CN113913446A

CN113913446A - Bifunctional vector, preparation method and application thereof

Info

Publication number: CN113913446A
Application number: CN202110771513.2A
Authority: CN
Inventors: 李应宇; 汪琼; 王磊; 殷刘松; 邱奕凯
Original assignee: Nanjing Vigorous Biotechnology Co ltd
Current assignee: Nanjing Vigorous Biotechnology Co ltd
Priority date: 2020-07-08
Filing date: 2021-07-08
Publication date: 2022-01-11

Abstract

The invention belongs to the field of bioengineering, and particularly relates to a bifunctional vector and a preparation method and application thereof. The vector comprises the basic elements of a phagemid vector and is characterized in that the vector also comprises a polynucleotide sequence for encoding an expression antibody, a SASA tag protein gene sequence and an amber stop codon, wherein the polynucleotide sequence for encoding the expression antibody and the SASA tag protein gene sequence are upstream of the amber stop codon. The carrier disclosed by the invention can realize dual-function switching, additional tag protein is added, the accuracy in subsequent screening detection is improved, more possibilities are provided for subsequent screening detection, and the detection efficiency can be greatly improved.

Description

Bifunctional vector, preparation method and application thereof

Technical Field

The invention relates to the field of antibodies, in particular to a bifunctional phage display vector, which can be used for performing phage display of an antibody in the presence of a helper phage and expressing a soluble antibody under the induction of an inducer.

Background

With the continuous development of phage display technology, methods and techniques for antibody screening using phage display technology are becoming mature. At present, there are many phage display vectors in the industry, wherein one of the commonly used phage display vectors is a display system based on phage coat protein pIII, the technical principle of the system is that target antibody fragments or peptides are expressed by fusion with phage pIII protein, phage assembly and infection are assisted by adding helper phage to realize display of the target antibody fragments or peptides, generally speaking, screening verification is performed after 1-3 rounds of panning, and identification of screened antibodies is further completed by sequencing. The suitability and sensitivity of the secondary antibody is of crucial importance when performing 1-3 rounds of post-panning ELISA or flow cytometric screening validation. At present, a specific secondary antibody (anti-M13-HRP) aiming at the phage is generally adopted for carrying out screening verification, and the possibility of false positive, namely high background signal exists when the secondary antibody is used, because the screened phage display antibody can be non-specifically combined with target protein, cell or enzyme label plate^[1-2]The target detected by anti-M13-HRP is phage, so there may be cases where the background is high. In order to further verify the accuracy of the positive clone, the antibody sequence obtained by screening needs to be solubleSexual expression verification, and the process needs to spend extra time for plasmid construction and expression of soluble antibody, and the experimental period is longer^[3-4]. In addition, the lack or singleness of the tag protein on the current phage display vector also greatly limits the adoption of subsequent verification methods, such as non-specific binding of a specific tag protein which may occur, and further influences the antibody screening efficiency, so that the problems are to be researched and improved.

Disclosure of Invention

Aiming at the problems of the existing phage display technology, the invention integrates the functions of antibody phage display and antibody solubility induced expression by optimizing the vector, thereby better solving the problem of false positive.

In one aspect, the present invention provides an expression vector comprising the essential elements of a phagemid vector, wherein the vector further comprises a polynucleotide sequence encoding an expression antibody, a gene sequence of a SASA tag protein, and an amber stop codon, and the polynucleotide sequence encoding the expression antibody and the gene sequence of the SASA tag protein are upstream of the amber stop codon.

In some embodiments, the SASA tag protein comprises the amino acid sequence set forth in SEQ ID NO. 1, or a sequence that is at least 80% identical to the amino acid sequence set forth in SEQ ID NO. 1. In some embodiments, the SASA tag protein comprises a sequence that is at least 80%, at least 83%, at least 85%, at least 87%, at least 89%, at least 91%, at least 93%, at least 95%, at least 97%, or at least 99% identical to the amino acid sequence set forth in SEQ ID NO. 1.

In other embodiments, the SASA tag protein comprises the amino acid sequence set forth in SEQ ID NO 1. In a specific embodiment, the amino acids of the SASA tag protein have the sequence shown in SEQ ID NO. 1.

In some embodiments, the amber stop codonAlso included downstream is a polynucleotide sequence encoding a peptide linker. In some embodiments, the peptide linker is selected from the group consisting of (EAAAK)_n、(Gly)_6-8、(AP)₇Or a GS linker, preferably a GS linker.

In other specific embodiments, the peptide linker is a GS linker, which is (G)₄S)₃Or GGGGSGGGS.

In one embodiment, the peptide linker is (G)₄S)₃。

In other embodiments, the amber stop codon further comprises upstream of the amber stop codon a polynucleotide sequence encoding another suitable detection tag. In some embodiments, the other suitable detection tag is selected from one or more of a c-Myc tag, a Flag tag, an HA tag, a V5 tag, a His tag and an HSV tag, preferably a c-Myc tag. In other specific embodiments, the other suitable detection tag is selected from one or more of a c-Myc tag, a Flag tag, and a His tag. In a specific embodiment, the other suitable detection tag is a c-Myc tag.

In some embodiments, the polynucleotide sequence encoding the other suitable detection tag is located downstream of the polynucleotide sequence expressing the antibody.

In other embodiments, the c-Myc tag comprises the amino acid sequence set forth in SEQ ID NO 2. In a specific embodiment, the amino acid sequence of the c-Myc tag is shown in SEQ ID NO 2.

