CN113913455B - Rice mitochondrial protein OsNBL3 related to plant disease resistance, and coding gene and application thereof - Google Patents

Abstract

The invention discloses rice OsNBL3 protein related to plant disease resistance, and a coding gene and application thereof. The OsNBL3 protein provided by the invention is a protein shown in a sequence 2, and the encoding gene of the OsNBL3 protein is a DNA molecule shown in a sequence 1. According to the invention, a T-DNA insertion site is cloned through SiteFining-PCR, and the fact that the insertion of the T-DNA leads to the downregulation expression of an OsNBL3 gene is found; and confirmed by RNA interference of OsNBL3 gene in wild rice: the RNA interference of the OsNBL3 gene can lead rice to spontaneously generate leaf spot, enhance the resistance to rice blast and bacterial leaf spot, and suggest that the OsNBL3 gene has better application potential and application value in improving the disease resistance of crops.

Description

Rice mitochondrial protein OsNBL3 related to plant disease resistance, and coding gene and application thereof

Technical Field

The invention belongs to the field of plant genetic engineering, and in particular relates to rice mitochondrial protein OsNBL3 related to plant disease resistance, and a coding gene and application thereof.

Background

Rice is taken as a first large grain crop in China, is an important guarantee of national grain safety strategy, and rice diseases are always main factors of the reduction of rice yield and quality. The disease resistance of rice varieties can be scientifically and reasonably utilized to effectively control the occurrence of rice diseases. The research shows that the disease-resistant mechanism of the plants is complex and can be regulated, and although a great deal of research reports on the disease-resistant mechanism exist, the research reports are far from clear in comparison with the general. The new mechanism of plant disease resistance is identified, and the method has important significance for scientific and reasonable utilization of the novel mechanism.

Mitochondria continuously provide energy for the vital activities of eukaryotes, and are processing plants for producing energy. The respiratory electron transfer chain is an energy production line consisting of a respiratory enzyme complex that is inlaid or anchored on the endomembrane of the telomere, including nicotinamide adenine dinucleotide (nicotinamide adenine dinucleotide, NADH) -ubiquinone oxidoreductase (complex I), succinic acid-ubiquinone reductase (complex II), cytochrome b precursor (complex III), cytochrome c oxidase (complex IV) and ATP synthase (complex V). In addition to complex II, other complex proteins are encoded by the mitochondrial genome, which complexes can transfer electrons to oxygen, which support cellular energy metabolism via redox reactions, oxygen is not sufficiently reduced to produce ROS (reactive oxygen species), and when abnormal gene function occurs in the respiratory electron transfer chain, loss of function of the electron transfer chain can lead to electron leakage, resulting in production of mitochondrial ROS, which in some cases can trigger Programmed Cell Death (PCD). Further triggering the plant to produce allergic necrosis response (HR), and finally activating and regulating the defense response mechanism of the plant. At present, the mechanism of the process is not clear, in order to explore the regulation and control path of mitochondrial genes involved in plant disease resistance, it is highly required to obtain genes positioned at mitochondria through genetic pathways, further define the molecular functions of the genes, determine how the genes are involved in plant defense reaction pathways, and provide basis for analyzing the action mechanism of mitochondrial genes in plant disease resistance.

Disclosure of Invention

In order to solve the technical problems, the invention firstly provides a new application of the OsNBL3 protein.

The invention provides an application of OsNBL3 protein in regulating and controlling plant disease resistance

The OsNBL3 protein is a protein shown in any one of the following A1), A2), A3) or A4):

a1 Protein composed of amino acid sequences shown in sequence 2 in a sequence table;

a2 A fusion protein obtained by connecting a label with the N end or/and the C end of the protein shown in the sequence 2 in the sequence table;

a3 Protein which is obtained by substituting and/or deleting and/or adding one or more amino acid residues for the amino acid sequence shown in the sequence 2 in the sequence table and is related to plant disease resistance;

a4 A protein having 99% or more, 95% or more, 90% or more, 85% or more, or 80% or more homology with the amino acid sequence defined in any one of A1) to A3) and being related to plant disease resistance.

Wherein, sequence 2 consists of 409 amino acid residues.

In order to facilitate purification of the protein of a), a tag as shown in Table 1 may be attached to the amino-or carboxy-terminus of the protein shown in sequence 2 in the sequence listing.

TABLE 1 sequence of tags

Label (Label)	Residues	Sequence(s)
			Poly-Arg	5-6 (usually 5)	RRRRR
Poly-His	2-10 (usually 6)	HHHHHH
			FLAG	8	DYKDDDDK
Strep-tag II	8	WSHPQFEK
			c-myc	10	EQKLISEEDL

The protein OsNBL3 in the above c), wherein the substitution and/or deletion and/or addition of one or several amino acid residues is not more than 10 amino acid residues.

The protein OsNBL3 in the c) can be synthesized artificially or can be obtained by synthesizing the coding gene and then biologically expressing.

The gene encoding OsNBL3 of the protein in c) above can be obtained by deleting one or more amino acid residues in the DNA sequence shown in the sequence 1, and/or performing one or more base pair missense mutations, and/or ligating the coding sequences of the tags shown in the table 1 at the 5 'end and/or the 3' end thereof.

In order to solve the technical problems, the invention also provides a new application of the biological material related to the OsNBL3 protein.

The invention provides application of biological materials related to OsNBL3 protein in regulating and controlling plant disease resistance.

The biomaterial is any one of the following B1) to B8):

b1 Nucleic acid molecules encoding OsNBL3 proteins;

b2 An expression cassette comprising the nucleic acid molecule of B1);

b3 A recombinant vector comprising the nucleic acid molecule of B1);

b4 A recombinant vector comprising the expression cassette of B2);

b5 A recombinant microorganism comprising the nucleic acid molecule of B1);

b6 A recombinant microorganism comprising the expression cassette of B2);

b7 A recombinant microorganism containing the recombinant vector of B3);

b8 A recombinant microorganism containing the recombinant vector of B4).

In the above application, the nucleic acid molecule of B1) is a gene as shown in the following 1) or 2) or 3) or 4):

1) The coding sequence is a DNA molecule shown in a sequence 1;

2) A DNA molecule derived from rice having more than 98% homology with the DNA sequence defined in 1) and encoding a plant disease resistance-related protein;

3) A DNA molecule which hybridizes under stringent conditions with the DNA sequence defined in 1) or 2) and which encodes a plant disease resistance-related protein;

4) A DNA molecule having more than 90% homology with the DNA sequence defined in 1) or 2) and encoding a plant disease resistance related protein.

