CN113912732A

CN113912732A - Method for detecting content of maduramicin or maduramicin and single-chain antibody thereof

Info

Publication number: CN113912732A
Application number: CN202111251280.XA
Authority: CN
Inventors: 李建成; 黄婧洁; 李苗; 陈莹娴; 梁雪燕
Original assignee: China Agricultural University
Current assignee: China Agricultural University
Priority date: 2021-10-26
Filing date: 2021-10-26
Publication date: 2022-01-11
Anticipated expiration: 2041-10-26
Also published as: CN113912732B

Abstract

The invention discloses a method for detecting the content of maduramicin or maduramicin and a single-chain antibody thereof. The single-chain antibody comprises a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region and the light chain variable region are both composed of a determinant complementary region and a framework region; the determinant complementarity region is composed of CDR1, CDR2 and CDR 3. The single-chain antibody has high sensitivity and strong specificity, can be applied to residue detection of maduramicin, and meets the requirement of practical application.

Description

Method for detecting content of maduramicin or maduramicin and single-chain antibody thereof

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a method for detecting the content of maduramicin or maduramicin and a single-chain antibody thereof.

Background

Maduramycin (MAD) also called Maduramicin belongs to Polyether Ionophore Antibiotics (PIAs), has a wide coccidiosis resistant spectrum, has coccidiosis resistant activity on both sporozoites and first-generation schizonts, can effectively control 6 common chicken coccidiosis, has a good prevention effect on duck coccidiosis, is not easy to generate drug resistance, and also has antibacterial and growth promoting effects, so that the Maduramicin serving as a feed additive is widely applied to production. However, when the animal food containing the drug residues is eaten, the blood vessels can be expanded, coronary artery diseases can be induced, and the animal food has potential hazard to people and livestock. Therefore, the residual detection of the MAD is increasingly emphasized. The highest residual limit of maduramicin in animal food approved in China is as follows: chicken muscle 0.24 mug/mL, chicken skin fat 0.48 mug/mL, chicken liver 0.72 mug/mL.

At present, the common methods for detecting maduramicin residue mainly include microbiological detection, chromatography, immunoassay and the like. Microbiological methods are economical, simple, but have limited sensitivity. Because maduramicin lacks ultraviolet, fluorescent and electrochemical characteristics, chromophores are introduced for its derivatization based on HPLC, and although the sensitivity is high, the pretreatment process is cumbersome. The chromatography requires higher equipment, is not suitable for high-throughput sample screening, has expensive instruments and higher requirements on operators, and is difficult to popularize. The immunoassay detection technology is a rapid, high-throughput and low-cost detection technology which is gradually and widely applied in the field of environmental and food safety monitoring in recent years, and has gradually become one of the main methods for rapidly screening and monitoring toxic and harmful residues in various countries in the world, so that a new way is provided for the detection of chromatography.

The immunomagnetic beads (IMB) are magnetic particles with specific antibodies fixed on the surfaces, so that a target can be captured specifically and an immune compound can be separated under a certain magnetic field intensity, the IMB is mainly a covalent bond connection between primary amine groups on the antibodies and activated carboxyl groups on the magnetic beads, and is relatively stable, but because part of the antibodies are combined with the magnetic beads through physical adsorption (electrostatic attraction and the like), the IMB is not firm, and the IMB is easy to separate from the magnetic beads in the subsequent processes of capturing antigens and eluting the antigens.

Disclosure of Invention

One of the objects to be solved by the present invention: aiming at the current situation that a maduramicin antibody is not developed in China, the invention provides a maduramicin single-chain antibody, a preparation method thereof and a method for detecting maduramicin by immunomagnetic bead purification-enzyme linked immunosorbent assay. The maduramicin single-chain antibody provided by the invention has high sensitivity and strong specificity, can be applied to the residue detection of maduramicin, and meets the requirements of practical application.

The invention provides a single-chain antibody of maduramicin or an antigen binding part thereof, wherein the single-chain antibody or the antigen binding part thereof contains a heavy chain variable region and a light chain variable region, and the heavy chain variable region and the light chain variable region are both composed of a determinant complementary region and a framework region; the determinant complementarity region is composed of CDR1, CDR2 and CDR 3;

the amino acid sequence of CDR1 of the heavy chain variable region is shown in position 153-163 of SEQ ID No. 2;

the amino acid sequence of CDR2 of the heavy chain variable region is shown in position 179-185 of SEQ ID No. 2;

the amino acid sequence of CDR3 of the heavy chain variable region is shown in position 218-226 of SEQ ID No. 2;

the amino acid sequence of CDR1 of the light chain variable region is shown in the 27 th-33 th position of SEQ ID No. 2;

the amino acid sequence of CDR2 of the light chain variable region is shown in 53-57 th position of SEQ ID No. 2;

the amino acid sequence of CDR3 of the light chain variable region is shown in 96 th-103 th positions of SEQ ID No. 2.

Alternatively, according to the above-mentioned single chain antibody or antigen-binding portion thereof, the amino acid sequence of the heavy chain variable region is shown as position 131-251 of SEQ ID No.2, and the amino acid sequence of the light chain variable region is shown as position 2-115 of SEQ ID No. 2.

Alternatively, according to the single-chain antibody or the antigen-binding portion thereof, the amino acid sequence of the single-chain antibody or the antigen-binding portion thereof is shown in SEQ ID No. 2.

The single chain antibody or antigen-binding portion thereof of maduramicin may further comprise a protein tag. The protein-tag refers to a polypeptide or protein which is expressed by fusion with a target protein by using a DNA in vitro recombination technology so as to facilitate the expression, detection, tracing and/or purification of the target protein. The protein tag may be a Flag tag, a His tag, an MBP tag, an HA tag, a myc tag, a GST tag, and/or a SUMO tag, among others. For example, the amino acid sequence of a single-chain antibody or an antigen-binding portion thereof to maduramicin is a sequence obtained by linking a protein-tag-encoding gene to the end of the sequence shown in SEQ ID No. 2.

The present invention also provides a biomaterial related to the above-mentioned single-chain antibody or antigen-binding portion thereof, which is any one of:

B1) nucleic acid molecules encoding the single-chain antibodies or antigen-binding portions thereof described above;

B2) an expression cassette comprising the nucleic acid molecule of B1);

B3) a recombinant vector comprising the nucleic acid molecule of B1);

B4) a recombinant vector comprising the expression cassette of B2);

B5) a recombinant microorganism comprising the nucleic acid molecule of B1);

B6) a recombinant microorganism comprising the expression cassette of B2);

B7) a recombinant microorganism containing the recombinant vector of B3);

B8) a recombinant microorganism comprising the recombinant vector of B4).

Alternatively, according to the above-mentioned biomaterial, B1) the nucleic acid molecule is a gene encoding the above-mentioned single-chain antibody or an antigen-binding portion thereof, the gene being a DNA molecule as described in a) or B) below:

A) the coding gene sequence of CDR1 of the heavy chain variable region is shown in the 457-489 bit of SEQ ID No. 1; the coding gene sequence of CDR2 of the heavy chain variable region is shown as 535-555 bit in SEQ ID No. 1; the coding gene sequence of CDR3 of the heavy chain variable region is shown in the 652-th and 678-th positions in SEQ ID No. 1; the encoding gene sequence of CDR1 of the light chain variable region is shown as 79-99 th position in SEQ ID No. 1; the coding gene sequence of CDR2 of the light chain variable region is shown in the 157-171 th position in SEQ ID No. 1; the coding gene sequence of CDR3 of the light chain variable region is shown as 286-309 bit in SEQ ID No. 1;

B) a DNA having 90% or more identity to the DNA molecule defined in A) and encoding the single-chain antibody or an antigen-binding portion thereof.

The gene sequence encoding the heavy chain variable region may be shown as position 388-753 of SEQ ID No.1, and the gene sequence encoding the light chain variable region may be shown as position 4-342 of SEQ ID No. 1. For example, B1) is shown as SEQ ID No. 1.

The invention also provides an immunomagnetic bead, and the surface of the immunomagnetic bead is coupled with the single-chain antibody or the antigen binding part thereof. The magnetic beads may be manufactured by beaver corporation, Suzhou under the product designation MB 004.