In some embodiments, the expression antibody is selected from an sdAb (single domain antibody), a Fab (antigen binding fragment), or an scFv (single chain variable region), preferably an sdAb. The expression antibody of the present invention refers to an antibody specifically binding to a target protein, i.e., an antibody displayed or expressed in the present invention. In some embodiments, the expression antibody is selected from an sdAb, or a Fab. In a specific embodiment, the expressed antibody is an sdAb.

In other embodiments, the carrier comprises an inducible operon, preferably a lactose operon. The inducible operon of the present invention may be selected from the lactose operon or the galactose operon. In a specific embodiment, the carrier comprises a lactose operon.

In some embodiments, the vector comprises a phage pIII protein gene.

In other embodiments, the vector can function as both a phage display vector and a vector for expression of soluble antibodies. In some embodiments, after the vector is used to construct a phage library, helper phage are added, which can be used for phage display of antibodies. Wherein the helper phage is selected from M13KO7, VSCM13 or Hyperphage M13K 07 delta pIII, preferably M13KO 7. In a specific embodiment, the helper phage is M13KO 7. In other embodiments, the vectors are used to construct phage libraries, followed by the addition of an inducing agent capable of inducing soluble expression of the antibody. In a specific embodiment, the inducer is IPTG.

In another aspect, the present invention provides a method for constructing a phage display library, comprising the following steps:

(1) extracting RNA of peripheral blood lymph B cell of target protein immune animal, reverse transcribing to obtain cDNA, amplifying, and enzyme cutting to connect to the carrier;

(2) transfecting the vector obtained in the step (1) into a competent host bacterium, and culturing the transfected host bacterium to obtain a phage library bacterium liquid;

(3) adding helper phage, culturing and purifying to obtain phage display library.

In some embodiments, step (1) comprises cleaving the amplified DNA fragment and the vector with the same enzyme, the DNA fragment being present in a ratio of 1: 2-1: 10 mass ratio hybrid junction. In some embodiments, the digested DNA fragment is ligated to the vector in a ratio of 1: 2. 1: 3. 1: 4. 1: 5. 1: 6. 1: 7. 1: 8. 1: 9 or 1: 10 mass ratio hybrid junction. In a specific embodiment, the digested DNA fragment is ligated to the vector in a ratio of 1: 3 are mixed and connected.

In other embodiments, the competent host bacterium in step (2) is E.coli. In one embodiment, the escherichia coli is TG 1.

In some embodiments, the helper phage in step (3) is selected from M13KO7, VSCM13 or hyperthermage M13K 07 Δ pIII, preferably M13KO 7. In a specific embodiment, the helper phage of step (3) is M13KO 7.

In some embodiments, the construction method further comprises panning and screening the phage display library. Panning of the phage library in the present invention includes: a. blocking the phage with a blocking agent, incubating with a target protein, washing, eluting the elutriated phage with TEA buffer solution, and neutralizing with Tirs-HCl; b. adding the obtained phage into host bacteria, and infecting for 30-60 min; c. after being diluted, the bacterial liquid is screened by a culture medium containing resistance. Preferably, panning of the phage library comprises: a. sealing the phage with skim milk powder at room temperature for 1 hour, incubating with target protein at room temperature for 1 hour, washing, eluting the elutriated phage with TEA buffer solution, and neutralizing with Tirs-HCl; b. adding the obtained phage into Escherichia coli, and infecting for 45 min; c. after being diluted, the bacterial liquid is screened by a culture medium containing resistance. Screening of phage libraries in the present invention can include: a. performing plate culture on the elutriated phage bacterium liquid, selecting a monoclonal colony, and culturing; b. adding auxiliary phage into the cultured bacterial liquid, standing and infecting for 30-60 min, and culturing overnight to perform phage display. Preferably, the screening of the phage library may comprise: a. performing plate culture on the elutriated phage bacterium liquid, selecting a monoclonal colony, and culturing for 5 hours at 37 ℃; b. adding helper phage M13KO7 into the cultured bacterial liquid, standing and infecting for 45min at 37 ℃, and culturing overnight at 30 ℃ for phage display. Screening of the phage library of the present invention may also include: a. performing plate culture on the elutriated phage bacterium liquid, selecting a monoclonal colony, and culturing; b. IPTG inducer is added into the cultured bacterial liquid, and the bacterial liquid is cultured overnight at 30 ℃ for induction expression.

In yet another aspect, the present invention provides a method of expressing a soluble antibody comprising the steps of:

(3) after culturing for a period of time, adding an inducer for induction expression to obtain the antibody with soluble expression.

In some embodiments, the inducing agent in step (3) is IPTG. In a specific embodiment, the step (3) comprises culturing the phage library bacterial liquid obtained in the step (2) at 37 ℃ for 0.5-1.5 hours, adding IPTG inducer, and culturing overnight at 30 ℃ for induction expression.

In yet another aspect, the invention provides the use of the vector described above in the construction, panning or/and screening of phage display libraries.

The screening of the phage library in the invention comprises that after the auxiliary phage is added into the bacterial liquid containing the vector for antibody display, the screening of the antibody can be carried out by adopting the following two different modes:

performing ELISA screening on Anti-c-Myc-HRP or Anti-M13-HRP secondary antibody, specifically, after enrichment panning, selecting monoclonal antibody for ELISA screening, coating target protein (antigen) in a 96-well plate, adding antibody supernatant, adding specific Anti-c-Myc-HRP or Anti-phage Anti-M13-HRP secondary antibody, and performing ELISA reading detection; or

b. FACS screening is carried out by adopting Anti-c-Myc-FITC or Anti-fd-biotin (fd refers to a phage binding region) and SA-Alexa Fluor647(SA refers to streptavidin) secondary antibody, specifically, after cell enrichment panning, cells are paved on a 96-well plate, antibody supernatant is added, and then secondary antibody (Anti-c-Myc-FITC or Anti-fd-biotin) with fluorescent markers and SA-Alexa Fluor647 are added for FACS detection.