In the above application, the nucleic acid molecule may be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule may also be RNA, such as mRNA or hnRNA, etc. Wherein the sequence 1 consists of 1230 nucleotides, and the whole sequence 1 is the coding sequence (ORF) of the OsNBL3 gene, and codes the protein shown as the sequence 2 in the sequence table.

The nucleotide sequence encoding OsNBL3 of the present invention can be easily mutated by one of ordinary skill in the art using known methods, such as directed evolution and point mutation. Those artificially modified nucleotides having 75% or more identity to the nucleotide sequence of OsNBL3 isolated according to the present invention are derived from the nucleotide sequence of the present invention and are equivalent to the sequence of the present invention as long as they encode OsNBL3 and have the same function.

The term "identity" as used herein refers to sequence similarity to a native nucleic acid sequence. "identity" includes a nucleotide sequence having 75% or more, or 85% or more, or 90% or more, or 95% or more identity with the nucleotide sequence of a protein consisting of the amino acid sequence shown in the coding sequence 2 of the present invention. Identity can be assessed visually or by computer software. Using computer software, the identity between two or more sequences can be expressed in percent (%), which can be used to evaluate the identity between related sequences.

The 75% or more identity may be 80%, 85%, 90% or 95% or more identity.

In the above application, the expression cassette (OsNBL 3 gene expression cassette) comprising a nucleic acid molecule encoding OsNBL3 as described in B2) means a DNA capable of expressing OsNBL3 in a host cell, and the DNA may include not only a promoter for initiating transcription of OsNBL3 but also a terminator for terminating transcription of OsNBL 3. Further, the expression cassette may also include an enhancer sequence. Promoters useful in the present invention include, but are not limited to: a constitutive promoter; tissue, organ and development specific promoters and inducible promoters. Suitable transcription terminators include, but are not limited to: agrobacterium nopaline synthase terminator (NOS terminator), cauliflower mosaic virus CaMV 35S terminator, tml terminator, pea rbcS E9 terminator and nopaline and octopine synthase terminator.

The plant recombinant expression vector can be constructed by using the existing plant expression vector. The plant expression vectors include binary agrobacterium vectors, vectors useful for microprojectile bombardment, and the like, such as pGreen0029, pCAMBIA3301, pCAMBIA1300, pCAMBIA1301, pBI121, pBin19, pCAMBIA2301, pCG1301, or other derived plant expression vectors. The plant expression vector may also comprise the 3' -untranslated region of a foreign gene, i.e., comprising a polyadenylation signal and any other DNA segments involved in mRNA processing or gene expression. The polyadenylation signal may direct the addition of polyadenylation to the 3' end of the mRNA precursor. When the gene is used for constructing a recombinant expression vector, any one of enhanced, constitutive, tissue-specific or inducible promoters, such as cauliflower mosaic virus (CaMV) 35S promoter, ubiquitin gene Ubiquitin promoter (pUbi), stress-inducible promoter Rd29A and the like, which can be used alone or in combination with other plant promoters, can be added before transcription initiation nucleotide; in addition, when constructing a recombinant expression vector using the gene of the present invention, enhancers, including translational enhancers or transcriptional enhancers, may be used, and these enhancers may be ATG initiation or adjacent region initiation codons, etc., but must be identical to the reading frame of the coding sequence to ensure proper translation of the entire sequence. The sources of the translational control signals and initiation codons are broad, and can be either natural or synthetic. The translation initiation region may be derived from a transcription initiation region or a structural gene. To facilitate identification and selection of transgenic plant cells or plants, the plant expression vectors used may be processed, for example by adding genes encoding enzymes or luminescent compounds which produce a color change, antibiotic markers or chemical resistance marker genes which are expressed in the plants, etc. Or directly screening transformed plants by adversity without adding any selection marker gene.

In the above applications, the vector may be a plasmid, cosmid, phage or viral vector. In the invention, the recombinant vector is specifically a vector obtained by inserting a DNA molecule containing a ubiquitin promoter and an OsNBL3-RNAi gene shown in a sequence 3 between Pme I and Mlu I cleavage sites of a pCAMBIA1301 vector.

In the above application, the microorganism may be a yeast, a bacterium, an alga or a fungus, such as Agrobacterium. In the present invention, the agrobacterium employed is specifically EHA105.

The invention also provides application of the OsNBL3 protein or biological material related to the OsNBL3 protein in cultivating transgenic plants with improved disease resistance.

The invention also provides an application of the OsNBL3 protein or the biological material in plant breeding. The purpose of the breeding is to cultivate disease-resistant plant varieties.

In the application, the regulation of plant disease resistance is to improve plant disease resistance. The disease resistance can be rice blast resistance and/or rice bacterial leaf blight resistance.

The regulation and control of plant disease resistance is shown in the following steps: when the OsNBL3 protein content and/or activity in a plant is increased or the expression level of the OsNBL3 gene is increased, the disease resistance of the plant is reduced; when the OsNBL3 protein content and/or activity in a plant is decreased or the expression level of the OsNBL3 gene is decreased, the disease resistance of the plant is improved. The improvement of disease resistance of the plant is embodied in any one of the following m 1) to m 4) when the OsNBL3 protein content and/or activity in the plant is reduced or the expression level of the OsNBL3 gene is reduced:

m 1) the plant spontaneously produces leaf blight;

m 2) active oxygen can be detected at the position of the plant where the plant produces leaf spot;

m 3) the length of the plant lesions is reduced after inoculation with pathogenic bacteria; the pathogenic bacteria are rice blast bacteria (such as rice blast fungus race P007) or bacterial leaf blight bacteria (such as rice bacterial leaf blight strain PXO 99);

m 4) the expression level of the plant defense-related gene is increased; the defense-related genes are in particular the genes PR1b and/or PR2 and/or PR3 and/or PR5 and/or PR8 and/or PR10.

In order to solve the technical problems, the invention finally provides a method for cultivating transgenic plants with improved disease resistance.

The method for cultivating transgenic plants with improved disease resistance comprises the steps of reducing the content and/or activity of OsNBL3 protein in a receptor plant to obtain transgenic plants; the transgenic plant has a disease resistance greater than the recipient plant.

In the method, the disease resistance is rice blast resistance and/or rice bacterial leaf blight resistance.

The transgenic plant has a higher disease resistance than the recipient plant is embodied in any one of the following n 1) -n 4):

n 1) said recipient plant does not produce leaf blight, whereas said transgenic plant spontaneously produces leaf blight;

n 2) the recipient plant does not produce leaf spot, and the transgenic plant can spontaneously produce leaf spot and the site producing leaf spot can detect active oxygen;

n 3) after inoculation with a pathogen, the transgenic plant has a lesion length less than that of the recipient plant;

n 4) the expression level of the defense-related gene in the transgenic plant is higher than that of the recipient plant.