The preparation method of the immunomagnetic beads can comprise the steps of uniformly mixing magnetic beads activated by NHS and the single-chain antibody or the antigen binding part thereof for 30s in a vortex mode, vertically and uniformly mixing for 1.5h at room temperature, carrying out coupling reaction for 30min, carrying out vortex 15s every 5min, and then carrying out vortex 15s every 15 min. The concentration of the single chain antibody or antigen-binding portion thereof can be 0.4 mg/mL. The mass ratio of the single chain antibody or antigen-binding portion thereof to the magnetic bead can be 1: 25. And (3) blocking the active residues of the unconjugated single-chain antibody or the antigen binding part thereof on the surface of the magnetic bead by using a blocking solution. And magnetic separation, enrichment and closure of the magnetic beads are adopted to obtain immunomagnetic beads.

The invention also provides a product for detecting the content of maduramicin or maduramicin, which comprises the single-chain antibody or the antigen-binding part thereof. The product may also comprise immunomagnetic beads as described above.

The invention also provides a product for enriching maduramicin, which comprises the immunomagnetic beads.

The invention also provides the single-chain antibody or the antigen binding part thereof, the biological material, the immunomagnetic bead, the product or the application of the product in any one of the following methods:

(1) preparing a product for detecting maduramicin, or detecting maduramicin;

(2) preparing a product for detecting the content of maduramicin, or detecting the content of maduramicin;

(3) preparing a product enriched with maduramicin, or enriching maduramicin.

The invention also provides a method for detecting the content of maduramicin or maduramicin, which comprises the following steps

(1) The sample is processed by the immunomagnetic beads to obtain a sample to be detected by the ICELISA;

(2) and (2) determining whether the sample contains maduramicin or the maduramicin content in the sample by using maduramicin as a coating antigen, using the single-chain antibody or the antigen binding part thereof as a primary antibody and detecting the sample to be detected by the iclass-linked immunosorbent assay obtained in the step (1).

The step (1) may include the steps of:

a. weighing 2.0g (+ -0.02 g) of a sample, adding 5mL of methanol, mixing at 24000rpm for 10s in a homogenizer, oscillating for 5min on a vortex oscillator, centrifuging at 4 ℃ and 5000rpm for 10min, taking supernatant, blowing nitrogen at 37 ℃ for drying, and redissolving with 2mL of 5% methanol-PBS solution (the solvent is 0.01M (pH7.4) PBS, and the solute and the content of the solute in the solution are 5% (volume percent) of methanol) to obtain a sample to be detected;

b. adding 500 mu L of the prepared sample to be detected into 1mg of the immunomagnetic beads, uniformly mixing by vortex, reacting for 30min on a shaking table at 37 ℃, and washing the immunomagnetic beads for 3 times by using a PBST solution after magnetic separation;

c. adding 500 mu L of 50% methanol water (the solvent is water, the solute and the content of the solute in the solution are 50% (volume percentage) of methanol) into the immunomagnetic beads, resuspending the immunomagnetic beads, uniformly mixing by vortex, reacting for 30min on a shaking table at 37 ℃, carrying out magnetic separation and preserving supernatant, wherein the supernatant is the sample to be detected by the ICELISA.

Step (2) may comprise using MAD-OVA as a coating agent (for example, the concentration of the coating agent is 1. mu.g/mL), 5% skim milk (solvent is 0.01M (pH7.4) PBS, solute and its content in the blocking solution is 5% (mass percent) skim milk.) as a blocking solution, diluting the single-chain antibody or antigen-binding portion thereof with 5% methanol-PBS solution, and sequentially performing coating, blocking, binding of the single-chain antibody or antigen-binding portion thereof to the sample to be tested by the ICELISA, binding to the goat anti-mouse IgG antibody labeled by horseradish peroxidase, development, termination and reading of OD of the reaction system₄₅₀The value is obtained.

The coating conditions may be incubation for 12h at 4 ℃. The blocking conditions may be incubation for 1h at 37 ℃. The single chain antibody or antigen-binding portion thereof (at a concentration of 1.5. mu.g/ml) may be diluted by a factor of 1000 volumes. The single-chain antibody or the antigen binding part thereof can be incubated for 1h at 37 ℃ under the condition of being combined with the sample to be detected in the ICELISA. The binding conditions with the horseradish peroxidase-labeled goat anti-mouse IgG antibody can be incubation for 1h at 37 ℃.

The single-chain antibody has small molecular weight, strong tissue penetration capability and low immunogenicity, and has strong advantages in tumor treatment compared with mAb; the single-chain antibody has no Fc segment, can reduce non-specific adsorption, simultaneously keeps the affinity and specificity of the parent antibody, is combined with hapten in a monovalent mode, has higher sensitivity and is also suitable for the field of immunodetection.

The ICELISA method has the advantages of high detection speed, low cost, low requirements on instruments and equipment, high sensitivity, strong selectivity and the like, and can be used for field detection.

The immunomagnetic beads can enrich pure antigen target substances in a short time, so that the sample detection time is remarkably shortened, the defect that an immune complex is difficult to separate from a background solution in the immunoassay process is overcome, and the detection benefit and the sensitivity of the method are improved. The stability of the immunomagnetic beads prepared in the examples of the present invention was measured by 1M NaCl,

the value was 85.43%, and the prepared immunomagnetic beads had good stability, and most of single-chain variable fragments (scFv) were bonded to the magnetic beads via covalent bonds.

In the invention, the prepared single-chain antibody is coupled with magnetic beads to prepare immunomagnetic beads, the immunomagnetic beads are used for enriching and purifying MAD molecules in a sample, the MAD molecules are further separated by a magnetic separation technology, then the MAD is eluted from the immunomagnetic beads by methanol, and the residue of the MAD is detected by establishing an immunomagnetic bead purification-enzyme-linked immunoassay method.

The detection method provided by the embodiment of the invention has the advantages that the detection limit of chicken is 6.31 mug/kg, the addition recovery rate is 72.93-89.51%, the variation coefficient in the daytime and the intraday is not more than 15%, and the sensitivity and the stability can meet the limit standard and the detection requirement. The detection method has high separation efficiency and good stability, can improve the working efficiency, and can be used as an effective tool for residue screening of the MAD in the chicken.

Drawings

FIG. 1 is the structural formula of maduramicin.

FIG. 2 is a schematic diagram of a single-chain antibody gene construction route.

FIG. 3 is a diagram of example 1abYsis search for heavy and light chain variable regions.

FIG. 4 is a chessboard titration method to determine the optimal concentration of coatingen and 3B 4-scFv.

FIG. 5 shows the indirect competitive ELISA assay for single-chain antibody IC₅₀Is shown schematically in the figure.

FIG. 6 is a schematic diagram of the preparation route of immunomagnetic beads.

FIG. 7 shows the result of the optimization of immunomagnetic bead conditions.

FIG. 8 is a comparison of the standard curve for MAD in chicken matrix and the standard curve for MAD in solvent.

Detailed Description

The present invention is described in further detail below with reference to specific embodiments, which are given for the purpose of illustration only and are not intended to limit the scope of the invention. The examples provided below serve as a guide for further modifications by a person skilled in the art and do not constitute a limitation of the invention in any way.

The experimental procedures in the following examples, unless otherwise indicated, are conventional and are carried out according to the techniques or conditions described in the literature in the field or according to the instructions of the products. Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

Coli RV308 and pJB33 plasmid vectors were both stored in the laboratory (described in Wen K, Nolke G, Schillberg S, et al, improved fluoroquinolone detection in ELISA through engineering of a broad-specific single-chain variable binding mutant to 20fluoroquinolones [ J ]. Analytical and biochemical chemistry, 2012, 403 (9): 2771-2783.)

The quantitative tests in the following examples, all set up three replicates and the results averaged.

Maduramicin (MAD): ehrenstorfer, germany, CAS number 84878-61-5, the structural formula is shown in figure 1. Magnetic beads: beaver, Suzhou, cat # MB 004. Bovine Serum Albumin (BSA): OXOID, Inc. of UK, cat # 37525. Egg albumin (OVA): OXOID, UK. Horse radish peroxidase-labeled goat anti-mouse IgG antibody: beijing Soilebao reagent, cat # SA 131. Mouse anti-His-tag monoclonal antibody, HRP labeling: shanghai assist, san Francisco Biotech, Inc., cat # 30404ES 60. TMB substrate color development solution: sigma, USA, Cat # T0565. DMEM: gibco, Inc. of USA, cat # 8121475. Fetal bovine serum: gibco, Inc. USA, Cat # 10099-141. Penicillin streptomycin mixture (100 ×): beijing Soilebao reagent, cat # P1400. EDC: U.S. Thermo corporation, cat #: 22980. NHS: U.S. Thermo corporation, cat #: 24500. 2 percent (mass percent) of skim milk and 5 percent (mass percent) of skim milk are prepared by using skim milk powder (Bomaide biotechnology limited, product number: PA201-01) and 0.01M (pH7.4) PBS.