The invention also provides the application of the vector in expression, antibody screening or/and antibody property detection.

In the screening of the antibody, after IPTG is added into a bacterial liquid containing the vector to induce the expression of the antibody, the antibody can be screened in the following three different modes:

a. performing ELISA screening by using Anti-c-Myc-HRP or Anti-BSA-HRP secondary antibody, specifically, adding IPTG (isopropyl beta-thiogalactoside) induced antibody supernatant by using coating target protein (antigen), adding specific Anti-c-Myc-HRP or Anti-BSA-HRP secondary antibody specifically combined with SASA (SASA) label for ELISA screening, and performing ELISA reading detection;

b. performing FACS screening by using Anti-c-Myc-FITC or Anti-BSA-FITC secondary antibody, specifically, paving cells on a 96-well plate, adding IPTG induced expression antibody supernatant, and adding a secondary antibody (Anti-c-Myc-FITC or Anti-BSA-FITC) with a fluorescent marker for FACS detection;

c. applying SPR technology and adopting a Chip-BSA Chip to carry out affinity sequencing screening, specifically adopting Chip-BSA, adding IPTG induced expression antibody supernatant, then adding target protein (antigen) in a flowing manner, and then carrying out Biacore detection.

The invention also provides a host bacterium containing the vector. The host bacterium containing the vector of the present invention may be a eukaryotic bacterium or a prokaryotic bacterium. In some embodiments, the host bacterium comprising the above-described vector is escherichia coli. In a specific embodiment, the host bacterium comprising the above vector is TG 1.

Compared with the original vector, the optimized vector is mainly added with elements such as SASA label, c-Myc label, amber and the like. The increase of the Amber element can realize the soluble induced expression of IPTG, so that the purposes of phage display and soluble expression on the same carrier are achieved, the increase of the c-Myc label protein can well avoid false positive caused by anti-M13-HRP detection, and the screening detection is carried out more specifically. The addition of the SASA tag protein can achieve the effects of screening detection and expression quantity identification. The addition of more tag proteins can realize more flexible and various strategies for screening and verifying the antibody.

The invention integrates the functions of phage display and soluble expression, and realizes the switching of double functions by different methods. The additional tag protein is added, the accuracy in subsequent screening detection is improved, more possibilities are provided for subsequent screening detection, and therefore the detection efficiency can be greatly improved. When the soluble expression induction is carried out, the expression level of the antibody in the soluble expression supernatant can be evaluated through the specific binding of the SASA tag protein and BSA, in addition, the affinity between the antibody and the antigen in the supernatant can be evaluated by adopting a BSA specific chip, and the antibody screening based on the affinity is greatly improved without expression and purification.

Interpretation of terms

As used herein, "vector" refers to a nucleic acid molecule capable of transporting another nucleic acid sequence (or nucleic acid sequences) to which it has been linked into a host cell or genome. One type of vector is a "plasmid," which refers to a circular DNA loop, usually double-stranded, into which additional DNA segments can be ligated. Another type of vector is a viral vector, wherein additional DNA segments can be ligated into the viral genome. Certain vectors are capable of autonomous replication in a host cell into which they are introduced (e.g., bacterial vectors having a bacterial origin of replication). In addition, certain vectors are capable of directing the expression of genes (e.g., genes encoding foreign peptides or proteins of interest) that are operably linked to the gene when combined with appropriate control sequences such as promoter and operator sequences and replication initiation sites. Such vectors are often referred to as "expression vectors" and may also include multiple cloning sites for insertion of genes encoding proteins of interest. Alternatively, the gene encoding the peptide or protein of interest may be introduced by Site-directed Mutagenesis techniques such as Kunkel Mutagenesis (Handa et al, Rapid and replaceable Site-directed Mutagenesis Using Kunkel's Approach, Methods In molecular biology, vol 182: In Vitro Mutagenesis Protocols, 2 nd edition). The vector of the present invention is preferably a phagemid vector comprising essential elements required for normal replication and expression, including promoters, replicons of prokaryotic bacteria, replicons of regulatory phages, resistance genes and multiple cloning sites. Specifically, the vectors include, but are not limited to, the pBR322 replicon, the ampicillin resistance gene, the F1 replicon, the lactose operon lac Z, and the pIII protein.

The "essential element of the phagemid vector" in the present invention is intended to include elements required for normal replication and expression of the vector, such as a promoter, a ribosome binding site, a signal peptide, a multiple cloning site, a prokaryotic bacterial replicon or a replicon regulating a phage, and may further include a resistance gene such as an ampicillin resistance gene and the like.

The term "target protein" as used herein refers to a protein, i.e., an antigen, for screening for a specifically expressed antibody, and the target protein may be any selected target, such as PD1, PD-L1, TIGIT. In the invention, the target protein can be used for immunizing animals to generate the expression antibody specifically binding with the target protein, and the target protein can also be coated on a solid phase support to detect whether the expression antibody specifically binding with the target protein is generated.