Further, the pathogenic bacteria are rice blast bacteria (such as rice blast bacteria race P007) or bacterial blight bacteria (such as rice bacterial blight bacterial strain PXO 99);

the defense related genes are genes PR1b and/or PR2 and/or PR3 and/or PR5 and/or PR8 and/or PR10.

In the method, the method for reducing the content and/or activity of the OsNBL3 protein in the receptor plant is to silence or inhibit the expression of the OsNBL3 protein coding gene in the receptor plant or knock out the OsNBL3 protein coding gene. The nucleotide sequence of the OsNBL3 protein coding gene is a sequence 1 in a sequence table.

Further, the silencing or inhibiting the expression of the gene encoding the OsNBL3 protein in the recipient plant is to reduce the expression level of the gene encoding the OsNBL3 protein in the recipient plant or to cause deletion mutation or insertion mutation or base substitution of the gene encoding the OsNBL3 protein in the recipient plant.

Further, the method for reducing the expression level of the gene encoding the OsNBL3 protein in the recipient plant is to introduce a vector interfering with the expression of the gene encoding the OsNBL3 protein into the recipient plant. In a specific embodiment of the invention, the vector for interfering the expression of the OsNBL3 protein coding gene is a vector obtained by inserting a DNA molecule containing a ubiquitin promoter and an OsNBL3-RNAi gene shown in a sequence 3 between Pme I and Mlu I cleavage sites of a pCAMBIA1301 vector.

The method for making the gene encoding the OsNBL3 protein in the receptor plant generate deletion mutation, insertion mutation or base substitution is to insert T-DNA into the genome of the receptor plant. In a specific embodiment of the present invention, the T-DNA insertion site is located 1322bp downstream from the OsNBL3 gene stop codon TGA.

The above-mentioned vectors which interfere with the expression of the encoding gene of the OsNBL3 protein also belong to the scope of the present invention.

In the above application or method, the recipient plant is a monocot or dicot; the monocot plant may be rice, maize, wheat, etc. In the present invention, the plant is a monocot plant, the monocot plant is rice, and the rice variety may specifically be Aizhi Xueh.

The invention utilizes a rice recessive leaf blight mutant nbl, uses SiteFinding-PCR technology to clone OsNBL3 gene and performs functional analysis. The T-DNA in the mutant nbl is inserted into the 3' UTR region of the OsNBL3 gene, so that the expression of the OsNBL3 is reduced, the leaf blight phenotype is shown, and the disease resistance of the rice blast fungus is enhanced compared with that of a wild type. Furthermore, the Ubiquitin promoter is utilized to drive the OsNBL3 gene to carry out RNA interference in wild rice, compared with the wild rice, the phenotype of the RNA interference plant is consistent with that of a mutant nbl, and the RNA interference of the OsNBL3 gene can increase the disease resistance of the OsNBL3 gene to rice blast, so that the method has application prospect in improving the plant yield. The invention provides a foundation for molecular breeding to improve crop yield or enhance plant disease resistance by using genetic engineering means, and has potential application value.

Drawings

FIG. 1 shows the growth phenotype of mutant nbl and Wild Type (WT) and the detection of leaf reactive oxygen species. Wherein, A is the phenotype under the greenhouse/field (Beijing) planting condition; b is the accumulation result of active oxygen around the detection type lesion by DAB staining. WT is wild type, nbl3 is mutant nbl3.

FIG. 2 shows the phenotype of mutant nbl3 and Wild Type (WT) inoculated with Pyricularia oryzae race P007. A is the morbidity result of scratch inoculation of a rice blast fungus minispecies P007; b is the lesion length measured after scratch inoculation of the rice blast fungus race P007 (data is average of 12 lesion lengths,: P <0.01, student's t test); c is the morbidity result of inoculating rice ralstonia solanacearum PXO 99; d is the plaque length measured after inoculation with rice ralstonia solanacearum PXO99 (data are averages of 5 plaque lengths, P <0.01, student's t-test).

FIG. 3 shows the results of the detection of the relative expression levels of 6 guard genes of mutant nbl and Wild Type (WT) using real-time quantitative PCR (P <0.01, student's t-test).

FIG. 4 shows the result of cloning of the rice OsNBL3 gene by SiteFinding-PCR. A is the insertion position of T-DNA in the OsNBL3 gene; b is the result of identifying the insertion site of the T-DNA by PCR; c is the result of detecting the relative expression amount of OsNBL3 gene in mutant nbl and Wild Type (WT) by real-time quantitative PCR (P <0.01, student's t-test).

FIG. 5 shows the subcellular localization results of OsNBL 3. Wherein A is the localization result of OsNBL3-GFP (3N-GFP) in tobacco epidermal cells; b is the localization result of OsNBL3-GFP (3N-GFP) in rice protoplasts.

FIG. 6 shows the acquisition and phenotypic analysis of the RNAi transgenic strain of the OsNBL3 gene. A is the detection of gene expression level of OsNBL3 in wild-type and OsNBL3 gene RNAi transgene lines by real-time quantitative PCR (P <0.01, student's t-test); b is the field phenotype of wild type, mutant nbl3 and OsNBL3 gene RNAi transgene strain.

Detailed Description

The following examples facilitate a better understanding of the present invention, but are not intended to limit the same. The experimental methods in the following examples are conventional methods unless otherwise specified. The test materials used in the examples described below, unless otherwise specified, were purchased from conventional biochemical reagent stores. The quantitative tests in the following examples were all set up in triplicate and the results averaged.

The Magnaporthe grisea P007 in the examples below is described in the literature "physiological Magnaporthe grisea and its toxicity", and is publicly available from the university of agriculture, and the biomaterial was used only for repeated experiments related to the present invention and was not used for other purposes.

The bacterial leaf blight strain PXO99 of rice in the following examples is described in the literature "identification and preliminary localization of novel genes against bacterial leaf blight in small grain wild rice", and is publicly available from the national university of agriculture, and the biological material is used only for repeated experiments related to the present invention and cannot be used for other purposes.