H₂SO₄Stopping liquid: concentrated sulfuric acid 22.2mL, ultrapure water 177.8 mL. Binding Buffer: 1.0M Tris-HCl, 300mM sodium chloride, 10mM imidazole, 0.05% Tritonx-100, pH 8.0. Washing Buffer: 50mM Tris-HCl, 300mM NaCl, 50mM imidazole, 0.05% Tritonx-100, pH 8.0. Elution Buffer: 50mM Tris-HCl, 300mM NaCl, 300mM imidazole, pH 8.0. MEST: 100mM MES, pH 5.0, 20% Tween 20. Storage Buffer: PBST, pH 7.2, 0.1% BSA, 0.02% Procline 300.

EXAMPLE I preparation of Madurycin Single chain antibody

Preparation of maduramicin single-chain antibody gene fragment

1. And (3) recovering the hybridoma cells: and (3) taking out the required hybridoma cell strain capable of stably secreting the MAD-3B4 antibody from the liquid nitrogen tank, immediately putting the cryopreserved tube into a water bath kettle at 37 ℃, heating while shaking, and only leaving small icicles in almost all the thawed tubes within one minute. The cells were transferred to an autoclaved 15mL centrifuge tube, 10mL incomplete medium (DMEM) was added, and centrifuged at 1000rpm for 5 min. Discarding the supernatant, adding 2mL of complete culture solution (20% fetal calf serum, 80% DMEM, 1% streptomycin mixed solution) to resuspend the cells, transferring the cells to a 24-hole cell culture plate, culturing in a 5% CO2 cell culture box at 37 ℃ for a period of time, and extracting the total RNA of the cells when the cells grow to fill 24 holes and the growth state is stable, uniform in size and transparent in a round shape.

2. Serotype identification: the single chain antibody immunoglobulin subclass was determined using a murine IgG subclass detection kit.

3. Extraction of hybridoma cell RNA: total RNA from 3B4 hybridoma cells was extracted according to the RNAminikit instructions and stored at-20 ℃. The whole operation process needs to avoid the pollution of RNase as much as possible.

4、cDNA-As0₄Synthesis of linker: and (3) performing reverse transcription to synthesize cDNA by using the extracted total RNA of the cells as a template. The cDNA was ligated with a linker of known sequence As04 linker at T₄Under the action of RNAligase, As0₄Linker and cDNA are connected into cDNA-As0₄And (5) linker. And (4) purifying and recovering the reaction product by using a Promega gel recovery kit.

5. And (3) designing a primer according to the single-chain antibody typing result in the step (2). As cDNA-As0₄linker is taken As a template, corresponding primers are adopted to respectively amplify heavy chain and light chain genes of the antibody, and the primer used by the heavy chain of the antibody is As0₄F (sequence: TAGGATCCACCAAGCTTTCTGCAG) and PrimerIgG₁(SEQ ID NO: GTCGACTCATTTACCAGGAGAGTGGGAGAGG), As0 was used As a primer for the light chain of the antibody₄F (sequence: TAGGATCCACCAAGCTTTCTGCAG) and PrimerKappa (sequence: CTCGAGTCAACACTCATTCCTGTTGAAGCTCTTGAC).

6. And (4) determining the genes of the heavy chain and the light chain of the antibody amplified in the step (5) by using 1% agarose gel, cutting the agarose gel and recovering the target fragment.

7. Determination of heavy and light chain variable regions: and (4) respectively connecting the heavy chain and light chain genes of the antibody obtained by amplification in the step 6 with a pGM-TFast vector. And (3) placing the mixed reaction solution at 22 ℃ for reaction for 30min, transferring the reaction solution into escherichia coli DH5 alpha competent cells by a heat shock method, and culturing to grow white and opaque colonies. The correct bacterial fluid identified by PCR was sequenced and the sequences of the variable regions of the heavy and light chain genes of the antibody were determined using software based on the sequencing results.

Splicing of gene fragment of maduramicin single-chain antibody (3B4-scFv)

A schematic diagram of a scFv gene construction route for constructing 3B4 by overlap extension PCR technology is shown in FIG. 2, and an ScFv gene is obtained by linking a heavy chain gene variable region (VH) and a light chain gene variable region (VL) by Linker by SOE PCR.

Primers used for SOE PCR are shown in tables 1 and 2. First round SOE-PCR: and (3) carrying out amplification culture on the bacterial liquid with correct sequencing, extracting plasmids, and carrying out PCR amplification by using the plasmid extracting solution as a template. The PCR reaction system and PCR reaction conditions of the second round and the third round of SOE-PCR are the same as those of the first round of SOE-PCR. Except that the reaction template in each subsequent round was the recovered product of the previous round of PCR amplification, VH was amplified by three PCR amplifications, and VL was amplified by two PCR amplifications.

TABLE 1 primers required for SOE-PCR reaction

TABLE 2 primers required for scFv amplification

The PCR reaction system is as follows:

plasmid/PCR recovery (100ng) 0.5. mu.L

primer-F0.3. mu.L

primer-R0.3. mu.L

2×Fast Pfu mix 12.5μL

dd water 11.4μL

The total volume was 25. mu.L.

PCR reaction procedure: 5min at 95 ℃ (95 ℃ 1min, 55 ℃ 50s, 72 ℃ 1min)30 cycles, and 10min at 72 ℃. And (3) identifying the PCR product by 1% agarose gel electrophoresis, cutting the gel and recovering to obtain the full-length scFv gene fragment. The dialyzed 3B4-scFv was mixed with an appropriate amount of Coupling buffer A and stored at 4 ℃ until use.

The second or third round of PCR products of VH and VL were recovered by purification and VH-R3 and VL-F2 were used as primers to link VH and VL to give the complete 3B4-ScFv gene fragment. The reaction system is as follows:

the PCR reaction conditions were the same as the first round of SOE-PCR reaction conditions. The reaction product was identified by 1% agarose gel electrophoresis, and the complete 3B4-scFv gene fragment was recovered by cutting the gel.

The sequencing result shows that the 3B4-scFv gene fragment is 753bp (excluding a stop codon, a protective base, a SfiI enzyme cutting site and the like), the nucleotide sequence of the 3B4-scFv gene fragment is shown as SEQ ID No.1, abYsis is used for searching a heavy chain variable region and a light chain variable region, and as shown in FIG. 3, each of VL and VH regions is composed of 4 FR regions and 3 CDR regions embedded therein, and the expected guess is met. Wherein, the 1-3 position is a methionine sequence, the 4-342 position is a VL sequence, 113 amino acids are coded, the 343-.

The amino acid sequence of the maduramicin single-chain antibody coded by the 3B4-scFv gene fragment is shown as SEQ ID No.2, wherein, the 2 nd to 115 nd sites are VL sequences, the 116 nd and 130 th sites are Linker sequences, the 131 nd and 251 th sites are VH sequences, the 27 th to 33 th sites are CDR1 sequences of VL, the 53 th to 57 th sites are CDR2 sequences of VL, the 96 th to 103 th sites are CDR3 sequences of VL, the 153 th and 163 th sites are CDR1 sequences of VH, the 179 th and 185 th sites are CDR2 sequences of VH, and the 218 th and 226 th sites are CDR3 sequences of VH.

Construction of RV308 expression System for tris, 3B4-scFv

Frozen Escherichia coli RV308 cells are inoculated on an LB plate for streaking, inverted culture is carried out for 12-18h at 37 ℃, a single colony is selected and inoculated in 2mL of LB broth culture medium, and culture is carried out for 12-18h at 37 ℃ and 250 rpm. 2mL of the above culture was added to 200mL of LB broth, and when the culture was cultured at 37 ℃ and 250rpm to OD600 of about 0.5, the flask was taken out and immediately ice-cooled for 30 min. Centrifuge at 3000rpm for 15min at 4 ℃. 200mL ice-bath sterile water heavy suspension of the thalli, 4 ℃, 3000rpm centrifugation for 20min, suction dry supernatant. 150mL of 10% ice-bath glycerol is used for resuspending the thalli, centrifugation is carried out for 20min at 4 ℃ and 4000rpm, the centrifugation is repeated once, the supernatant is sucked dry, 6mL of 10% ice-bath glycerol is used for resuspending the thalli, and subpackaging is carried out for preservation at-70 ℃.