The term "antibody" as used herein refers to an immunoglobulin or antigen-binding fragment of an antigen of interest, including, but not limited to, a full-length antibody, an sdAb (single domain antibody), an Fab (e.g., obtained by papain digestion of an antibody), an F (ab') 2 (e.g., obtained by pepsin digestion), an Fv (variable region antibody), or an scFv (single chain variable region antibody, e.g., obtained by molecular biology techniques). By "full length antibody" is meant an antibody having four full long chains, including heavy and light chains comprising an Fc region. By "antigen-binding fragment" is meant fragments of antibodies and antibody analogs, which typically include at least a portion of the antigen-binding or variable region (e.g., one or more CDRs) of a parent antibody (parent antibody). Antibody fragments retain at least some of the binding specificity of the parent antibody. The term "expression antibody" as used herein refers to an antibody that specifically binds to a target protein of the present invention, and is capable of expressing the antibody by transfection of a host cell with a phagemid vector, followed by the addition of a helper phage to allow phage display of the antibody or by induction of the expression of the antibody by the addition of an inducer.

A "single domain antibody (sdAb)" herein refers to a single antigen-binding polypeptide having three Complementarity Determining Regions (CDRs). These single domain antibodies are individually capable of binding to an antigen without pairing to the corresponding CDR-containing polypeptide. In some cases, single domain antibodies are engineered from camelid heavy chain antibodies, referred to as "V_HH segment ". Cartilaginous fish also have heavy chain antibodies (IgNAR, an abbreviation for immunoglobulin neoantigen receptor immunoglobulin heavy antibody receptor), from which antibodies also called "V" can be made_NARA segment "of a single domain antibody. Camelidae sdabs are a well-known smallest antigen-binding antibody fragment (see e.g., Hamers-Casterman et al, Nature 363:446-8 (1993); Greenberg et al, Nature 374:168-73 (1995); Hassanzadeh-Ghassabeh et al, Nanomedicine (Lond),8:1013-26 (2013)). Basic V_HH has the following structure from N end to C end: FR1-CDR1-FR2-CDR2-FR3-CDR3-FR4, wherein FR1 to FR4 are framework regions 1 to 4, respectively, and CDR1 to CDR3 are complementarity determining regions 1 to 3.

The term "single chain variable antibody (scFv)" as used herein refers to a fusion protein of immunoglobulin heavy and light chain variable regions linked by a short linker peptide of 5 to about 25 amino acids. Among these, short linker peptides are generally rich in glycine, which is flexible, and serine or threonine, which has solubility, and can link the N-terminus of the heavy chain variable region to the C-terminus of the light chain variable region, and vice versa. Despite the removal of the constant region and the introduction of the linker, the protein retains the specificity of the original immunoglobulin.

The "phage antibody display library" or "phage display library" in the present invention refers to a diverse phage library formed by phage display of antibody genes. The quality of antibody phage libraries is determined primarily by the size of the library and the diversity. The library capacity refers to the number of single clones in the phage library, and the total number of single clones in the library is counted by a gradient dilution method. Theoretical capacity of storageUp to 1 × 10⁷More than 99% of the antigenic determinants can be recognized. However, in order to obtain high-affinity antibodies, the phage antibody library needs to be as large as possible while ensuring diversity. The library diversity refers to the number of specific antibody sequences in the library and the distribution of the antibody gene families, and the more specific antibody sequences, the more consistent the distribution ratio of the antibody families to the natural distribution ratio of the antibodies, which indicates better diversity.

The term "SASA tag" or "SASA-tag protein" refers to an antibody or a functional fragment thereof, in particular a single domain antibody, that targets Bovine Serum Albumin (BSA) or whose antigen is BSA. The tag protein is used as an anchor protein (protein anchor) and is on a carrier together with the candidate protein, and the candidate protein is screened and evaluated and other biological performance tests are carried out by binding the tag protein with antigen BSA. The SASA tag protein can be found in US20120178110a1 for definition of the anchor protein, including but not limited to BSA12 or a functional fragment thereof.

As used herein, a "suitable detection tag" or "suitable detection tag sequence" refers to a peptide sequence that can be grafted or fused to another protein or peptide of interest by recombinant techniques. Grafting the tag sequence to the protein of interest allows detection of the protein, for example by using an antibody directed against the tag peptide sequence. Determination of suitable detection tag sequences is well within the knowledge of one skilled in the art. Typical detection tag sequences suitable for use in the present invention include a c-Myc tag, a Flag-tag, an HA-tag, a V5-tag, a His-tag or an HSV-tag, wherein for example the amino acid sequence of the c-Myc tag is EQKLISEEDL (SEQ ID NO:2), the amino acid sequence of the Flag-tag is DYKDDDDK, the amino acid sequence of the HA-tag is YDYPVPDYA, the amino acid sequence of the V5-tag is GKPIPNPLLGLDST, the amino acid sequence of the His-tag is HHHHHHHHH, and the amino acid sequence of the HSV-tag is QPELAPEDPED.

As understood by those skilled in the art, the insert nucleic acid may be inserted contiguously with the reference gene, or it may be inserted at spatially separated sites by using linker-encoding sequences that are also cloned in-frame. Furthermore, the insert nucleic acid may be inserted upstream or downstream of the reference nucleic acid sequence. As used herein, "upstream" refers to the placement or position of a target nucleic acid sequence relative to a reference nucleic acid or gene such that the target sequence is translated prior to the reference nucleic acid or gene during translation. Also, as used herein, "downstream" refers to the placement or position of a target nucleic acid sequence relative to a reference nucleic acid or gene such that the target sequence is translated after the reference nucleic acid or gene during translation.

