cttttgcgtcgccaggtgaaga。

SEQ ID NO.6：agcggcgcgaacacatcc。

SEQ ID NO.7：aatggtcctggatgcccgac。

SEQ ID NO.8：tggtgatgatttcatagccagcgat。

SEQ ID NO.9：cagtagccacgctagtccattcc。

SEQ ID NO.10：aagtcagagctggggtcaatgtg。

SEQ ID NO.11：cttccaccgcaatagtcaacact。

SEQ ID NO.12：ggctgaaagaccaaatgaagtgg。

Preferably, the human standard genomic DNA generally refers to a DNA sample whose integrity can completely meet the requirements of the corresponding experiment, in general, extracted from normal human fresh diploid cells or fresh tissues, dissolved in TE or similar buffer solution, free from contamination by proteins, RNA, polysaccharides, etc., and subjected to stringent Qubit or similar DNA based on precise quantification by fluorescent dyes.

Preferably, the internal reference comprises a plasmid containing GAPDH gene, TBXAS1 gene, AF4 gene and PLZF gene segments, wherein the GAPDH gene, TBXAS1 gene, AF4 gene and PLZF gene segments are in the same plasmid, or the GAPDH gene, TBXAS1 gene, AF4 gene and PLZF gene segments are in different plasmids respectively.

In the invention, the corresponding nucleic acid segments of the primer pairs of the GAPDH gene, the TBXAS1 gene, the AF4 gene and the PLZF gene are inserted into a plasmid, a plasmid template form is used as an internal reference, the storage is convenient, the insertion mode can be selected according to requirements, four genes can be inserted into the same plasmid, and the four genes can also be independently inserted into the plasmid.

Preferably, the PCR enzyme comprises Taq nucleic acid polymerase.

In the present invention, commercially available polymerase and buffer for conventional PCR amplification are suitable.

In a second aspect, the present invention provides a use of the nucleic acid integrity assessment kit according to the first aspect for detecting nucleic acid integrity.

In a third aspect, the present invention provides a nucleic acid integrity assessment method, comprising:

the nucleic acid integrity evaluation kit of the first aspect is utilized to respectively take a sample to be detected and the calibrator as templates to carry out PCR, carry out capillary electrophoresis on PCR products, compare peak height ratios of 4 housekeeping genes in the sample to be detected and the calibrator, and judge the nucleic acid integrity of the sample to be detected.

Respectively carrying out PCR amplification on 4 tube family genes of a sample to be detected and a calibrator, simultaneously carrying out PCR amplification on internal references in the same system, and then carrying out capillary electrophoresis on all PCR products to evaluate the integrity of nucleic acid. The capillary electrophoresis result can respectively obtain the peak height of each gene of the sample to be detected and the peak height of the corresponding gene of the internal reference in the sample tube to be detected, and the peak height of each gene of the calibrator and the peak height of the corresponding gene of the internal reference in the calibrator tube, so that the peak height ratio of each gene and the corresponding gene of the internal reference in the sample to be detected and the calibrator can be calculated, namely the peak height of each gene of the sample to be detected/the internal reference peak height of the corresponding gene, and the peak height of each gene of the calibrator/the internal reference peak height of the corresponding gene. And comparing the peak height ratio of each gene in the sample to be detected with the peak height ratio of the corresponding gene in the calibrator, and judging the integrity of the nucleic acid of the sample.

In the PCR reaction system, the concentration of the calibrator human standard genome DNA is added according to the concentration requirement of nucleic acid in a sample to be detected in a specific experiment, so that whether the integrity of the nucleic acid of the sample to be detected meets the requirement can be judged by comparing the sample to be detected with the calibrator.

In the invention, the samples possibly degraded, such as paraffin-embedded tissue nucleic acid samples, blood nucleic acid samples, fresh tissue nucleic acid samples, frozen tissue nucleic acid samples, outdoor severely degraded samples obtained by forensic identification and the like, can be subjected to nucleic acid integrity evaluation by using the method of the invention.

Preferably, the sample to be tested comprises a paraffin-embedded tissue nucleic acid sample.

Preferably, the PCR comprises multiplex fluorescence PCR.