Four, transformation, expression and purification of single-chain antibody

1. Electroporation transformation of scFv-PJB33 expression vectors

The scFv gene and the PJB33 plasmid are respectively digested by SfiI, and then the digested products are connected by T4 DNA ligase to construct the scFv-PJB33 expression vector. The scFv-PJB33 expression vector is a vector in which the 3B4-ScFv gene fragment is replaced by a fragment (small fragment) inserted between pelB and (His)6tag recognition sites of the pJB33 plasmid vector, and the other nucleotide sequences of the pJB33 plasmid vector are kept unchanged.

The scFv-PJB33 expression vector is transferred into Escherichia coli RV308 by using an electric shock method to construct a scFv Escherichia coli expression system of 3B4, and the steps are as follows:

the dialysis membrane was placed on the surface of deionized water, and 3. mu.L of scFv-PJB33 expression vector was dialyzed on the dialysis membrane for 30min, and the whole dialysis process was performed under ice bath conditions. Competent cells RV308 (100. mu.L/tube) were removed from-70 ℃ and placed on ice, and the dialyzed plasmid was added just after thawing, flicked and mixed well. The product was transferred to a pre-cooled, sterile, dry electric rotor. The electric rotor was placed in an electroporator under conditions of 2.5kv, 25uF, 200 Ω. Immediately after the electroporation, the resultant was washed out of the electroporation with 900. mu.L of 2 XYT (Yeast tryptone) broth and shaken at 37 ℃ and 200rpm for 1 hour to resuscitate the bacteria. 100. mu.L of the bacterial suspension was applied to a2 XYT agar plate containing 34. mu.g/mL chloramphenicol, and the plate was inverted and placed in a 37 ℃ incubator overnight for culture. 15 single colonies were picked from the plate and grown in 2mL 2 XYT broth (containing chloramphenicol 34. mu.g/mL) overnight at 37 ℃ at 250rpm, and the bacterial suspension was subjected to PCR as follows:

PJB 33F sequence (5 '→ 3'): GGCTTTACACTTTATGCTTCCG, respectively;

PJB 33R sequence (5 '→ 3'): CGAGAAAGGAAGGGAAGAAAGC are provided.

The PCR conditions were the same as those of "two" in example one, and the products were identified by agarose gel electrophoresis. The correct bacteria were identified and sent for sequencing to determine if the 3B4-scFv gene fragment was correctly transferred. The strains with correct sequencing are preserved at-80 ℃. Recombinant bacteria with correct sequencing express maduramicin single-chain antibody (3B 4-scFv).

2. Prokaryotic expression and purification of 3B4-scFv

Selecting recombinant bacteria with correct sequencing for amplification culture, sucking the bacterial liquid with correct sequencing from 2 mu L to 5mL of 2 XYT liquid culture medium (containing chloramphenicol 34 mu g/mL), and culturing overnight at 37 ℃ with a constant-temperature shaking table at 250 rpm. The overnight-cultured bacterial suspension was inoculated into 2 XYT broth (containing chloramphenicol 34. mu.g/mL) at an inoculum size of 1%, and shaken at 250rpm and 37 ℃ until the OD600 became 0.6 to 0.8. Then, IPTG 0.5mM was added thereto, and the mixture was subjected to induction culture at 20 ℃ and 180rpm overnight. The culture flask is placed on ice for precooling for 5min, and the collected bacterial liquid is transferred to a 50mL centrifuge tube. The bacterial liquid was centrifuged at 8000rpm at 4 ℃ for 10min, and the cells were collected. The cells were washed with pre-cooled PBS and centrifuged repeatedly. The cells were resuspended in a precooled binding buffer and 5mL of binding buffer was added per gram of cells. And (3) carrying out ultrasonic treatment in an ice bath with 200W power, crushing the thalli until the suspension becomes clear, centrifuging for 20min at 10000rpm at 4 ℃, collecting supernatant, namely 3B4-scFv extracting solution, and storing at 4 ℃ to be purified.

The 3B4-scFv after prokaryotic expression carries a 6xHis tag, the 3B4-scFv containing the His tag is purified by a magnetic separation method, and the aim of purification is achieved by imidazole gradient concentration elution. The method mainly comprises the following steps:

(1) the reagent bottle containing the magnetic beads is fully mixed, 200uL of magnetic beads are absorbed and added into a centrifugal tube containing 800uL Binding Buffer (10mM imidazole), the mixture is placed on a magnetic separation rack for 10s after being mixed, and the supernatant is discarded.

(2) Mixing 1mL of 3B4-scFv extract and 1mL of Binding Buffer with equal volume, adding into the centrifuge tube, mixing by inversion, shaking for 30min, performing magnetic separation on a magnetic separation rack, and discarding the supernatant.

(3) The washing was repeated by adding 1mL of Wash Buffer (50mM imidazole) to remove contaminating proteins from the beads, and the protein concentration was measured with a Nanodrop until no protein flowed out.

(4) Finally, the target protein bound on the magnetic beads is washed by an ELution Buffer (300mM imidazole), and the eluent is collected, namely the purified 3B 4-scFv. The elution was repeated while the Nanodrop measures the protein concentration until no protein flowed.

(5) The magnetic beads were washed thoroughly with Elution Buffer and ultrapure water and stored at 4 ℃ in 20% (v/v) ethanol for the next purification.

(6) And (3) dialyzing the eluent obtained in the step (4) for 48 hours by using PBS, and collecting the target protein to obtain purified 3B4-scFv, namely the maduramicin single-chain antibody solution.

(7) Finally, the protein concentration in the maduramicin single-chain antibody solution was 1.45mg/ml as determined by the BCA kit.

EXAMPLE two preparation of the coating antigen

(1) 20mg of maduramicin is dissolved in 1.5mL of DMF, 25mg of EDC and 20mg of NHS are sequentially added, and the mixture is shaken at room temperature until the solution is completely clear (4-5h), so as to obtain reaction liquid I.

(2) 35mg of OVA was dissolved in 4.5mL of 0.05M carbonate buffer solution (pH 9.6) to obtain reaction solution II.

(3) The reaction solution I was added dropwise to the reaction solution II, followed by shaking at room temperature for 24 hours.

(4) And (3) putting the solution obtained in the step (3) into a dialysis bag, dialyzing in 0.01M PBS buffer solution (pH7.4) for 3d (changing the solution twice per day), finally centrifuging at 10000rpm for 10min, collecting supernatant to obtain coating original solution (MAD-OVA), subpackaging and storing at-20 ℃.

EXAMPLE III preparation of standard curve for ICELISA

Concentration optimization of primary, MAD-OVA and 3B4-scFv antibody solution

The MAD-OVA synthesized in example two was diluted with PBS solution at pH 7.410mM to actual concentrations of about 4. mu.g/mL, 2. mu.g/mL, 1. mu.g/mL, 0.5. mu.g/mL, 0.25. mu.g/mL, and the 3B4-scFv solution prepared in example 1 was diluted 500, 1000, 2000, 4000, 8000 times, respectively.

The optimal concentrations of MAD-OVA and 3B4-scFv solutions were determined by a checkerboard titration method. The specific method (the basic steps of the iclelisa) is as follows.

1. Adding MAD-OVA with different concentrations into a 96-well plate at a rate of 100 mu L/well, incubating for 12h at 4 ℃, washing the plate for 3 times by 1 XPBST, and drying by beating;

2. adding blocking solution (5% skim milk), incubating at 280 μ L/well for 2h2h at 37 deg.C, washing with 1 XPBST for 3 times, and patting to dry;

3. adding 10ng/mL maduramicin solution and 50 muL/well, respectively adding 3B4-scFv solution with different dilution times, 50 muL/well, incubating at 37 ℃ for 1h, washing with 1 XPBST for 3 times, and patting to dry;

4. adding HRP-anti-His antibody (diluted 1: 5000), incubating at 100 μ L/well for 1h at 37 deg.C, washing with 1 XPBST for 3 times, and patting to dry;

5. adding TMB substrate color development solution, 100 μ L/hole, and reacting at 37 deg.C in dark for 10min10 min;

6. adding 2M H2SO4 stop solution, 50 mu L/hole, and detecting OD450 value by a microplate reader.