"peptide linker" as used herein includes, but is not limited to (EAAAK)_n、(Gly)_6-8、(AP)₇Or a GS linker. Wherein "GS linker" refers to a GS combination of glycine (G) and serine (S) for linking multiple proteins together to form a fusion protein. A commonly used GS combination is (GGGGS) n, the length of the linker sequence is changed by changing the size of n, n is an integer from 1 to 10, wherein most GS combinations employ (GGGGS)3 (sequence shown in SEQ ID NO: 3). Also, glycine and serine can be combined to generate different linker sequences, such as the G9 linker, with GS combined to GGGGSGGGS. (EAAAK)_)nWhere n represents an integer from 1 to 5, such as (EAAAK) 3.

"amino acid sequence identity" is defined as the percentage of amino acid residues in a candidate sequence that are identical to amino acid residues in a particular peptide or polypeptide sequence after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and not considering any conservative substitutions as part of the sequence identity. Alignment to determine percent amino acid sequence identity can be performed in a variety of ways within the skill in the art, for example, using publicly available computer software such as BLAST, BLAST-2, ALIGN, or megalign (dnastar) software. One skilled in the art can determine appropriate parameters for measuring alignment, including any algorithms required to obtain maximum alignment over the full length of the sequences being compared.

When read from left to right, polypeptide chains as disclosed herein are depicted by their amino acid sequence from N-terminus to C-terminus, where each amino acid is represented by its single-letter or three-letter amino acid abbreviation. The "N-terminus" (or amino-terminus) of an amino acid or polypeptide chain refers to the free amino group on the amino acid or the free amino group on the first amino acid residue of the polypeptide chain. Likewise, the "C-terminus" (or carboxy-terminus) of an amino acid or polypeptide chain refers to the free carboxyl group on the amino acid or the free carboxyl group on the last amino acid residue of the polypeptide chain.

Drawings

FIG. 1 is a map of a vector, FIG. 1A is a map of a phage display original vector, and FIG. 1B is an optimized phage display vector;

FIG. 2 is a diagram of agarose gel electrophoresis of the optimized vector gene synthesis fragment by double digestion, lane 1 is the original plasmid; lane 2 is a double restriction enzyme plasmid; lane M is KB Ladder;

FIG. 3 is a frequency plot of the CDR3 length distribution;

FIG. 4 is a flow chart of phage display vector induction of soluble expression by helper phage display and IPTG.

Detailed Description

Example 1 construction of phage display antibody library

1.1 optimization of the vector: by sequence design, SASA TAG protein, c-Myc TAG protein, His TAG protein, amber stop codon (TAG) and G₄The S-linker was designed in tandem in the order described above, the sequence thus designed was synthesized and constructed into AH-V151 sfiipFL249 vector (phage display vector, see Rondon et al. US8546307B2) by enzymatic ligation, and the entire fragment was inserted between the vector signal peptide and the PIII protein, as shown in FIG. 1.

1.2 Gene Synthesis of optimized vectors: in a Kinry biological gene synthesis service (website: https:// www.genscript.com.cn/gene _ synthesis. htmlsrc ═ mostpopular), gene synthesis is performed to obtain an optimized phage vector. The optimized vector is subjected to sequence identification through Sanger sequencing, EcoR I and Hind III are adopted for double enzyme digestion at 37 ℃ for 40min, agarose gel electrophoresis is adopted for detecting fragments synthesized by the genes, the result is shown in figure 2, the size of the fragments obtained through the agarose gel electrophoresis is consistent with the theoretical size of the fragments, the comparison of target sequences through Sanger sequencing shows that the inserted sequences are completely correct, and the detection results of the Sanger sequencing and the agarose gel electrophoresis show that the sequence of the optimized vector is correct.

1.3 Single-Domain antibody phage display library construction:

(1) extracting RNA of peripheral blood lymph B cell of target protein immune animal (such as one or more alpacas), reverse transcribing to obtain cDNA, and PCR amplifying to obtain target DNA segment.

(2) The target DNA fragment was digested with the restriction enzyme SfiI (New England Biolabs, cat. No.: R0123) at 50 ℃ for 16 hours. The optimized phage display vector plasmid was also digested with the restriction enzyme SfiI under the same conditions for 16 hours, and then reacted with phosphatase (New England Biolabs, cat # M0289S) at 37 ℃ for 1 hour to prevent self-ligation of the vector.

(3) The digested target DNA fragment and the phage display vector plasmid were subjected to 2% agarose gel electrophoresis, and the gel containing the target DNA fragment and the gel containing the phage display vector plasmid were excised with a small knife, and then purified and recovered with a gel recovery kit (QIAGEN, cat. No. 28706).

(4) And (3) mixing the purified DNA fragment of interest with the optimized phage display vector according to the ratio of 1: 3 in a mass ratio. The DNA fragment and the optimized phage display vector were subjected to ligation reaction with T4DNA ligase (New England Biolabs, cat # M0202) at 37 ℃ for 2 hours. The ligated plasmid was then transferred into a competent TG1 host strain by electrotransformation (Agilent technologies, Inc., cat. No.: 930251). Then, the medium was added, the bacteria were resuspended, and then transferred to a 1.5ml sterile centrifuge tube, followed by culturing for 45min at 220rpm on a 37 ℃ shaker. Finally, gradient dilutions were performed and plated onto ampicillin resistant plates and incubated overnight at 37 ℃ in an inverted format.