Example 1 obtaining Rice OsNBL3 protein and encoding Gene thereof

1. Rice leaf blight mutant nbl3 acquisition and phenotype identification

1. Rice leaf blight mutant nbl3 acquisition and phenotype identification

Mutant nbl3 was obtained by screening from the progeny of the T-DNA transformed rice variety Aizhi. Mutant nbl is shown in FIG. 1A as compared to the phenotype of wild type Aizhi Xueh. Under greenhouse conditions, the mutant nbl showed dwarfing plants and symptoms of leaf blight at the 14 th day of planting; in the field, the mutant nbl3 shows plant dwarfing and obvious leaf blight symptoms in the seedling stage at the 120 th day of planting. From the seedling stage, the mutant nbl3 exhibited leaf spot withering, which was mainly manifested by uneven yellowing of the leaf inside, and gradually spread out from the leaf inside to the leaf edge until the whole leaf died. In the whole tillering stage, the mutant nbl3 has certain leaf withering phenomenon except that the heart leaves are normal leaves, and in the heading stage, all leaves are withered to different degrees.

2. Blade active oxygen detection

The staining experiments were performed on mutant nbl3 and wild rice Aizhuchi leaf using 3' -Diaminobenzidine (DAB). For specific steps reference is made to the method in the literature "Qunen Liu, yuase Ning, YIngxin Zhang, ning Yu, chunde Zhao, xiaodeng Zhan, weixun Wu, daibo Chen, xiangajin Wei, guo-Liang Wang, shihua Cheng, liyong Cao,2017,OsCUL3a Negatively Regulates Cell Death and Immunity by Degrading OsNPR1 in Rice,Plant Cell,29 (2): 345-359, doi: 10.1105". The results are shown in FIG. 1B. The mutant nbl showed no visible active oxygen burst at the site of leaf spot production, whereas the wild type was not detected.

3. Inoculation test

(1) Mutant nbl and wild rice Aizhuhu leaf were sprayed and streaked ex vivo with Pyricularia oryzae race P007.

The results are shown in FIG. 2. The lesion length of mutant nbl3 was only 1/2 of that of the wild type 120 hours after the scratch inoculation, indicating that the resistance of mutant nbl3 to Pyricularia oryzae was significantly enhanced.

(2) Mutant nbl and wild rice Aizhikou leaf were inoculated with rice bacterial leaf blight strain PXO 99.

The results are shown in FIG. 2. After 2 weeks of inoculation, the plaque length of mutant nbl3 was significantly smaller than that of the wild type, indicating that the resistance of mutant nbl3 to bacterial blight bacteria was significantly enhanced.

4. Detection of expression level of defense gene

The expression of mutant nbl and wild rice Aizhihu defense-related genes PR1b, PR2, PR3, PR5, PR8 and PR10 was analyzed by fluorescent quantitative PCR, with rice ACTIN1 gene as an internal reference. The method comprises the following specific steps: the mutant nbl and wild rice known to have the same position are fully developed, the total RNA is extracted by a Trizol reagent method (Invitrogen), reverse transcription is performed by MMLV reverse transcriptase (TaKaRa) and a corresponding using method, then SYBR green I fluorescent dye is added into a PCR system by using a real-time fluorescent quantitative PCR technology according to the using method provided by a manufacturer (TaKaRa), and the expression of defense related genes PR1b, PR2, PR3, PR5, PR8 and PR10 is detected by a fluorescent quantitative PCR instrument (ABI 7500, USA), wherein the primer sequences are shown in the table 2. The experiment was repeated three times. The data processing adopts a compatible Ct method, namely, the Ct value is the number of cycles undergone by a fluorescent signal in a PCR tube reaching a set threshold value, and delta Ct=Ct (gene to be detected) -Ct (ACTIN 1) is calculated by 2 ^-ΔCt The value measures the gene transcription level, and the comparison analysis is carried out on the mutant nbl3 and the measured genes in the wild rice.

Table 2, primer sequences of ACTIN1 and defense genes

Gene name	Locus ID	Primer name	Sequence of uses
				ACTIN1	LOC_Os03g50885	qRT-OsRAc1-F	ATCACTGCCTTGGCTCCTA
		qRT-OsRAc1-R	CATCTGCTGGAATGTGCTG
				PR1b	LOC_Os07g03710	qRT-PR1b-F	TCGTATGCTATGCTACGTGTTT
		qRT-PR1b-R	CACTAAGCAAATACGGCTGACA
				PR2	LOC_Os01g71340	qRT-PR2-F	CTGGCATTGGTCCTTGGAGTT
		qRT-PR2-R	CGATGCCGTTGGACTTGTAG
				PR3	LOC_Os10g39680	qRT-PR3-F	CCTATTGCATGATCGTTCGAT
		qRT-PR3-R	GCCTGTAGCAGTTAAAGCAATTG
				PR5	LOC_Os12g43380	qRT-PR5-F	CCACGTGTGCAATTGTTTAATC
		qRT-PR5-R	ACTCGGACGCTTTCATTTGA
				PR8	LOC_Os10g28080	qRT-PR8-F	TTCATCTGGTCAGCGGATAGC
		qRT-PR8-R	TATCACGACCGTTCGATGGA
				PR10	LOC_Os12g36880	qRT-PR10-F	CCTGCCGAATACGCCTAAGA
		qRT-PR10-R	CTCAAACGCCACGAGAATTT

The results are shown in FIG. 3. The defense genes PR1b, PR2, PR3, PR5, PR8, PR10 in mutant nbl all exhibited significant up-regulated expression.

2. Cloning of OsNBL3 Gene Using SiteFinding-PCR technique

1. Acquisition of OsNBL3 Gene

The genetic analysis of the mutant nbl3 obtained in the first step shows that the leaf blight phenotype of the mutant is separated from the T-DNA insertion, and the mutant is a recessive mutant inserted at a single point. T-DNA flanking sequences were isolated using the SiteFinding-PCR technique. Analysis found that the T-DNA insertion site was on chromosome 03 (shown in FIG. 4A). PCR amplification (shown in FIG. 4B) is performed by designing a combination of primers JD-F (5'-GCATGTCTCAAGGTGGAACTGT-3'), JD-R (5'-TGTGCACAATCAACCTACTTCAT-3') and T-DNA boundary primers L3 (5'-GATGCCGACCGGATCTGTCGATC-3') and R3 (5'-CTGTTGCCGGTCTTGCGATGAT-3') on a genome, sequencing analysis finds that T-DNA is inserted into a 3' untranslated region of a gene, a T-DNA insertion site is located at 1322bp (FIG. 4A) downstream from a termination codon TGA of the gene, the gene is named as an OsNBL3 gene, an Open Reading Frame (ORF) of the OsNBL3 gene is shown as a sequence 1 in a sequence table, and an amino acid sequence of a protein (OsNBL 3 protein) coded by the gene is shown as a sequence 2 in the sequence table.

