CN113897414A

CN113897414A - Trace nucleic acid library construction method

Info

Publication number: CN113897414A
Application number: CN202111179328.0A
Authority: CN
Inventors: 王永利; 贺田芬; 鞠巍; 汤链; 徐根明; 郭杰安
Original assignee: Hunan Yearth Biotechnological Co ltd
Current assignee: Hunan Yearth Biotechnological Co ltd
Priority date: 2021-10-11
Filing date: 2021-10-11
Publication date: 2022-01-07

Abstract

The invention discloses a trace nucleic acid library construction method. The method comprises the following steps: (1) obtaining fragmented DNA single strands or cDNA which are subjected to 5 'end phosphorylation and 3' end hydroxylation treatment; (2) carrying out 3' end auxiliary connection on the DNA fragment obtained in the step (1) and extending into a DNA double strand; (3) and (3) connecting a joint to the 5' end of the DNA double strand obtained in the step (2), and then carrying out double-template substrate amplification to obtain a library. The method improves the efficiency of preparing the trace library, reduces the purification steps, and has great significance for constructing the library by the trace DNA starting materials.

Description

Trace nucleic acid library construction method

Technical Field

The invention belongs to the technical field of molecular biology, and particularly relates to a construction method of a trace single-stranded nucleic acid library.

Background

Nucleic acid is a generic term for deoxyribonucleic acid (DNA) and ribonucleic acid (RNA), and is a biological macromolecular compound synthesized by polymerizing many nucleotide monomers, which is one of the most basic substances of life. Among naturally occurring nucleic acids, ribonucleic acid (RNA) is mostly present in single-stranded and hairpin forms, and is also found in small amounts in circular forms. Deoxyribonucleic acid (DNA) exists mainly in a double-stranded form of double helix, and also exists partially in a single-stranded form. In the fields of biotechnology such as nucleic acid detection, in vitro diagnosis, gene sequencing, and the like, nucleic acids are also produced in a single-stranded form during various treatments of the nucleic acids. For example, organisms with single-stranded DNA or single-stranded RNA as genetic material such as human transfusion virus (TTV), parvovirus, and the like exist in nature. Sequencing studies of the genetic material of these organisms are not easily accomplished using traditional NGS library construction methods. In the forensic field, DNA or RNA extracted from rotten various human-derived materials such as bone, nails, hair, etc. has often been highly degraded into single-stranded fragmented nucleic acids and is already in trace amounts (e.g., pg or fg scale). There is currently no efficient means for library preparation for these trace amounts of fragmented nucleic acids. In addition, the DNA methylation detection also involves a step of heavy salt conversion of the DNA, and most of the DNA after heavy salt conversion becomes relatively short fragmented single-stranded DNA. A particularly efficient technique is also lacking for the treatment of these single-stranded nucleic acids.

Disclosure of Invention

The object of the present invention is to provide a method by which library preparation can be performed on trace amounts of nucleic acids (DNA or RNA). The method is independent of the double-stranded structure of the DNA. The method has high library preparation efficiency, and is widely suitable for trace single-stranded or double-stranded DNA and RNA with various lengths.

The object of the present invention is achieved as follows.

A method for constructing a trace single-stranded nucleic acid library comprises the following steps:

(1) obtaining fragmented DNA single strands or cDNA which are subjected to 5 'end phosphorylation and 3' end hydroxylation treatment;

(2) carrying out 3' end auxiliary connection on the DNA fragment obtained in the step (1) and extending into a DNA double strand;

(3) and (3) connecting a joint to the 5' end of the DNA double strand obtained in the step (2), and then carrying out double-template substrate amplification to obtain a library.

The length of the DNA fragment obtained in the step (1) is 10bp-1000 bp; preferably 50bp to 800bp, and more preferably 100bp to 300 bp.