Compared with the prior art, the invention has the following beneficial effects:

(1) the kit disclosed by the invention can be used for simultaneously detecting the lengths of multiple gene multiple nucleic acid templates through one-tube reaction, has the advantages of comprehensive coverage length, few reaction numbers and short detection period, and can be used for simply and rapidly detecting the degradation degree and integrity of DNA in a sample to be detected;

(2) the kit of the invention is provided with internal reference plasmids corresponding to gene segments with different lengths as internal controls, and simultaneously carries out amplification, and compared with the internal reference, the kit can reduce errors caused by experimental operation and capillary electrophoresis processes and differences caused by the influence of inhibitors in a sample or a system;

(3) the invention has higher detection sensitivity: genomic DNA as low as 0.2ng can be detected, and the peak height completely reaches the standard of effective peaks; the accuracy is good: the nucleic acid sample evaluated by the method is detected by other target systems, and the result is in line with expectation.

Drawings

FIG. 1 is a graph showing the results of integrity measurement of 0.2ng of nucleic acid in example 2 of the present invention;

FIG. 2 is a diagram showing the result of integrity test of the calibrator in the present invention;

FIG. 3 is a diagram showing the results of integrity testing of FFPE1 samples in example 2 of the present invention;

FIG. 4 is a diagram showing the results of integrity testing of FFPE2 samples in example 2 of the present invention;

FIG. 5 is a MSI system result chart of the calibrator in example 3 of the present invention;

FIG. 6 is a diagram showing the results of integrity testing of FFPE3 samples in example 3 of the present invention;

FIG. 7 is a graph of the MSI system results of a sample FFPE3 in example 3 of the present invention;

FIG. 8 is a diagram showing the results of integrity testing of FFPE4 samples in example 3 of the present invention;

FIG. 9 is a graph of the MSI system results of a sample FFPE4 in example 3 of the present invention;

FIG. 10 is a graph showing the results of integrity tests of the calibrator in comparative example 1 in accordance with the present invention;

FIG. 11 is a graph showing the results of integrity tests of the calibrator in comparative example 1 of the present invention.

Detailed Description

To further illustrate the technical means adopted by the present invention and the effects thereof, the present invention is further described below with reference to the embodiments and the accompanying drawings. It is to be understood that the specific embodiments described herein are merely illustrative of the invention and are not limiting of the invention.

The examples do not show the specific techniques or conditions, according to the technical or conditions described in the literature in the field, or according to the product specifications. The reagents or apparatus used are conventional products commercially available from normal sources, not indicated by the manufacturer.

Example 1 design and construction of nucleic acid integrity evaluation kit

The invention provides a nucleic acid integrity evaluation kit, which contains primer mixed liquor, PCR enzyme, PCR buffer solution, internal reference, a calibrator and purified water.

1. Design of primers

The primer mixture comprises a GAPDH primer pair SEQ ID NO.5 (5 'end FAM modification) and SEQ ID NO.6, a TBXAS1 primer pair SEQ ID NO.7 (5' end FAM modification) and SEQ ID NO.8, an AF4 primer pair SEQ ID NO.9 (5 'end FAM modification) and SEQ ID NO.10, and a PLZF primer pair SEQ ID NO.11 (5' end FAM modification) and SEQ ID NO. 12.

2. Preparation of internal reference

The internal reference is 4 plasmids containing GAPDH gene, TBXAS1 gene, AF4 gene and PLZF gene nucleic acid segments shown as SEQ ID No. 1-SEQ ID No.4 respectively, and the preparation method is as follows:

1) designing a PCR primer according to a known sequence, and carrying out PCR amplification on a target fragment;

2) purifying the amplification product;

3) inserting a target gene into a vector by methods such as homologous recombination, enzyme digestion connection and the like, transforming escherichia coli competent cells, plating and culturing, and selecting a monoclonal;

4) sequencing verification is carried out on the single clone, and the clone inserted with the target fragment is selected for shake bacteria;

5) plasmid nucleic acid is extracted, quantified and stored at-20 ℃ for later use.

3. Preparation of calibrator

The calibrator was human standard genomic DNA from a human cell line (K562 cell line, purchased from national cell resources Bank) and quantified to 10 cells⁶Extracting by adopting a blood/tissue/cell DNA extraction kit of Tiangen, carrying out Nanodrop on the extracted DNA to determine the purity, measuring the concentration by using the Qubit, and then quantifying the cell line DNA to 10 ng/. mu.L to be used as a calibrator in the kit.

4. Other Components of the kit

The PCR enzyme is TaKaRa Ex Taq Hot Start Version, and the PCR Buffer solution is 10 XEx Taq Buffer (Mg²⁺ plus) (20 mM)。

Example 2 kit Performance test assay

This example analyzes the performance parameters of the nucleic acid integrity assessment kit of example 1.