In contrast to wild rice Aizhi, mutant nbl was characterized in that only the 3' -untranslated region of the OsNBL3 gene in the wild rice Aizhi genome had a T-DNA insertion mutation, and the T-DNA insertion site was located 1322bp downstream from the OsNBL3 gene stop codon TGA.

2. OsNBL3 gene expression level detection

The fluorescent quantitative PCR method is used for analyzing the expression condition of the mutant nbl3 and the OsNBL3 gene of wild rice Aizhihu, the ACTIN1 gene is used as an internal reference, the primer sequences are shown in Table 2, and the detection method and the data processing are the same as those of step one 4. The primer sequences were as follows:

qRT-OsNBL3-F：5’-CTAAGGCAAACCTCGTCTTG-3’；

qRT-OsNBL3-R：5’-GAGTAAATCCTGCATCCTTTGAT-3’。

the results are shown in fig. 4C, which shows that: T-DNA insertion resulted in 10-fold down-regulated expression of the OsNBL3 gene in mutant nbl3.

Example 2 subcellular localization of OsNBL3 protein

1. GFP-NBL3-F (5' -ATA) was used by PCRgagctcATGGCGATCGC-3', underlined is SacI site) as forward primer with GFP-NBL3-R (5' -ATA)gtcgacGTAGGGCTCACAAT-3', underlined is the Sal I site) was used as a reverse primer to amplify the open reading frame partial sequence of the OsNBL3 gene, which contains a mitochondrial localization signal peptide of 100 amino acids in total, from the cDNA of the rice variety Aizhi Xue.

2. And (3) recovering the PCR product obtained in the step (1), then connecting the PCR product to a pMD-18T vector (TaKaRa), carrying out double enzyme digestion by using Sac I and Sal I after sequencing correctly, and connecting the enzyme digestion product to a plant subcellular localization expression vector pCG1301 (commonly known as Tiin biotechnology (Beijing) Co., ltd.) to obtain the recombinant expression vector pCG1301-OsNBL3-GFP containing the OsNBL3 gene. The structure of the recombinant expression vector pCG1301-OsNBL3-GFP is described as follows: a DNA molecule shown in the 1 st to 300 nd positions of the sequence 1 in the sequence table is inserted between the multiple cloning sites Sac I and Sal I of the pCG1301 vector. In the recombinant expression vector pCG1301-OsNBL3-GFP, the promoter driving the expression of the OsNBL3 gene is a 35S promoter.

3. The recombinant expression vector pCG1301-OsNBL3-GFP was transformed into tobacco mesophyll cells and rice protoplasts according to the method described in the literature "Li, X.,2011,Infiltration of Nicotiana benthamiana Protocol for Transient Expression via Agrobacterium.Bio-protocol Bio101:e95.DOI 10.21769/BioProtoc.95" and the literature "Wang, K., liu, Y.and Li, S.,2013,Bimolecular Fluorescence Complementation (BIFC) Protocol for Rice Protoplast transformation.Bio-protocol 3 (22): e979.DOI 10.21769/BioProtoc.979", respectively, and the localization of the OsNBL3 protein was observed under a laser confocal microscope.

The results are shown in FIG. 5, from which it can be seen that the OsNBL3 protein is localized on mitochondria in both tobacco mesophyll cells and rice protoplasts.

Example 3 acquisition and phenotypic characterization of OsNBL3 Gene RNA interference plants

The gene involved in this example is OsNBL3 gene of rice variety Aizhihu obtained in example 1, the nucleotide sequence of which is sequence 1 in the sequence table, and the gene encodes a protein (OsNBL 3) shown in sequence 2 in the sequence table. Sequence 1 consists of 1230 nucleotides and sequence 2 consists of 409 amino acids.

1. Obtaining of OsNBL3 gene RNA interference plant

1. Construction of recombinant expression vector pCAMBIA1301-Ubi-OsNBL3-RNAi

(1) By PCR method, primer 5' -ata is usedgagctcGTGCAGCGTGACCCGGT-3 '(Sac I site underlined) and 5' -ataggatccAAGTAACACCAAACAACAGGGT-3' (BamHI site in underlined) the ubiquitin promoter region was amplified using the binary vector pUbiGUSPlus (commonly known as Tine Biotechnology (Beijing) Co., ltd.) as template. The amplified product was recovered and ligated to pMD18-T simple (TaKaRa) vector and verified by sequencing. The plasmid with correct sequencing verification is digested with SacI and BamHI, and the digested product is recovered and then connected to pCAMBISac I and BamHI double cleavage sites of A1301 vector (commonly used in the Biotechnology of Trestin (Beijing) Co., ltd.) gave pCAMBIA1301-Ubi.

(2) RNAi-NBL3-F1 (5' -GGCC) using primersttaattaaTGAGTGAGACACCCTTC-3', underlined is Pac I site) and RNAi-NBL3-R1 (5' -ATA)acgcgtCCATCGCTTACAAGTTCC-3' the underlined part is Mlu I site), the sequence of the OsNBL3 gene (designated OsNBL 3) was amplified from the DNA of the rice variety Aizhi Xue _{Forward sequence} ). The PCR product is recovered and then is connected into a pMD-18T vector (TaKaRa), after the sequencing is correct, pac I and Mlu I are used for double digestion, and the digested product is RNAi-NBL3-1.

RNAi-NBL3-F2 (5' -GGCC) using primersttaattaaTGGAATGGAAGCTAGAG-3', underlined is Pac I site) and RNAi-NBL3-R2 (5' -ATC)gtttaaacCCATCGCTTACAAGTTCC-3' the underlined site is Pme I), the sequence of the OsNBL3 gene (designated OsNBL 3) was amplified from the DNA of the rice variety Aizhi Xueu _{Reverse sequence} ). The PCR product is recovered and then is connected into a pMD-18T vector (TaKaRa), after the sequencing is correct, pac I and Pme I are utilized for double digestion, and the digested product is RNAi-NBL3-2.

(3) And (3) connecting the enzyme digestion products RNAi-NBL3-1 and RNAi-NBL3-2 into the plant expression vector pCAMBIA1301-Ubi in the step (1), thus obtaining the recombinant expression vector pCAMBIA1301-Ubi-OsNBL3-RNAi containing the OsNBL3-RNAi gene.