As a result, as shown in FIG. 4, OD was determined when the concentration of MAD-OVA was 2. mu.g/mL₄₅₀No longer increases with increasing concentration, when OD₄₅₀Since the ELISA test sensitivity was high at about 1.5, the optimal dilution factor of the selected antibody was 1000 at a concentration of 1.5. mu.g/mL, and the concentration of the coating antigen was 1. mu.g/mL.

Optimization of the ICELISA method

The above-mentioned ICELISA method has been preliminarily established, and the optimal concentration of MAD-OVA and 3B4-scFv is established by using a chessboard titration method, and the ICELISA is further optimized to establish a 3B4-scFv standard curve.

1. Coating conditions are as follows: the optimal antigen antibody concentration was chosen, the coating conditions were set to 37 ℃ for 2h incubation or 4 ℃ overnight incubation, respectively, and the optimal coating conditions were chosen in combination with the OD450 value of the zero-labeled well and IC 50.

2. Sealing liquid: selecting the optimal antigen-antibody concentration and the optimal coating conditions, using BSA, OVA, 2% skim milk and 5% skim milk as blocking solutions, and performing the rest steps according to the basic steps of the ICELISA, and selecting the optimal blocking solution by combining the OD450 value of a zero-standard hole and IC 50.

3. Sealing time: and (3) adopting the optimal conditions of the steps, performing the rest steps according to the basic steps of the iclELISA, setting the sealing time to be 30min, 1h, 2h and 4h respectively, and selecting the optimal sealing time by combining the OD450 value of the zero-mark hole and the IC 50.

4. Buffer methanol content: the optimal conditions of the above steps are adopted, the rest steps are carried out according to the basic steps of the iclELISA, the volume fractions of 5%, 10% and 20% methanol-PBS are selected to dilute the MAD standard substance and 3B4-scFv, and the optimal methanol content is selected according to the OD450 value and IC50 of a zero-standard hole.

5. Ionic strength of buffer: the optimal conditions of the above steps are adopted, the rest steps are carried out according to the basic steps of the iclelisa, and the optimal ionic strength is determined by using 10mMPBS, 20mMPBS, 30mMPBS, 50mMPBS to dilute the antibody and the standard, and combining the OD450 value of the zero standard well and the IC 50.

6. pH value of the buffer: the optimal conditions of the above steps are adopted, the rest steps are carried out according to the basic steps of the ICELISA, the pH values of the buffers are respectively 6.2, 6.8, 7.4 and 8.0, and the optimal pH value of the reaction buffer is selected by combining the zero-mark OD450 value and IC 50.

7. Competition reaction time: the optimal conditions of the above steps are adopted, and the rest steps are carried out according to the basic steps of the ICELISA. The competitive reaction time is set to be 30min, 45min and 60min, and the optimal reaction time of the competitive reaction is selected by combining the zero-mark OD450 value and the IC 50.

8. The reaction time of the secondary antibody: adopting the optimal conditions of the above steps, performing the rest steps according to the basic steps of the iclELISA, setting the time of the secondary antibody to be 15min, 30min, 45min and 60min respectively, measuring the OD450 value of each hole, and combining the zero-mark OD₄₅₀The values and IC50 determine the optimal reaction time for the secondary antibody.

According to IC₅₀And zero-mark hole OD₄₅₀(B₀) The condition of higher sensitivity is selected as the optimum condition. The results of the individual steps are shown in Table 3, with bold preferred conditions. The temperature is selected to be 4 ℃ overnightAs coating conditions, 5% skim milk blocking for 1h, 3B4-scFv and MAD standards were diluted with 5% methanol in PBS at pH 7.410mM, competing for 1h for the reaction time, and 1h for the secondary antibody.

TABLE 3 optimized Condition test results

Establishment of standard curve of ICELISA

An icELISA assay based on 3B4-scFv MAD was established under the optimal conditions obtained in the above steps.

The optimal dilution of the coating antigen and scFv was selected, and solutions of maduramicin at different concentrations were prepared using maduramicin and 0.01M PBS buffer (also referred to below simply as 5% methanol-PBS solution) containing 5% methanol at pH 7.4. The concentration of maduramicin was 4. mu.g/mL, 2. mu.g/mL, 1. mu.g/mL, 0.5. mu.g/mL, and 0.25. mu.g/mL, respectively. A blank was prepared from 0.01M PBS buffer at pH7.4 containing 5% methanol.

1. Diluting the coating source to 1 mu g/mL by using a coating solution, adding the coating source to a 96-well plate at a concentration of 100 mu L/well, incubating for 12h at 4 ℃, washing the plate by 1 xPBST for 3 times, and patting to dry;

2. adding 5% skimmed milk, incubating at 280 μ L/well for 1h at 37 deg.C, washing with 1 × PBST for 3 times, and drying;

3. sequentially adding maduramicin solutions with different concentrations and 50 mu L/hole after gradient dilution, adding 3B4-scFv solution with the optimal working concentration of 1.5 mu g/mL into all the holes, incubating for 1h at the temperature of 50 mu L/hole, washing for 3 times by 1 XPBST, and patting to dry;

5. adding TMB substrate color development solution, 100 mu L/hole, and reacting for 10min at 37 ℃ in a dark place;

6. 2M H was added₂SO₄Stop solution, 50 μ L/well, OD detection by microplate reader₄₅₀The value is obtained.

Mapping was performed using origin8.5, as OD₄₅₀The values are plotted on the ordinate and the logarithm of the concentration of the maduramicin solution is plotted on the abscissaThe inhibition standard curve was plotted using Origin software, see FIG. 5, and the IC was calculated₅₀。

Inhibition ratio (%) - (B)₀-B)/B₀]X 100%. B represents the OD of the test well, B₀Represents the OD of the blank control well. The concentration of the maduramicin solution when the inhibition rate is 50 percent is the IC of the monoclonal antibody₅₀The value is obtained. IC (integrated circuit)₅₀15.43ng/mL, linear range 5.41-43.99 ng/mL.

EXAMPLE four preparation of MAD Immunomagnetic beads

Immunomagnetic bead preparation principle As shown in FIG. 6, 3B4-scFv was coupled with carboxylated magnetic beads (2 μm) activated with EDC and NHS (N-hydroxysuccinimide) to prepare MAD immunomagnetic beads. The method comprises the following specific steps:

activation of magnetic beads

And mixing the magnetic bead samples uniformly, sucking 100 mu L (namely 1mg) of the magnetic bead samples into 3 1.5mL centrifugal tubes respectively, mixing the magnetic bead samples uniformly in a vortex mode, placing the mixture on a magnetic separation rack for magnetic separation for 3min, and removing the supernatant. The magnetic bead samples were washed by adding 200. mu.L of a pre-cooled Washing Buffer at 4 ℃ and vortexed for 15s, followed by immediate magnetic separation and removal of the supernatant. 100. mu.L of activated magnetic beads of NHS (10mg/ml) were added and the mixture was placed on a vertical mixer and activated at 25 ℃ for 30 min. Washing with MEST 200 μ L, mixing by vortex for 10s, magnetically separating for 3min on a magnetic separation rack, removing supernatant, washing repeatedly for 2 times, and removing supernatant.

Secondly, coupling the antibody and the magnetic bead (preparing immunomagnetic bead)

1) The maduramicin single chain antibody solution obtained in example one was diluted with a PBST solution (0.05% Tween-20 in phosphate buffer, pH7.4, 0.01M) to obtain a single chain antibody dilution with a protein concentration of 1.0 mg/mL.

2) Adding 15 mu L of the single-chain antibody dilution liquid obtained in the step 1) into a centrifuge tube containing activated magnetic beads, and uniformly mixing by vortex for 30 s. The mixture was mixed vertically for 1.5h at room temperature for magnetic bead coupling with 3B 4-scFv. The reaction was vortexed for 30min, 15s every 5min, followed by 15s every 15 min. Magnetic beads are enriched by a magnetic separation frame and supernatant is stored for detecting the coupling effect.