1. Sensitivity analysis

The kit is used for carrying out PCR and capillary electrophoresis on different amounts of nucleic acid (0.1 ng, 0.2ng, 0.3 ng, 0.5 ng and 1 ng), wherein the PCR reaction system is shown in table 1, the reaction conditions are shown in table 2, the computer system for capillary electrophoresis is shown in table 3, the computer-on instrument is ABI3500Dx, and the computer-on program is shown in table 4.

TABLE 1

TABLE 2

TABLE 3

TABLE 4

When the total amount of nucleic acid is more than or equal to 0.2ng, the effective peak height can be obtained, as shown in figure 1, namely, 0.2ng of nucleic acid can be detected at the lowest, which indicates that the kit has higher sensitivity.

2. Analysis of accuracy

Two paraffin-embedded tissue nucleic acid samples (FFPE 1 and FFPE 2) with different known degradation degrees were tested using the kit, wherein the FFPE1 sample was degraded more severely and the FFPE2 sample was intact. The PCR reaction system is shown in Table 5, the reaction conditions are shown in Table 2, and the results of capillary electrophoresis performed as described in the above sensitivity analysis are shown in FIGS. 2 to 4.

TABLE 5

As can be seen from FIGS. 2 and 3, the FFPE1 sample has a peak height ratio of 102bp greater than that of the calibrator and a peak height ratio of 195 bp, 297bp and 400bp less than that of the calibrator, and the score is 4, which indicates that the sample can be subjected to PCR amplification of a product of less than 102bp and is at risk of amplification of more than 102 bp; as can be seen from FIGS. 2 and 4, the FFPE2 sample has peak height ratios of 102bp, 195 bp, 297bp and 400bp higher than that of the calibrator, and the score is 10 minutes, which indicates that the integrity of nucleic acid is good, and the detection result is consistent with the known degradation condition of the sample, indicating that the kit has good accuracy.

Example 3 application of the kit of the invention to sample evaluation before microsatellite instability (MSI) detection of human tumor samples

This example used the kit of example 1 to detect 3 nucleic acids, 1 of which was a calibrator and 2 of which were FFPE samples (FFPE 3 and FFPE 4).

Adopting a paraffin tissue DNA extraction kit (product number N032A 01) of Mejie transformation medical research (Suzhou) Limited company to extract nucleic acid, then using the kit to detect and evaluate the nucleic acid according to the method described in example 2, wherein the detection result of a nucleic acid integrity evaluation system is shown in figure 2, figure 6 and figure 8, and figure 2 is the result of a calibrator, and as shown in figure 6, it can be known that the FFPE3 sample has a peak height ratio of 102bp greater than that of the calibrator, a peak height ratio of 195 bp slightly smaller than that of the calibrator, a peak height ratio of 297bp and 400bp smaller than that of the calibrator, and a score of 4, and the subsequent detection is only recommended to be used for fragments of not greater than 100bp, if the detection of fragments of greater than 100bp is required, the sample loading amount needs to be correspondingly increased, so as to increase the detection success rate; from fig. 8, it can be seen that the FFPE4 sample has a peak height ratio of 102bp greater than the peak height ratio of the calibrator, and has a peak height ratio of 195 bp, 297bp and 400bp less than the peak height ratio of the calibrator, and the score is 4, which indicates that the nucleic acid of the sample has relatively serious degradation, and the FFPE4 sample is only suggested to be used for detecting fragments not greater than 100bp, and if the detection of fragments greater than 100bp is required to be performed, the sample loading amount needs to be correspondingly increased to increase the detection success rate; then, the extracted nucleic acid sample is subjected to MSI detection, the detection method is specifically disclosed in patent No. CN201810581074.7, the results are shown in FIG. 5, FIG. 7 and FIG. 9, FIG. 5 is the detection result of the MSI of the calibrator, the amplification of the 100 bp-300 bp fragment is good, and the peak height does not decrease. The MSI detection result of the FFPE3 sample in FIG. 7 shows that after 100bp, the peak height of the fragment is obviously reduced near 200bp, and the band near 300bp is not amplified. The MSI test results from the FFPE4 sample in FIG. 9 show that a band around 100bp can be amplified, and a band greater than 100bp is hardly amplified. As can be seen from the comparison, the prediction results of the sample tested by the nucleic acid integrity evaluation kit on the degradation degree of the fragment when the MSI test is carried out are consistent.