The recombinant expression vector pCAMBIA1301-Ubi-OsNBL3-RNAi is a vector obtained by inserting a DNA molecule containing a ubiquitin promoter and an OsNBL3-RNAi gene shown in a sequence 3 between Pme I and Mlu I cleavage sites of the pCAMBIA1301 vector. Wherein, the 7 th to 1987 th of the sequence 3 is a ubiquitin promoter and the 2569 th to 3514 th is OsNBL3 _{Forward sequence} The 2002-2560 th bit is OsNBL3 _{Reverse sequence} . In the recombinant expression vector pCAMBIA1301-Ubi-OsNBL3-RNAi, the promoter driving the expression of the OsNBL3-RNAi gene is a ubiquitin promoter.

2. Obtaining of OsNBL3 gene RNA interference rice

The recombinant expression vector pCAMBIA1301-Ubi-OsNBL3-RNAi constructed in the step 1 is introduced into embryogenic callus of rice variety Aizhi Xue (Oryza sativa L.cv.Aichi asahi) through agrobacterium EHA105 (commonly known as Tine Biotechnology (Beijing Co., ltd.), so as to obtain T0 generation OsNBL3 gene RNA interference rice. Specific transformation methods are described in the literature "Yi Zili, cao Shouyun, wang Li, stock, li Xiang, he Sijie, tangshun, zhou Piaohua, tian Wenzhong, studies to increase the frequency of agrobacterium transformation into rice, genetics journal, 2001, 28 (4): 352-358'.

3. Identification of OsNBL3 gene RNA interference rice

(1) Preliminary PCR identification

Extracting genome DNA from the T0 generation OsNBL3 gene RNA interference rice obtained in the step 2, detecting a neomycin phosphotransferase gene (HPTII) fragment in the T0 generation OsNBL3 gene RNA interference rice by using primers 5'-GCTGCGCCGATGGTTTCTACAA-3' and 5'-CACGGCCTCCAGAAGAAGATGTTG-3', wherein the fragment with 514bp of PCR amplification product is a positive plant. Through the PCR identification, the 3 positive T0 generation OsNBL3 gene RNA interference rice lines are respectively marked as T0 generation transgenic OsNBL3 rice lines RNAi-4, RNAi-7 and RNAi-9.

(2) Analysis of transcription level (RNA expression level)

Fluorescent quantitative PCR analysis was performed using the T0 generation transgenic OsNBL3 rice lines RNAi-4, RNAi-7, RNAi-9 and wild rice Aizhuchi as materials, and the ACTIN1 gene as an internal reference, and amplification primers were shown in Table 2. The detection method and data processing are the same as in step 4 of example 1.

The real-time fluorescent quantitative PCR detection results of the OsNBL3 gene in each test material are shown in FIG. 6A. As can be seen from the figures: compared with non-transgenic wild rice Aizhu, the transcription level of OsNBL3 genes in T0 generation transgenic OsNBL3 rice lines RNAi-4, RNAi-7 and RNAi-9 is obviously reduced.

2. OsNBL3 gene RNA interference rice leaf spot phenotype identification

And (3) taking the T0 generation transformed OsNBL3 rice strains RNAi-4, RNAi-7, RNAi-9 and wild rice Aizhu obtained in the step one as test materials, planting in a greenhouse according to a conventional method, and observing the four-leaf one-heart phenotype of each material under normal sunlight conditions (12 hours of sunlight).

As a result, as shown in FIG. 6B, T0-transformed OsNBL3 rice lines RNAi-4, RNAi-7, RNAi-9 and mutant nbl3 all spontaneously produced leaf blight to different degrees, whereas non-transgenic wild type rice Aizhihu did not produce leaf blight. And the severity of leaf spot generated by transforming the rice strain of OsNBL3 in the T0 generation with RNAi-4, RNAi-7 and RNAi-9 is inversely related to the expression level of the gene of OsNBL 3. This result further demonstrates that RNA interference with the OsNBL3 gene can result in leaf spot and increase disease resistance in rice.

The foregoing is merely a preferred embodiment of the present invention, and it should be noted that it will be apparent to those skilled in the art that several modifications and variations can be made without departing from the technical principle of the present invention, and these modifications and variations should also be regarded as the scope of the invention.

Sequence listing

<110> Chinese university of agriculture

<120> Rice mitochondrial protein OsNBL3 related to plant disease resistance, and coding gene and application thereof