(5) By counting the coatingAmpicillin-resistant plates were monocloned and the library size was determined to be 3.6X 10⁸. Carrying out sanger sequencing detection on the constructed library, wherein the sanger sequencing detection comprises the diversity and the insertion rate of the library, and the method comprises the following specific steps: by picking up the single clone and culturing overnight in an ampicillin-resistant medium, and using a sequence specific to the upstream and downstream of the insert in a vector (see the vector in Rondon et al U.S. 8546307B2) as a primer (AGCGGATAACAATTTCACACAGGA), the plasmid in the overnight-cultured bacterial solution was extracted, and PCR was carried out using the specific primer, and it was confirmed by sanger sequencing whether or not the sequence of the vector contained a nucleotide sequence encoding an antibody. As a result: the insertion sequence translatable rate (In frame rate), i.e., the proportion of sequences sequenced by Sanger translated into standard antibody sequences after IMGT database analysis, was 98.6%, and the analysis of the diversity of CDR3 (complementary-determining region, CDR) amino acid lengths of the test sequences was performed: for single domain antibody libraries, the diversity of heavy chain CDR3 lengths is directly related to the diversity of the library, so we assessed the diversity of the library by analyzing the frequency of distribution of CDR3 lengths of the constructed libraries. In general, the CDR3 of the single domain antibody library is about 5-26 amino acids in length, with the majority of the lengths distributed between 15-17 amino acids in length, as shown in FIG. 3, and the phage single domain antibody display library constructed in this experiment meets the requirements of the library construction criteria.

1.4 phage display library preparation:

(1) the library bacterial liquid is cultured in the amount of 10-100 times of the storage capacity and the final concentration is about OD₆₀₀The concentration of 0.05 was transferred to a shake flask and incubated at 37 ℃ and 220rpm to OD₆₀₀When the average molecular weight is 0.5 to 0.8, the helper phage M13KO7 was added and cultured overnight at 25 ℃ and 200rpm to perform phage display.

(2) The next day, the overnight culture was centrifuged at 4 ℃ at 10000 Xg for 15min, the centrifuged supernatant was transferred to a new 50mL centrifuge tube, 36mL of each tube was added with 9mL of pre-cooled PEG/NaCl solution, mixed well, left on ice for 1h, centrifuged at 12000 Xg for 30min at 4 ℃, the supernatant was discarded, and the precipitate was resuspended in 1-2 mL PBS buffer. Centrifuging at 12000 Xg for 5min at 4 deg.C, transferring phage supernatant to a new tube, and removing residual thallus and impurities.

(3) Secondary precipitation of phage: adding 1/4 volumes of PEG/NaCl solution into the transferred phage supernatant, mixing, and standing on ice for 30 min. Then at 4 degrees C, 12000 Xg centrifugal 15min, abandon the supernatant, using a total volume of 8mL precooled PBS buffer heavy suspension, heavy suspension system at 4 degrees C, 12000 Xg centrifugal 10min, will phage supernatant transfer to the new centrifuge tube.

(4) The concentration value (titer) of the phage display library was calculated by counting the number of single clones on ampicillin resistant plates by a gradient dilution method after infecting the resuspended phage into E.coli, and the titer value was 8X 10¹²pfu/ml。

Example 2 panning of phage display antibody libraries

Selection of 2X 10¹²pfu antibody display phage were blocked with 3% skim milk powder for 1 hour at room temperature, and then incubated with the target protein for 1 hour at room temperature. The incubated phage display library was washed with PBST and PBS, respectively, and the panned phage was eluted with 0.1M TEA buffer and then neutralized with Tris-HCl. The obtained phage was added to TG1 host bacteria (Agilent technologies, Inc., cat # 930251) and infected at 37 ℃ for 45 min. Taking out partial bacteria liquid for gradient dilution, and coating the bacteria liquid into a plate of a 2YT + carbenicillin solid culture medium for subsequent screening and identification of a phage display library; and centrifuging the residual bacterial liquid to remove the redundant culture medium, and then coating the residual bacterial liquid on a plate of a 2YT + carbenicillin solid culture medium to perform amplification culture and seed preservation on the phage display library. Putting all plates into an incubator at 30 ℃ for overnight culture, freezing and preserving the phage library in a 15cm plate by using a 2YT + glycerol culture medium the next day, counting the maximum value and the minimum value of the intermediate gradient after the plate coated with the diluted solution is cultured overnight, taking the average value and multiplying the average value by the dilution multiple to obtain the titer of the phage library, wherein the titer value is 8 multiplied by 10⁶pfu。

Example 3 screening of phage antibody display libraries

From the host bacteria plates cultured overnight in example 2, monoclonal bacteria were picked up and dropped into 96-well plates and cultured at 37 ℃ and 220rpm for 5 hours. Dividing the bacterial liquid into 2 parts according to the proportion of 1: 10 were transferred to 2 new 96-well plates and incubated at 37 ℃ and 220rpm for 1 hour. Adding M13KO7 helper phage (New England Biolabs, cat # N0315S) into one part of bacterial liquid, standing at 37 deg.C for 45min, and culturing at 30 deg.C overnight for phage display; and culturing another bacterial solution at 37 ℃ and 220rpm for 1 hour, adding IPTG inducer, and culturing overnight at 30 ℃ for induction expression, wherein the phage display vector performs different processes of phage display of the antibody and soluble expression of the antibody as shown in figure 4. If the helper phage is added into the bacterial liquid containing the carrier for protein display, the screening and detection of the antibody can be carried out by adopting the following two different modes:

a. performing ELISA screening detection by using Anti-c-Myc-HRP or Anti-M13-HRP secondary antibody, specifically, after 1-3 rounds of enrichment panning, selecting a monoclonal antibody for ELISA screening, coating a target protein (antigen) in a 96-hole enzyme label plate, adding phage display antibody supernatant, adding specific Anti-c-Myc-HRP or Anti-phage Anti-M13-HRP secondary antibody, and performing ELISA reading detection;

b. performing FACS screening detection by using Anti-c-Myc-FITC or Anti-fd-biotin + SA-AlexaFluor 647 secondary antibody, specifically, after 1-3 rounds of enrichment panning, spreading cells on a 96-well plate, adding phage display antibody supernatant, and adding secondary antibody (Anti-c-Myc-FITC or Anti-fd-biotin) with fluorescent or biotin labels and SA-AlexaFluor 647 for FACS detection.