Comparative example 1

This comparative example provides a detection system, which is the same as example 1 except that it does not contain an internal reference, and detects nucleic acid in an FFPE sample using the detection system, as compared with example 1. The results show that the same sample is subjected to repeated experiments for a plurality of times without adding internal reference, the peak height difference of the same site is large and has no comparability, the capillary electrophoresis results are shown in fig. 10 and fig. 11, and the difference can be caused by experimental operation errors, or capillary running errors corresponding to different holes, and the like.

In conclusion, the nucleic acid integrity evaluation kit can be effectively applied to nucleic acid integrity detection, is simple to operate and high in detection sensitivity, and can detect genomic DNA (deoxyribonucleic acid) as low as 0.2 ng; the internal reference plasmid is simultaneously amplified to serve as an internal control, errors caused by experimental operation and a capillary electrophoresis process and errors caused by the influence of an inhibitor possibly existing in a sample or a system are reduced, the accuracy is good, the sample nucleic acid after being evaluated by the kit is amplified in a target system, and the results are consistent.

The applicant states that the present invention is illustrated in detail by the above examples, but the present invention is not limited to the above detailed methods, i.e. it is not meant that the present invention must rely on the above detailed methods for its implementation. It should be understood by those skilled in the art that any modification of the present invention, equivalent substitutions of the raw materials of the product of the present invention, addition of auxiliary components, selection of specific modes, etc., are within the scope and disclosure of the present invention.

Sequence listing

<110> Mejie transformation medical research (Suzhou) Co., Ltd

<120> nucleic acid integrity assessment kit and assessment method

<130> 2021-12-10

<160> 12

<170> PatentIn version 3.3

<210> 1

<211> 104

<212> DNA

<213> Artificial sequence

<400> 1

cttttgcgtc gccaggtgaa gattcgggcg gagagaaacc cgggaggcta gggacggcct 60

gaaggcggca ggggcgggcg caggccggat gtgttcgcgc cgct 104

<210> 2

<211> 205

<212> DNA

<213> Artificial sequence

<400> 2

aatggtcctg gatgcccgac ttattctgca agtcccatgg gcgtgcaaga ctttgacatc 60

gtcagagacg ttttctcctc tactgggtgc aagccgaacc cttcccggca acaccagccc 120

agccctatgg ccaggccttt gactgtggat gagattgtgg gccaggcctt catcttcctc 180

atcgctggct atgaaatcat cacca 205

<210> 3

<211> 309

<212> DNA

<213> Artificial sequence

<400> 3

cagtagccac gctagtccat tccttcagaa ggaaattttt ttttttaaca atgacttttg 60

gtaaagggtt ttgtggatga ttttttttct tttgagtttt gggagaaata tttgtttagt 120

aacttctaat ggccatctgt aaaccataag taatgaagga ctccactgtg ccccactttc 180

tgccaatgaa cagtggcttg ataataccaa gtattgttgt aatttataaa attgaaggca 240

acccccgctc ctgccgcccc caatctcccc attgcctaga gcgctgcaca ttgaccccag 300

ctctgactt 309

<210> 4

<211> 406

<212> DNA

<213> Artificial sequence

<400> 4

tcctcttcca ccgcaatagt caacacttta tactttggac ttcctctcgc caaagacctt 60

ccagcagatt ctggagtatg catatacagc cacgctgcaa gccaaggcgg aggacctgga 120

tgacctgctg tatgcggccg agatcctgga gatcgagtac ctggaggaac agtgcctgaa 180

gatgctggag accatccagg cctcagacga caatgacacg gaggccacca tggccgatgg 240

cggggccgag gaagaagagg accgcaaggc tcggtacctc aagaacatct tcatctcgaa 300

gcattccagc gaggagagtg ggtatgccag tgtggctgga cagagcctcc ctgggcccat 360

ggtggaccag agcccttcag tctccacttc atttggtctt tcagcc 406

<210> 5

<211> 22

<212> DNA

<213> Artificial sequence

<400> 5

cttttgcgtc gccaggtgaa ga 22

<210> 6

<211> 18

<212> DNA

<213> Artificial sequence

<400> 6

agcggcgcga acacatcc 18

<210> 7

<211> 20

<212> DNA

<213> Artificial sequence

<400> 7

aatggtcctg gatgcccgac 20

<210> 8

<211> 25

<212> DNA

<213> Artificial sequence

<400> 8

tggtgatgat ttcatagcca gcgat 25

<210> 9

<211> 23

<212> DNA

<213> Artificial sequence

<400> 9

cagtagccac gctagtccat tcc 23

<210> 10

<211> 23

<212> DNA

<213> Artificial sequence

<400> 10

aagtcagagc tggggtcaat gtg 23

<210> 11

<211> 23

<212> DNA

<213> Artificial sequence

<400> 11

cttccaccgc aatagtcaac act 23

<210> 12

<211> 23

<212> DNA

<213> Artificial sequence

<400> 12

ggctgaaaga ccaaatgaag tgg 23

Claims

1. A nucleic acid integrity evaluation kit is characterized by comprising a primer mixed solution, a PCR enzyme, a PCR buffer solution, an internal reference and a calibrator;