<160> 3

<170> PatentIn version 3.5

<210> 1

<211> 1230

<212> DNA

<213> Artificial Sequence

<400> 1

atggcgatcg ccgccgcgcg ccggcggctg tggcgcgggc tgacgactgc ggccgccgcc 60

tccgtagggg tggaagcgga caccagcgcc ttgctcgcgc gccttgtcgc cgagcctgag 120

taccgcgtga aggcgacgat ggaggaggcg agcggcggct cctccgcggc ggccgccttc 180

tgggagcccc tcgccgccgc cctcctccgc gcgtcgtccc cgactaaggc aaacctcgtc 240

ttggaatgga agctagagaa gctaatcaag gaagggatcc gtgattgtga gccctactca 300

gtgataatcc gtttctgccg agagacaaag aatgcagaat ttgcaatgaa agtctttgaa 360

ttcgtggagg agcttggaat tcagctgaac actggcattt tcaatgccct tatcaatgct 420

ttcttgtcgg taggagatct ccttgctgca atgaccttat atgaggctat ggaagacata 480

gaggattgca agcccaactc cgctacatat gatgcattca tttctgcatt ttcacggctt 540

gggagtggcc atgcaatgat gagctggtac ctggcatcaa aggatgcagg atttactcct 600

agcattaagg cctttgaata tttgatcaca ggttttgtga agttggacag gctagatgat 660

gctgaagtgg tatttgaaga aatgatttgc tttgaaatta agccaaactt tgctatactg 720

gaggccaagc ttgagctgct ttcaagaagg aaagacccta acagggtaaa agtatttttg 780

gaacttgtaa gcgatgggaa tcaagagttg agtgaagcta cagttgagag gttaacaaga 840

ttatgcctgt acgaagacaa aattggtgaa ctggaccagt tactttccct agtacaaggc 900

atgcacacga gttctttaac taagctgcac tgtggaatta tcagattcta tgctaatgct 960

gatcgcttgt ctgatatgga gcatgcaatt ttccagatgt tggataatgg catggttttt 1020

gcccactcag aggatgttga ggctgttatc tgttcttatt ttcgtcacaa ggactttgat 1080

aggttggatc tattcttaaa ccgaatacgg agtttgtaca agctcacccg gtctacttat 1140

gatatattga tttctggata tcagaggttg aatttacacg gaaggctcga cttggccata 1200

aaagatatga gggaagctgg gtttgcatga 1230

<210> 2

<211> 409

<212> PRT

<213> Artificial Sequence

<400> 2

Met Ala Ile Ala Ala Ala Arg Arg Arg Leu Trp Arg Gly Leu Thr Thr

1 5 10 15

Ala Ala Ala Ala Ser Val Gly Val Glu Ala Asp Thr Ser Ala Leu Leu

20 25 30

Ala Arg Leu Val Ala Glu Pro Glu Tyr Arg Val Lys Ala Thr Met Glu

35 40 45

Glu Ala Ser Gly Gly Ser Ser Ala Ala Ala Ala Phe Trp Glu Pro Leu

50 55 60

Ala Ala Ala Leu Leu Arg Ala Ser Ser Pro Thr Lys Ala Asn Leu Val

65 70 75 80

Leu Glu Trp Lys Leu Glu Lys Leu Ile Lys Glu Gly Ile Arg Asp Cys

85 90 95

Glu Pro Tyr Ser Val Ile Ile Arg Phe Cys Arg Glu Thr Lys Asn Ala

100 105 110

Glu Phe Ala Met Lys Val Phe Glu Phe Val Glu Glu Leu Gly Ile Gln

115 120 125

Leu Asn Thr Gly Ile Phe Asn Ala Leu Ile Asn Ala Phe Leu Ser Val

130 135 140

Gly Asp Leu Leu Ala Ala Met Thr Leu Tyr Glu Ala Met Glu Asp Ile

145 150 155 160

Glu Asp Cys Lys Pro Asn Ser Ala Thr Tyr Asp Ala Phe Ile Ser Ala

165 170 175

Phe Ser Arg Leu Gly Ser Gly His Ala Met Met Ser Trp Tyr Leu Ala

180 185 190

Ser Lys Asp Ala Gly Phe Thr Pro Ser Ile Lys Ala Phe Glu Tyr Leu

195 200 205

Ile Thr Gly Phe Val Lys Leu Asp Arg Leu Asp Asp Ala Glu Val Val

210 215 220

Phe Glu Glu Met Ile Cys Phe Glu Ile Lys Pro Asn Phe Ala Ile Leu

225 230 235 240

Glu Ala Lys Leu Glu Leu Leu Ser Arg Arg Lys Asp Pro Asn Arg Val

245 250 255

Lys Val Phe Leu Glu Leu Val Ser Asp Gly Asn Gln Glu Leu Ser Glu

260 265 270

Ala Thr Val Glu Arg Leu Thr Arg Leu Cys Leu Tyr Glu Asp Lys Ile

275 280 285

Gly Glu Leu Asp Gln Leu Leu Ser Leu Val Gln Gly Met His Thr Ser

290 295 300

Ser Leu Thr Lys Leu His Cys Gly Ile Ile Arg Phe Tyr Ala Asn Ala

305 310 315 320

Asp Arg Leu Ser Asp Met Glu His Ala Ile Phe Gln Met Leu Asp Asn

325 330 335

Gly Met Val Phe Ala His Ser Glu Asp Val Glu Ala Val Ile Cys Ser

340 345 350

Tyr Phe Arg His Lys Asp Phe Asp Arg Leu Asp Leu Phe Leu Asn Arg

355 360 365

Ile Arg Ser Leu Tyr Lys Leu Thr Arg Ser Thr Tyr Asp Ile Leu Ile

370 375 380

Ser Gly Tyr Gln Arg Leu Asn Leu His Gly Arg Leu Asp Leu Ala Ile

385 390 395 400

Lys Asp Met Arg Glu Ala Gly Phe Ala

405

<210> 3

<211> 3520

<212> DNA

<213> Artificial Sequence

<400> 3

gagctcgtgc agcgtgaccc ggtcgtgccc ctctctagag ataatgagca ttgcatgtct 60

aagttataaa aaattaccac atattttttt tgtcacactt gtttgaagtg cagtttatct 120

atctttatac atatatttaa actttactct acgaataata taatctatag tactacaata 180

atatcagtgt tttagagaat catataaatg aacagttaga catggtctaa aggacaattg 240

agtattttga caacaggact ctacagtttt atctttttag tgtgcatgtg ttctcctttt 300

tttttgcaaa tagcttcacc tatataatac ttcatccatt ttattagtac atccatttag 360

ggtttagggt taatggtttt tatagactaa tttttttagt acatctattt tattctattt 420

tagcctctaa attaagaaaa ctaaaactct attttagttt ttttatttaa taatttagat 480

ataaaataga ataaaataaa gtgactaaaa attaaacaaa taccctttaa gaaattaaaa 540

aaactaagga aacatttttc ttgtttcgag tagataatgc cagcctgtta aacgccgtcg 600

acgagtctaa cggacaccaa ccagcgaacc agcagcgtcg cgtcgggcca agcgaagcag 660

acggcacggc atctctgtcg ctgcctctgg acccctctcg agagttccgc tccaccgttg 720

gacttgctcc gctgtcggca tccagaaatt gcgtggcgga gcggcagacg tgagccggca 780

cggcaggcgg cctcctcctc ctctcacggc acggcagcta cgggggattc ctttcccacc 840

gctccttcgc tttcccttcc tcgcccgccg taataaatag acaccccctc cacaccctct 900

ttccccaacc tcgtgttgtt cggagcgcac acacacacaa ccagatctcc cccaaatcca 960

cccgtcggca cctccgcttc aaggtacgcc gctcgtcctc cccccccccc cctctctacc 1020

ttctctagat cggcgttccg gtccatggtt agggcccggt agttctactt ctgttcatgt 1080

ttgtgttaga tccgtgtttg tgttagatcc gtgctgctag cgttcgtaca cggatgcgac 1140

ctgtacgtca gacacgttct gattgctaac ttgccagtgt ttctctttgg ggaatcctgg 1200

gatggctcta gccgttccgc agacgggatc gatttcatga ttttttttgt ttcgttgcat 1260

agggtttggt ttgccctttt cctttatttc aatatatgcc gtgcacttgt ttgtcgggtc 1320

atcttttcat gctttttttt gtcttggttg tgatgatgtg gtctggttgg gcggtcgttc 1380

tagatcggag tagaattctg tttcaaacta cctggtggat ttattaattt tggatctgta 1440

tgtgtgtgcc atacatattc atagttacga attgaagatg atggatggaa atatcgatct 1500

aggataggta tacatgttga tgcgggtttt actgatgcat atacagagat gctttttgtt 1560

cgcttggttg tgatgatgtg gtgtggttgg gcggtcgttc attcgttcta gatcggagta 1620

gaatactgtt tcaaactacc tggtgtattt attaattttg gaactgtatg tgtgtgtcat 1680