3) Adding 200 mu L of confining liquid (3M ethanolamine) into the magnetic beads obtained in the step 2), vortexing for 30s, enriching the magnetic beads through a magnetic separation frame, and discarding the supernatant. Repeat 4 times.

4) Adding the magnetic beads obtained in the step 3) into 200 mu L of sealing liquid in a centrifuge tube, vortexing for 30s, placing the centrifuge tube in a vertical mixer for reacting for 2h at room temperature to seal the activated residues of the unconjugated 3B4-scFv, enriching the magnetic beads through a magnetic separation frame, and discarding the supernatant.

5) And (3) adding 200 mu L of ultrapure water into the magnetic beads obtained in the step 4) in a centrifuge tube, fully mixing, and enriching the magnetic beads through a magnetic separation rack.

6) Adding 200 mu L of Storage Buffer into the magnetic beads obtained in the step 5) to a centrifuge tube, fully mixing, enriching the magnetic beads through a magnetic separation rack, and discarding the supernatant. This operation was repeated 2 times.

7) And (4) adding the magnetic beads obtained in the step (6) into a 100 mu LStorage Buffer, fully mixing, and storing at 4 ℃ for later use.

The prepared 3B4-scFv solution was mixed with PBST to a concentration of 0.3mg/mL, 0.4mg/mL, 0.5mg/mL, 100. mu.L each of different concentrations of 3B4-scFv solutions was coupled with 1mg of magnetic beads using the method described above, the supernatant of step 2) was magnetically separated and retained, the concentration of 3B4-scFv in the supernatant was determined using the BCA kit, 3 replicates of each supernatant were taken, the average of the concentrations was taken, and the remaining amount of antibody in the supernatant was calculated from the volume of 100. mu.L.

The coupling rate of the 3B4-scFv to the magnetic beads is as follows: the Coupling rate (Coupling rate) was calculated to be greater than 80% for all the 3B4-scFv solutions with different concentrations (antibody addition amount-remaining amount of supernatant antibody)/antibody addition amount, which is more effective. As shown in FIG. 7(A), the results of the coupling rates were found to be 83.8% and 68.6% in the case where the amounts of antibody added were 40. mu.g and 50. mu.g, respectively, although the coupling rates were 33.5. mu.g and 34.3. mu.g, respectively, with no significant difference therebetween. When the magnetic bead coupled antibody is not saturated, the addition amount of the antibody is in positive correlation with the coupling rate, and when the concentration of the antibody is too high, the coupling sites are saturated, and the rest of the antibody cannot be coupled, so that the coupling effect of the magnetic bead is influenced. Therefore, the optimum amount of antibody to be added was 40. mu.g, and the amount of antibody coupled to the immunomagnetic beads prepared at this time was 33.1 mg/g.

The optimized preparation method of the immunomagnetic beads is specifically as follows.

1) The maduramicin single chain antibody solution obtained in example one was diluted with a PBST solution (0.05% Tween-20 in phosphate buffer, pH7.4, 0.01M) to obtain a single chain antibody dilution with a protein concentration of 0.4 mg/mL.

2) Adding 15 mu L of the single-chain antibody dilution liquid obtained in the step 1) into a centrifuge tube containing activated magnetic beads, and uniformly mixing by vortex for 30 s. The mixture was mixed vertically for 1.5h at room temperature for magnetic bead coupling with 3B 4-scFv. The reaction was vortexed for 30min, 15s every 5min, followed by 15s every 15 min. Magnetic beads were enriched by magnetic separation shelves.

7) And (4) adding the magnetic beads obtained in the step (6) into 100 mu L of Storage Buffer in a centrifuge tube, fully mixing, and storing at 4 ℃ for later use.

Third, simulating the enrichment and separation of MAD in the sample by immunomagnetic beads and optimizing

The immunomagnetic bead purification method is specifically as follows.

1. Adding 500 mu L of maduramicin solution prepared by adopting adsorption solution and maduramicin standard substance into an immunomagnetic bead centrifugal tube synthesized by the optimized preparation method of immunomagnetic beads, uniformly mixing in a vortex manner, performing antigen capture for 30min on a shaking table at 37 ℃ to ensure that the antigen (namely maduramicin) fully reacts with the immunomagnetic beads, and reserving supernatant after magnetic separation for measuring the antigen capture rate. The immunomagnetic beads were washed 3 times with PBST solution.

2. And adding 500 mu L of eluent into the magnetic beads, resuspending the magnetic beads, uniformly mixing by vortex, reacting for 30min on a shaking table at 37 ℃ to elute the antigen, then carrying out magnetic separation by adopting a magnetic separation frame, and storing supernatant, wherein the supernatant is the sample to be detected by the ICELSA.

3. The tubes were washed by adding 500. mu.L of 0.01M PBS pH7.4, vortexed, and the supernatant was removed by magnetic separation and repeated 3 times. Finally, the immunomagnetic beads were resuspended in 100. mu.L Storage Buffer in a centrifuge tube and stored at 4 ℃ until use.

4. The supernatant after 1: 10 fold dilution was assayed using icELSA, which was the same as the icELSA method in example 2, except that the maduramicin solution of different concentrations after gradient dilution was replaced with the supernatant after 1: 10 fold dilution. The concentration of the supernatant after 1: 10-fold dilution was obtained according to the standard curve prepared in example three. And (2) calculating the residual amount of the antigen in the supernatant according to the concentration of the supernatant diluted by 1: 10 times in the step (1), wherein the adsorption rate is (antigen adding amount-residual amount of the antigen in the supernatant)/antigen adding amount. And (3) calculating the antigen amount in the eluent according to the concentration of the supernatant diluted by the time of 1: 10 in the step (1), and calculating the antigen amount captured by the magnetic beads according to the concentration of the supernatant diluted by the time of 1: 10 in the step (2), wherein the elution rate is equal to the antigen amount in the eluent/the antigen amount captured by the magnetic beads.

The optimization of the immunomagnetic bead purification method is specifically as follows.

1. Optimization of antigen capture time

The method is adopted for antigen capture, the capture time is respectively 15min, 30min and 60min, the adsorption solution is 5% methanol-PBS solution, the concentration of the maduramicin solution is 500ng/mL, and the eluent is 50% methanol water.

The supernatant obtained in step (1) is diluted 1: 10 times and then detected by an ICELISA, the relationship between Capture time (Capture time) and antigen Capture efficiency is shown in FIG. 7(B), and OD is determined when Capture time is 15min and 30min₄₅₀The increase is obvious, which indicates that the antigen is still not captured in the 15-30min period, and the OD is 60min when the capture time is₄₅₀Has no great difference with 30 min. The antigen capture time was chosen to be 30 min.

2. Optimization of adsorption liquids

MADs are not readily soluble in water and are readily soluble in organic solvents. Therefore, the adsorption solution is properly added with the solvent, which is beneficial to dissolving the MAD and improving the efficiency of capturing the antigen by the immunomagnetic beads, but the overhigh organic solvent influences the biological activity of the scFv and is not beneficial to the specific combination of the antigen and the antibody. Methanol is used as an organic solvent, and has little influence on the physicochemical properties and biological activity of the antibody, so 0, 5%, 10% and 20% methanol-PBS solutions are respectively selected as adsorption solutions, and a closed blank magnetic bead is used as a blank control. The method is adopted for antigen capture, the capture time is 30min, the adsorption solution is 0, 5%, 10% and 20% methanol-PBS solution respectively, the concentration of the maduramicin solution is 500ng/mL, and the eluent is 50% methanol water.

The supernatant of step (2) was diluted 1: 10 times and then detected by an ICELISA, and the result is shown in FIG. 7(C), and 5% methanol-PBS was selected as the adsorption solution.

3. Optimization of antigen addition

The method is adopted for antigen capture, the capture time is 30min, the adsorption solution is 5% methanol-PBS solution, the concentration of the maduramicin solution is 100ng/mL, 250ng/mL, 500ng/mL and 750ng/mL, closed blank magnetic beads are used as blank control, and the eluent is 50% methanol water.

The supernatant obtained in step (1) was diluted 1: 10 times and then subjected to an ICELISA, and the results are shown in FIG. 7(D), where OD was measured at 100ng/mL to 500ng/mL with increasing antigen addition₄₅₀There was no major change, OD when the antigen was added at a concentration of 750ng/mL₄₅₀The concentration of the antigen in the supernatant is obviously reduced, namely the concentration of the antigen in the supernatant is increased, so that the optimal antigen adding concentration is 500ng/mL, namely the adding amount of the antigen is 250 ng. The immunomagnetic beads prepared by the method are suitable for enriching the sample to be detected with the maduramicin content of less than or equal to 500 ng/mL.