If IPTG is added into the bacterial liquid containing the carrier to induce protein expression, the screening and detection of the antibody can be carried out by adopting the following three different modes:

a. performing ELISA screening detection by using Anti-c-Myc-HRP or Anti-BSA-HRP secondary antibody, specifically, adding IPTG (isopropyl beta-thiogalactoside) induced antibody supernatant by using coating target protein (antigen), adding specific Anti-c-Myc-HRP or BSA-HRP secondary antibody specifically combined with SASA (SASA) label for ELISA screening, and performing ELISA reading detection;

b. performing FACS screening detection by using Anti-c-Myc-FITC or BSA-FITC secondary antibody, specifically, paving cells on a 96-well plate, adding IPTG induced expression antibody supernatant, and adding a secondary antibody (Anti-c-Myc-FITC or BSA-FITC) with a fluorescent marker for FACS detection;

Meanwhile, different secondary antibodies can be used for screening and detecting the antibodies according to different label proteins contained in the optimized phage display carrier.

Example 4 ELISA detection assay

4.1 overnight culture of example 3 in 2 forms of the bacterial liquid (2 pieces of 96-well plate) were centrifuged, and the supernatant was examined according to the following 3 ELISA screening protocols:

a. coating target protein + sdAb-phage supernatant + Anti-c-Myc-HRP secondary antibody

b. Coating target protein + sdAb-soluble expression supernatant + Anti-c-Myc-HRP secondary antibody

c. Coating BSA + sdAb-soluble expression supernatant + Anti-c-Myc-HRP secondary antibody

4.2 specific procedures for ELISA experiments

(1) Coating: antigen (target protein coated or BSA coated) was diluted to 1. mu.g/ml with coating solution (CBS), coated on an ELISA plate at 100. mu.l/well and coated overnight at 4 ℃.

(2) And (3) sealing: the plate was washed 2-3 times with 0.05% PBST buffer, 300. mu.l/well blocking solution (3% nonfat dry milk) was added, and incubated at 37 ℃ for 1 hour.

(3) Primary antibody incubation: the plate was washed 1 time with 0.05% PBST buffer and 50. mu.l of 0.1% PBST + 50. mu.l of bacterial supernatant (either sdAb-phage supernatant or sdAb-soluble expression supernatant) was added to each well, and the corresponding negative control (equal amount of bacterial supernatant not associated with target protein binding) and blank control supernatant (2YT medium) were added and incubated for 2 hours at room temperature.

(4) And (3) secondary antibody incubation: the plate was washed 3 times with 0.05% PBST buffer and 100. mu.l of Anti-c-Myc-HRP secondary antibody (BETHYL, A190-104P) was added to each well and incubated for 45 minutes at room temperature.

(5) Color development: the plate was washed 6 times with 0.05% PBST buffer, 100. mu.l of TMB color developing solution was added to each well, incubated at room temperature for 10 minutes, and then 50. mu.l of 1mol/L hydrochloric acid was added to each well to terminate the reaction, and the reading was performed on an microplate reader at OD450nm, and the results were preserved.

(6) And (4) analyzing results: as shown in tables 1 and 2, the positive rates of the detection results of the phage display single domain antibody according to the protocol a and the soluble expression single domain antibody according to the protocol b are consistent, that is, the positive clone in the phage display form is also positive in the soluble expression form, and the number and the position of the positive clone are equivalent. Scheme c all clones using the optimized vector can express the SASA tag protein and have good binding with BSA, so that the SASA tag protein can be bound with a chip for SPR detection coupled with BSA, and the affinity detection of SPR can be carried out. The optimized vector can simultaneously keep the functions of phage display and soluble expression, the bacterial liquid induced by IPTG can be used for detecting the expression level and affinity, and the detection result of the soluble expression level is shown in Table 3. Remarking: clones with OD >0.5 were marked with bold, negative control: irrelevant phage display or expression supernatants not bound to the protein of interest, blank: 2YT medium.

Table 1: phage format screening results

Table 2: soluble expression form screening results

Table 3: soluble expression level detection results

Reference documents:

1.Alfaleh MA,et al.Strategies for Selecting Membrane Protein-Specific Antibodies using Phage Display with Cell-Based Panning.Antibodies(Basel).2017Aug 5；6(3):10.

2.Ph.D.^TMPhage Display Libraries Instruction Manual.NEB.

3.Hussack G,et al.ANovel Affinity Tag,ABTAG,and Its Application to the Affinity Screening ofSingle-Domain Antibodies Selectedby Phage Display.Front Immunol.2017 Oct 30；8:1406.

4.Zhongyu Zhu,et al.Construction ofa Large

Human Phage-Displayed Fab Library Through One-Step Cloning.Methods Mol Biol.2009；525:129-42.

SEQUENCE LISTING

<110> Nanjing GenScript Biotech Co., Ltd., (Nanjing King Smith Biotechnology Co., Ltd.)