acatcttcat agttacgagt ttaagatgga tggaaatatc gatctaggat aggtatacat 1740

gttgatgtgg gttttactga tgcatataca tgatggcata tgcagcatct attcatatgc 1800

tctaaccttg agtacctatc tattataata aacaagtatg ttttataatt attttgatct 1860

tgatatactt ggatgatggc atatgcagca gctatatgtg gattttttta gccctgcctt 1920

catacgctat ttatttgctt ggtactgttt cttttgtcga tgctcaccct gttgtttggt 1980

gttacttgga tccgtttaaa cccatcgctt acaagttcca aaaatacttt taccctgtta 2040

gggtctttcc ttcttgaaag cagctcaagc ttggcctcca gtatagcaaa gtttggctta 2100

atttcaaagc aaatcatttc ttcaaatacc acttcagcat catctagcct gtccaacttc 2160

acaaaacctg tgatcaaata ttcaaaggcc ttaatgctag gagtaaatcc tgcatccttt 2220

gatgccaggt accagctcat cattgcatgg ccactcccaa gccgtgaaaa tgcagaaatg 2280

aatgcatcat atgtagcgga gttgggcttg caatcctcta tgtcttccat agcctcatat 2340

aaggtcattg cagcaaggag atctcctacc gacaagaaag cattgataag ggcattgaaa 2400

atgccagtgt tcagctgaat tccaagctcc tccacgaatt caaagacttt cattgcaaat 2460

tctgcattct ttgtctctcg gcagaaacgg attatcactg agtagggctc acaatcacgg 2520

atcccttcct tgattagctt ctctagcttc cattccaaga ttaattaatg agtgagacac 2580

ccttcttctc cccgcttaac tgtcagttga gctgttgttt tgtttagtta gtatcagcgt 2640

tatggcgcag agaaatttcc ccctttctcg tatactaggt cgggttcaga tctgcgatgc 2700

atttggcggt accatgattt agcttataga gtggagtaga actattggat cgcgagcttg 2760

cggtgcatga ttatataatg caaagagcta agctattgat agcctgatgc cctgatatga 2820

ttctgttgga gtgagtacat tggtgctgat tctgttgtag tcttcatgac gattttaccg 2880

aattatacat gtttgtgcat tctagtgaga gatctttgta attgcgtgct aagatagaat 2940

caacattgat tcaggtcttg gaatggaagc tagagaagct aatcaaggaa gggatccgtg 3000

attgtgagcc ctactcagtg ataatccgtt tctgccgaga gacaaagaat gcagaatttg 3060

caatgaaagt ctttgaattc gtggaggagc ttggaattca gctgaacact ggcattttca 3120

atgcccttat caatgctttc ttgtcggtag gagatctcct tgctgcaatg accttatatg 3180

aggctatgga agacatagag gattgcaagc ccaactccgc tacatatgat gcattcattt 3240

ctgcattttc acggcttggg agtggccatg caatgatgag ctggtacctg gcatcaaagg 3300

atgcaggatt tactcctagc attaaggcct ttgaatattt gatcacaggt tttgtgaagt 3360

tggacaggct agatgatgct gaagtggtat ttgaagaaat gatttgcttt gaaattaagc 3420

caaactttgc tatactggag gccaagcttg agctgctttc aagaaggaaa gaccctaaca 3480

gggtaaaagt atttttggaa cttgtaagcg atggacgcgt 3520

Claims (9)

1. Application of OsNBL3 protein in regulating plant disease resistance; the regulation and control of plant disease resistance is shown in the following steps: when the OsNBL3 protein content and/or activity in a plant is reduced or the expression level of the OsNBL3 gene is reduced, the disease resistance of the plant is improved;

   the OsNBL3 protein is a protein shown in any one of the following A1) or A2):

   a1 Protein composed of amino acid sequences shown in sequence 2 in a sequence table;

   a2 A fusion protein obtained by connecting a label with the N end or/and the C end of the protein shown in the sequence 2 in the sequence table;

   the plant is rice.
2. 2. Use of biological material related to OsNBL3 protein for modulating plant disease resistance: the regulation and control of plant disease resistance is shown in the following steps: when the OsNBL3 protein content and/or activity in a plant is reduced or the expression level of the OsNBL3 gene is reduced, the disease resistance of the plant is improved;

   the biological material related to the OsNBL3 protein is any one of the following B1) to B8):

   b1 Nucleic acid molecules encoding OsNBL3 proteins;

   b2 An expression cassette comprising the nucleic acid molecule of B1);

   b3 A recombinant vector comprising the nucleic acid molecule of B1);

   b4 A recombinant vector comprising the expression cassette of B2);

   b5 A recombinant microorganism comprising the nucleic acid molecule of B1);

   b6 A recombinant microorganism comprising the expression cassette of B2);

   b7 A recombinant microorganism containing the recombinant vector of B3);

   b8 A recombinant microorganism comprising the recombinant vector of B4);

   the plant is rice.
3. 3. The use according to claim 2, characterized in that: b1 The nucleic acid molecule is a DNA molecule shown in a sequence 1.
4. 4. A use according to any one of claims 1-3, characterized in that: the disease resistance is rice blast resistance and/or rice bacterial leaf blight resistance.
5. 5. A method of growing a transgenic plant having increased disease resistance comprising the step of reducing the level and/or activity of an OsNBL3 protein according to claim 1 in a recipient plant to obtain a transgenic plant; the transgenic plant has a disease resistance greater than the recipient plant; the plant is rice.
6. 6. The method according to claim 5, wherein: the disease resistance is rice blast resistance and/or rice bacterial leaf blight resistance.
7. 7. The method according to claim 5 or 6, characterized in that: the method for reducing the content and/or activity of the OsNBL3 protein in the receptor plant is to silence or inhibit the expression of the OsNBL3 protein coding gene in the receptor plant or knock out the OsNBL3 protein coding gene.
8. 8. The method according to claim 7, wherein: the silencing or inhibiting the expression of the OsNBL3 protein coding gene in the receptor plant is to reduce the expression level of the OsNBL3 protein coding gene in the receptor plant or make the OsNBL3 protein coding gene in the receptor plant undergo deletion mutation or insertion mutation or base substitution.
9. 9. The method according to claim 8, wherein: the method for reducing the expression level of the OsNBL3 protein coding gene in the recipient plant is to introduce a vector interfering with the expression of the OsNBL3 protein coding gene into the recipient plant.

Images