4. Optimization of methanol content of eluent

The method is adopted for antigen capture, the capture time is 30min, the adsorption solution is 5% methanol-PBS solution, the concentration of the maduramicin solution is 500ng/mL, and the eluates are water, 25% methanol water, 50% methanol water, 75% methanol water and pure methanol respectively.

Diluting the supernatant obtained in the step (2) by 1: 10 times and then usingThe elution effect of the ICELISA assay is shown in FIG. 7(E), OD of the eluate from 0 to 50% methanol content₄₅₀OD of confining liquid at gradually decreasing, 50% to 100% methanol content₄₅₀There is no major change. Based on the effect of high concentration of organic solvent on antibody activity, 50% methanol water was selected as the optimal eluent.

5. Reproducibility of immunomagnetic beads

With the repeated use of the immunomagnetic beads, part of the magnetic beads are lost in the magnetic separation process, so that the antigen capture effect of the immunomagnetic beads is influenced. The method is adopted to continuously capture the antigen for 5 times by the immunomagnetic beads, the capture time is 30min, the adsorption solution is 5% methanol-PBS solution respectively, the concentration of the maduramicin solution is 500ng/mL, and the eluent is 50% methanol water.

And (2) diluting the supernatant obtained in the step (1) by 1: 10 times, and detecting by an ICELISA method, wherein the result is shown in FIG. 7(F), the antigen capture rate is reduced along with the increase of the use times of the immunomagnetic beads, and the reuse times of the immunomagnetic beads are selected to be 3 times for ensuring that the immunomagnetic beads completely capture the antigen.

Fourthly, enriching and separating the MAD in the sample by the immunomagnetic beads

1. Weighing 2.0g (+ -0.02 g) of a sample, adding 5mL of methanol, mixing at 24000rpm for 10s in a homogenizer, oscillating for 5min on a vortex oscillator, centrifuging at 4 ℃ and 5000rpm for 10min, taking supernatant, blowing nitrogen at 37 ℃ for drying, and re-dissolving with 2mL of 5% methanol-PBS solution to obtain the sample to be detected.

2. Adding 500 mu L of the prepared sample to be detected into an immunomagnetic bead centrifugal tube synthesized by the optimized preparation method of the immunomagnetic beads, uniformly mixing by vortex, reacting for 30min on a shaking table at 37 ℃ to ensure that the sample and the immunomagnetic beads fully react, and washing the immunomagnetic beads for 3 times by using a PBST solution after magnetic separation.

3. And adding 500 mu L of 50% methanol water into the magnetic beads, resuspending the magnetic beads, uniformly mixing by vortex, reacting for 30min on a shaking table at 37 ℃ to elute the antigen, then carrying out magnetic separation by adopting a magnetic separation frame, and storing supernatant, wherein the supernatant is the sample to be detected by the ICELISA.

4. The tubes were washed by adding 500. mu.L of 0.01M PBS pH7.4, vortexed, and the supernatant was removed by magnetic separation and repeated 3 times. Finally, the immunomagnetic beads were resuspended in 100. mu.L Storage Buffer in a centrifuge tube and stored at 4 ℃ until use.

EXAMPLE V detection of Madurycin content in samples

First, matrix effect

1. Sample pretreatment: weighing 2.0g (+ -0.02 g) of a blank chicken sample (namely a chicken sample without additionally added maduramicin), adding 5mL of methanol, mixing for 10s at 24000rpm in a homogenizer, shaking for 5min on a vortex oscillator, centrifuging for 10min at 4 ℃ and 5000rpm, taking supernatant, blowing nitrogen at 37 ℃ for drying, and re-dissolving with 2mL of 5% methanol-PBS solution.

2. And adding a proper amount of MAD standard substance into the pretreated sample to obtain a sample to be detected, wherein the concentration of the MAD in the sample to be detected is 0ng/mL, 0.9ng/mL, 2.7ng/mL, 8.1ng/mL, 24.3ng/mL, 72.9ng/mL, 218.7ng/mL and 656.1ng/mL respectively.

3. Adding 500 mu L of the prepared sample to be detected into an immunomagnetic bead centrifugal tube synthesized by the optimized preparation method of the immunomagnetic beads, uniformly mixing by vortex, reacting for 30min on a shaking table at 37 ℃ to ensure that the sample and the immunomagnetic beads fully react, and washing the immunomagnetic beads for 3 times by using a PBST solution after magnetic separation.

4. And adding 500 mu L of 50% methanol water into the magnetic beads, resuspending the magnetic beads, uniformly mixing by vortex, reacting for 30min on a shaking table at 37 ℃ to elute the antigen, then carrying out magnetic separation by adopting a magnetic separation frame, and storing supernatant, wherein the supernatant is the sample to be detected by the ICELISA.

5. The matrix-spiking curve was established by the method of "establishment of standard curve for iclELISA" in example three, and the matrix effect was analyzed by comparing with the standard curve of 5% methanol-PBS in FIG. 5.

The results are shown in FIG. 8, where the matrix is the matrix spiked curve prepared previously and the solvent is the standard curve of 5% methanol-PBS in FIG. 5. The matrix labeling IC50 is 15.72ng/mL, the linear range is 5.06-48.78ng/mL, the two are basically consistent, the immunomagnetic bead purification effect is good, and the influence of the matrix on the iciELISA can be ignored.

Second, measuring accuracy and precision

1. Sample pretreatment: weighing 2.0g (+ -0.02 g) of a blank chicken sample (namely a chicken sample without maduramicin), adding 5mL of methanol, mixing at 24000rpm for 10s in a homogenizer, adding an MAD standard substance diluted by 5% methanol-PBS solution, wherein the concentration (addition value) of the MAD standard substance in the mixture is 0ng/mL, 0.9ng/mL, 2.7ng/mL, 8.1ng/mL, 24.3ng/mL, 72.9ng/mL, 218.7ng/mL and 656.1ng/mL, shaking the mixture on a vortex shaker for 5min, centrifuging at 5000rpm for 10min at 4 ℃, taking a supernatant, blowing and drying at 37 ℃ by nitrogen, redissolving by using 2mL of 5% methanol-PBS solution, and diluting by 10 times by using 5% methanol-PBS solution as a sample to be detected.

4. And (2) detecting the concentration of the MAD in the sample to be detected by the ICELISA by adopting a method for detecting the MAD in the sample enriched by the magnetic beads by the indirect competitive ELISA (second step), and further calculating the actually measured concentration (actually measured value) of the MAD standard substance added in the blank chicken sample.

5. The recovery rate and the coefficient of variation were calculated from the recovery rate (%) measured value/added value × 100% and the coefficient of variation equal to the standard deviation of recovery rate/average value.

The detection result shows that the addition recovery rate is 72.93-89.51%, the variation coefficient in the day is not more than 15%, the requirements of the veterinary drug residue test technical specification on accuracy and precision are met, and the method can be used for residue detection of actual samples.

Method for detecting maduramicin content in sample

(one) MAD in enriched sample of magnetic beads

1. Weighing 2.0g (+ -0.02 g) of a sample, adding 5mL of methanol, mixing in a homogenizer at 24000rpm for 10s, oscillating on a vortex oscillator for 5min, centrifuging at 4 ℃ and 5000rpm for 10min, taking supernatant, blowing nitrogen at 37 ℃ for drying, and re-dissolving with 2mL of 5% methanol-PBS solution to obtain the sample to be detected.

(II) Indirect competitive ELISA for detecting MAD in magnetic bead enriched sample

1. The MAD-OVA coating original solution is taken and diluted by PBS solution with pH 7.410mM containing 5% methanol to obtain the coating original with the concentration of 1 mu g/mL (protein), the coating original is added to an enzyme label plate, 100 mu L/hole is incubated for 12h at 4 ℃, then the supernatant is discarded, and the solution is washed by 1 XPBST solution and dried by patting.

2. Add blocking solution (5% skim milk), incubate at 150. mu.L/well for 1h at 37 ℃, discard the supernatant, wash with 1 XPBST 3 times, pat dry.