the primer mixture comprises primer pairs for amplifying 4 housekeeping genes, the lengths of PCR products amplified by the primer pairs are different, the length difference of the 4 PCR products is not less than 90bp respectively, and the length ranges are distributed between 50bp and 1000 bp;

the internal reference comprises nucleic acid fragments of the 4 housekeeping genes, the sequence of the nucleic acid fragment of the internal reference is increased by at least 2bp compared with the sequence of the nucleic acid fragment of the original housekeeping gene, and a non-primer binding region positioned in the amplified fragments of the primer pair is increased;

the calibrator comprises human standard genomic DNA.

2. The nucleic acid integrity assessment kit according to claim 1, wherein said 4 tube family genes comprise GAPDH gene, TBXAS1 gene, AF4 gene and PLZF gene.

3. The nucleic acid integrity evaluation kit according to claim 2, wherein the nucleic acid sequence of the primer pair of the GAPDH gene comprises the sequences shown in SEQ ID No.5 to SEQ ID No. 6;

the nucleic acid sequence of the primer pair of the TBXAS1 gene comprises sequences shown in SEQ ID NO. 7-SEQ ID NO. 8;

the nucleic acid sequence of the primer pair of the AF4 gene comprises sequences shown in SEQ ID NO. 9-SEQ ID NO. 10;

the nucleic acid sequence of the primer pair of the PLZF gene comprises a sequence shown by SEQ ID NO. 11-SEQ ID NO. 12;

at least one primer in the primer pair has a modification of a fluorophore comprising FAM, VIC, HEX, ROX, CY3, CY5, PET, TAMRA, or NED.

4. The nucleic acid integrity evaluation kit according to claim 2, wherein the length of the PCR product of the GAPDH gene is 100-120 bp;

the length of the PCR product of the TBXAS1 gene is 180-200 bp;

the length of the PCR product of the AF4 gene is 280-300 bp;

the length of the PCR product of the PLZF gene is 380-400 bp.

5. The nucleic acid integrity assessment kit according to claim 1, wherein the nucleic acid sequence of the GAPDH gene segment of the internal reference comprises the sequence shown in SEQ ID No. 1;

the nucleic acid sequence of the TBXAS1 gene fragment in the internal reference comprises a sequence shown in SEQ ID NO. 2;

the nucleic acid sequence of the AF4 gene fragment in the internal reference comprises a sequence shown in SEQ ID NO. 3;

the nucleic acid sequence of the PLZF gene segment in the internal reference comprises a sequence shown in SEQ ID NO. 4.

6. The nucleic acid integrity assessment kit of claim 1, wherein said internal reference comprises a plasmid containing a GAPDH gene, a TBXAS1 gene, an AF4 gene and a PLZF gene segment;

the GAPDH gene, the TBXAS1 gene, the AF4 gene and the PLZF gene segments are in the same plasmid, or the GAPDH gene, the TBXAS1 gene, the AF4 gene and the PLZF gene segments are in different plasmids respectively.

7. Use of the nucleic acid integrity assessment kit of any one of claims 1-6 for the detection of nucleic acid integrity.

8. A nucleic acid integrity assessment method, characterized in that it comprises:

the nucleic acid integrity evaluation kit according to any one of claims 1 to 6, wherein a sample to be tested and the calibrator are used for PCR amplification, a PCR product is subjected to capillary electrophoresis, and the peak height ratios of 4 housekeeping genes in the sample to be tested and the calibrator are compared to judge the nucleic acid integrity of the sample to be tested.

9. The method of claim 8, wherein the sample to be tested comprises a paraffin-embedded tissue nucleic acid sample, a blood nucleic acid sample, a fresh tissue nucleic acid sample, or a frozen tissue nucleic acid sample.

10. The method of claim 8, wherein the PCR comprises multiplex fluorescence PCR.