<120> bifunctional vector, preparation method and application thereof

<130> 210

<150> CN202010653539.2

<151> 2020-07-08

<160> 3

<170> PatentIn version 3.5

<210> 1

<211> 124

<212> PRT

<213> Artificial Sequence

<220>

<223> SASA tag protein

<400> 1

Gln Val Lys Leu Glu Glu Ser Gly Gly Gly Leu Val Gln Val Gly Asp

1 5 10 15

Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Arg Thr Phe Ser Asn Tyr

20 25 30

Thr Met Ala Trp Phe Arg Gln Phe Pro Gly Lys Glu Arg Glu Phe Val

35 40 45

Ala Val Val Ser Arg Gly Gly Gly Ala Thr Asp Tyr Ala Asp Ser Val

50 55 60

Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Met Tyr

65 70 75 80

Leu Gln Met Asn Ser Leu Lys Thr Glu Asp Thr Ala Val Tyr Tyr Cys

85 90 95

Ala Ala Gly Thr Asp Leu Ser Tyr Tyr Tyr Ser Thr Lys Lys Trp Ala

100 105 110

Tyr Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser

115 120

<210> 2

<211> 10

<212> PRT

<213> Artificial Sequence

<220>

<223> c-Myc tag protein

<400> 2

Glu Gln Lys Leu Ile Ser Glu Glu Asp Leu

1 5 10

<210> 3

<211> 15

<212> PRT

<213> Artificial Sequence

<220>

<223> G4S linker

<400> 3

Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser

1 5 10 15

Claims

1. An expression vector comprising the essential elements of a phagemid vector, wherein the vector further comprises a polynucleotide sequence encoding an expression antibody, a gene sequence encoding a SASA tag protein and an amber stop codon, wherein the polynucleotide sequence encoding an expression antibody and the gene sequence encoding a SASA tag protein are upstream of the amber stop codon.

2. The vector of claim 1, wherein the SASA tag protein comprises the amino acid sequence set forth in SEQ ID NO. 1, or a sequence at least 80% identical to the amino acid sequence set forth in SEQ ID NO. 1.

3. The vector of claim 1 or 2, further comprising a polynucleotide sequence encoding a peptide linker downstream of the amber stop codon.

4. The vector of claim 3, wherein the peptide linker is selected from the group consisting of (EAAAK)_n、(Gly)_6-8、(AP)₇Or a GS linker, preferably a GS linker.

5. The vector according to any one of claims 1 to 4, further comprising upstream of the amber stop codon a polynucleotide sequence encoding a further suitable detection tag_。

6. The vector according to claim 5, wherein the further suitable detection tag is selected from one or more of the group consisting of a c-Myc tag, a Flag tag, an HA tag, a V5 tag, a His tag and an HSV tag, preferably a c-Myc tag.

7. The vector of claim 5 or6, wherein the polynucleotide sequence encoding the further suitable detection tag is located downstream of the polynucleotide sequence expressing the antibody.

8. The vector of claim 6 or 7, wherein the c-Myc tag protein comprises the amino acid sequence of SEQ ID NO 2.

9. The vector according to any one of claims 1-8, the expression antibody is selected from the group consisting of an sdAb, Fab or scFv, preferably an sdAb.

10. The vector according to any one of claims 1 to 9, wherein the vector comprises an inducible operon, preferably a lactose operon.

11. The vector according to any one of claims 1 to 10, wherein the vector comprises a phage pIII protein gene.

12. The vector according to any one of claims 1 to 11, wherein said vector is capable of functioning both as a phage display vector and as a vector for expression of soluble antibodies.

13. The vector according to any one of claims 1 to 12, wherein helper phage is added after the vector is used to construct a phage library, which can be used for phage display of antibodies.

14. The vector according to claim 13, wherein the helper phage is selected from the group consisting of M13KO7, VSCM13, and superphagem 13K 07 Δ pIII, preferably M13KO 7.

15. The vector according to any one of claims 1 to 12, wherein an inducer is added after construction of the phage library to induce soluble expression of the antibody.

16. The vector of claim 15, wherein the inducing agent is IPTG.

17. A method for constructing a phage display library, comprising the steps of:

(1) extracting RNA of peripheral blood lymph B cell of target protein immune animal, reverse transcribing to obtain cDNA, enzyme-cutting and connecting to the carrier of any one of claims 1-16 after amplification;

18. The method of claim 17, wherein step (1) comprises cleaving the amplified DNA fragment and the vector with the same enzyme in a ratio of 1: 2-1: 10 mass ratio hybrid junction.

19. The method according to claim 17 or 18, wherein the competent host bacterium in the step (2) is Escherichia coli.

20. The method of construction of any one of claims 17-19, further comprising panning and screening the phage display library.

21. A method of expressing a soluble antibody comprising the steps of:

(3) after culturing for a period of time, adding an inducer for induction expression to obtain a soluble expression antibody.

22. The method of claim 21, wherein step (1) comprises cleaving the amplified DNA fragment and the vector with the same enzyme in a ratio of 1: 2-1: 10 mass ratio hybrid junction.

23. The method according to claim 21 or 22, wherein the competent host bacterium in the step (2) is Escherichia coli.

24. The method of any one of claims 21-23, wherein the inducing agent in step (3) is IPTG.

25. Use of a vector according to any one of claims 1 to 16 for constructing, panning or/and screening a phage display library.

26. Use of a vector according to any one of claims 1 to 16 for expression, screening of antibodies or/and detection of antibody properties.

27. A host bacterium comprising the vector of any one of claims 1-16.