3. mu.L of the sample for the ICELISA obtained in step (I) and 50. mu.L of 1.5. mu.g/mL dilution of single-chain antibody (1.5. mu.g/mL concentration of the maduramicin single-chain antibody solution obtained in example one was diluted to 1000-fold volume with 5% methanol in PBS at pH 7.410 mM) were added to each well, incubated at 37 ℃ for 30min, washed 3 times with 1 XPBST solution, and blotted dry with absorbent paper.

4. mu.L of horseradish peroxidase-labeled goat anti-mouse IgG antibody (5000-fold dilution) was added to each well, incubated at 37 ℃ for 1h, washed 3 times with 1 XPBST solution, and blotted dry with absorbent paper.

5. 100 μ L of TMB developing solution was added to each well, and the reaction was carried out at 37 ℃ for 10min in the absence of light.

6. Add 50. mu.L of 2M H to each well₂SO₄Stop solution, enzyme-linked immunosorbent assay (OD)₄₅₀The value is obtained.

7. And (5) obtaining the content of the maduramicin in the sample according to the prepared matrix standard curve and the reading of the microplate reader obtained in the step 5.

Fourth, determining detection limit

And (3) detecting the chicken sample by using the established method, taking 20 blank chicken samples, carrying out pretreatment and then carrying out iclELISA detection, taking the average value of OD450 to reduce by 3 times of standard deviation, and taking the concentration on the corresponding substrate standard curve as the detection Limit (LOD).

The detection result shows that the detection limit of the chicken is 6.31 mug/kg, and the MAD sample exceeding the detection limit (1ng/mL) of the conventional immunodetection method is detected.

The present invention has been described in detail above. It will be apparent to those skilled in the art that the invention can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the invention and without undue experimentation. While the invention has been described with reference to specific embodiments, it will be appreciated that the invention can be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains. The use of some of the essential features is possible within the scope of the claims attached below.

Sequence listing

<110> university of agriculture in China

<120> detection method of maduramicin or maduramicin content and single-chain antibody thereof

<130> 212199

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 753

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

atggacatta ttctcaccca atctccacct tctttggctg tgtctctagg gcagagagcc 60

accgtctcct gcagagccag tgaaagtgtt gaatattttg gcacaagttt aatgcagtgg 120

taccaacaga aacccggaca gccacccaag ctcctcatct ttgctgcatc caacgtaaat 180

tctggggtcc ctgccagatt tagtggcagt gggtctggga cagacttcag cctcaacatc 240

catcctgtgg aggaggatga tattacaatg tatttctgtc accaaagtag gaaatttccg 300

ttcacgttcg gaggggggac caaactggaa ataaaacggg ctggtggtgg tggttctggc 360

ggcggcggct ccggtggtgg tggatccgat gtgcagcttc aggaatcagg acctgacctg 420

gtgaaacctt ctcagtcact ttcactcacc tgcactgtca ctggctattc catctccagt 480

ggttatacct ggcactggat ccggcagttt cctagaaaca cactggaatg tatgggttat 540

atacattaca gtggtaccac taattacagc ccatctctca aaagtcgaat ctctatcact 600

cgagacacat ccaaaaacca gttcttcctg cagttgaatt ctgtgactac tgaggacaca 660

gccacatatt tctgtgcaag tttctactat ggtgactcct cttactatgg tttggactac 720

tggggtcagg gaacctcagt caccgtctcc tcc 753

<210> 2

<211> 251

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 2

Met Asp Ile Ile Leu Thr Gln Ser Pro Pro Ser Leu Ala Val Ser Leu

1 5 10 15

Gly Gln Arg Ala Thr Val Ser Cys Arg Ala Ser Glu Ser Val Glu Tyr

20 25 30

Phe Gly Thr Ser Leu Met Gln Trp Tyr Gln Gln Lys Pro Gly Gln Pro

35 40 45

Pro Lys Leu Leu Ile Phe Ala Ala Ser Asn Val Asn Ser Gly Val Pro

50 55 60

Ala Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Ser Leu Asn Ile

65 70 75 80

His Pro Val Glu Glu Asp Asp Ile Thr Met Tyr Phe Cys His Gln Ser

85 90 95

Arg Lys Phe Pro Phe Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys

100 105 110

Arg Ala Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly

115 120 125

Ser Asp Val Gln Leu Gln Glu Ser Gly Pro Asp Leu Val Lys Pro Ser

130 135 140

Gln Ser Leu Ser Leu Thr Cys Thr Val Thr Gly Tyr Ser Ile Ser Ser

145 150 155 160

Gly Tyr Thr Trp His Trp Ile Arg Gln Phe Pro Arg Asn Thr Leu Glu

165 170 175

Cys Met Gly Tyr Ile His Tyr Ser Gly Thr Thr Asn Tyr Ser Pro Ser

180 185 190

Leu Lys Ser Arg Ile Ser Ile Thr Arg Asp Thr Ser Lys Asn Gln Phe

195 200 205

Phe Leu Gln Leu Asn Ser Val Thr Thr Glu Asp Thr Ala Thr Tyr Phe

210 215 220

Cys Ala Ser Phe Tyr Tyr Gly Asp Ser Ser Tyr Tyr Gly Leu Asp Tyr

225 230 235 240

Trp Gly Gln Gly Thr Ser Val Thr Val Ser Ser

245 250

Claims

1. A single chain antibody or antigen-binding portion thereof to maduramicin, characterized by: the single-chain antibody or antigen-binding portion thereof comprises a heavy chain variable region and a light chain variable region, both of which are composed of a determinant complementary region and a framework region; the determinant complementarity region is composed of CDR1, CDR2 and CDR 3;

2. The single chain antibody, or antigen binding portion thereof, of claim 1, wherein: the amino acid sequence of the heavy chain variable region is shown as 131-251 of SEQ ID No.2, and the amino acid sequence of the light chain variable region is shown as 2-115 of SEQ ID No. 2.

3. The single chain antibody, or antigen binding portion thereof, of claim 1 or 2, wherein: the amino acid sequence of the single-chain antibody or the antigen binding part thereof is shown as SEQ ID No. 2.

4. A biological material associated with the single chain antibody or antigen binding portion thereof of any one of claims 1 to 3, wherein the biological material is any one of:

B1) a nucleic acid molecule encoding the single chain antibody or antigen binding portion thereof of any one of claims 1-3;

B2) an expression cassette comprising the nucleic acid molecule of B1);

B3) a recombinant vector comprising the nucleic acid molecule of B1);

B4) a recombinant vector comprising the expression cassette of B2);

B5) a recombinant microorganism comprising the nucleic acid molecule of B1);

B6) a recombinant microorganism comprising the expression cassette of B2);

B7) a recombinant microorganism containing the recombinant vector of B3);

B8) a recombinant microorganism comprising the recombinant vector of B4).

5. The biomaterial of claim 4, wherein: B1) the nucleic acid molecule is a gene encoding the single-chain antibody or the antigen-binding portion thereof according to any one of claims 1 to 3, wherein the gene is a DNA molecule according to the following A) or B):

6. Immunomagnetic beads, characterized in that: the immunomagnetic beads have the single-chain antibody or the antigen-binding portion thereof according to any one of claims 1 to 3 coupled to the bead surface.

7. A product for detecting maduramicin or maduramicin content, characterized in that: comprising the single chain antibody or antigen binding portion thereof of any one of claims 1-3.

8. Product for enrichment of maduramicin, characterized in that: comprising the immunomagnetic bead of claim 6.

9. Use of a single chain antibody or antigen binding portion thereof according to any one of claims 1 to 3, a biological material according to claim 4 or 5, an immunomagnetic bead according to claim 6, a product according to claim 7 or a product according to claim 8 in any one of:

(1) preparing a product for detecting maduramicin, or detecting maduramicin;

(3) preparing a product enriched with maduramicin, or enriching maduramicin.

10. The method for detecting the content of maduramicin or maduramicin is characterized by comprising the following steps: comprises that

(1) Treating a sample with the immunomagnetic beads according to claim 6 to obtain an ICELISA sample to be detected;

(2) determining whether the sample contains maduramicin or the maduramicin content in the sample by using maduramicin as a coating antigen, using the single-chain antibody or the antigen-binding portion thereof of any one of claims 1 to 3 as a primary antibody and detecting the sample to be detected by the iclelisa obtained in the step (1) by indirect enzyme-linked immunosorbent assay.