The process of the step (2) adopts any one of the following modes:

1) a, DNA fragment for 3' end assisted ligation two artificially synthesized nucleotide fragments were used: the auxiliary sub-and the connector are connected: the linker is connected with the 3 'end tailing sequence of the DNA, the 3' end sequence of the helper is complementary with the 3 'end tailing sequence of the DNA, and the 5' end of the helper is complementary with the linker; the 3 'ends of the helper and the linker need to be blocked to prevent tailgating enzyme in the system from tailgating the 3' ends of the helper or the linker; adding an extension primer into the system after the connection of the connexon, wherein the extension primer performs position competition with the helper through annealing; the extension primer successfully competes to the position to extend the DNA double strand under the action of polymerase;

B. on the basis of the mode A, auxiliary ligation is performed using a short helper whose helper 5 ' end is at least 5 bases shorter than the long linker 3 ' end, and then complementary strand polymerization of the DNA fragment is performed using an extension primer complementary to the linker in the 3 ' direction; the polymerase needs to have strand displacement activity or 5 'to 3' direction exo-activity to remove the attached helper; the short helper allows space for the extension primer to bind at the 3' end of the linker, and there is no problem of helper competition with the extension primer compared to scheme a.

C. On the basis of the mode A, the helper contains at least 1 specially modified base or base analogue, and comprises: RNA base, deoxyhypoxanthine, or abasic sites; after the connection reaction of the connexons is finished, carrying out enzyme digestion by using RnaseH or Endonuclease IV to repair DNA damage without base site enzyme, so that the auxiliary molecules are broken and the hydroxyl groups of polymerase extension polymerization are exposed; deblocking and polymerizing by using polymerase to form a DNA fragment complementary strand;

D. on the basis of the mode A, an RNA helper is used for replacing a DNA helper, the RNA helper is degraded in high temperature or ribonuclease A (RNaseA), and the degraded RNA helper does not compete with the position of the extension primer; the RNA helper does not need to be closed at the 3' end; the ligase capable of performing DNA strand ligation on the DNA and RNA hybrid strands is preferably: SplintR ligase, followed by complementary strand polymerization of the DNA fragment using the extension primer.

2) The DNA fragment is subjected to 3' end auxiliary connection, an artificially synthesized nucleotide fragment auxiliary seed and dNTP are used, the dNTP is a mixture of common dNTP and hot-start dNTP, the common dNTP is selected from any one, two or three of the four dNTPs, and the hot-start dNTP is selected from the remaining three, two or one corresponding to the common dNTP; carrying out tailing reaction of the DNA fragment by using the common dNTP at a lower temperature; then, a higher temperature is given to the system, so that the hot-started dNTP enters an activated working state; then, a relatively low temperature is given, the helper is complementarily combined with the tailing sequence at the 3 'end of the DNA fragment, finally, the DNA polymerase respectively takes the helper and the DNA fragment as templates to extend forwards until the complementary strand of the helper extends out by taking the helper as a template and the complementary strand of the DNA fragment extends out by taking the DNA fragment as a template, the 3' end of the helper contains the sequence which is complementary with the tailing of the DNA fragment, and the 3 'end needs to be sealed to prevent the tailing enzyme in the system from carrying out 3' tailing on the helper;

3 ' end of the helper is blocked by phosphate group modification or C3Spacer modification, so that base designed at the 3 ' end of the helper is not complementary to a DNA chain, and deblocking is carried out by adding high-fidelity polymerase or other enzymes with 3 ' exo-activity to cut non-complementary base;

alternatively, the 3 'end of the helper is blocked with a phosphate group or a C3spacer, the last base at the 3' end of the helper is not required to be a non-complementary base, and the helper contains at least 1 specifically modified base or base analog, including: RNA base, deoxyhypoxanthine, or abasic sites; after the connection reaction of the connexons is finished, carrying out enzyme digestion by using RnaseH or Endonuclease IV to repair DNA damage without base site enzyme, so that the auxiliary molecules are broken and the hydroxyl groups which can be extended and polymerized by polymerase are exposed; then, the complementary strand of the DNA fragment is formed by deblocking and polymerization with a polymerase.

In the 1) above mode:

the process of auxiliary connection and extension of the 3' end of the DNA fragment into a DNA double strand comprises the following steps: the reaction is carried out in the same reaction system or in two reaction systems;

if the reaction is carried out in the same reaction system, a mixture of common dNTP and hot-start dNTP is required to be added into the system, the common dNTP selects any one, two or three of the four dNTPs, and the hot-start dNTP corresponds to the remaining three, two or one of the selected common dNTPs; carrying out tailing reaction of the DNA fragment by using the common dNTP at a lower temperature; then, the linker is connected with the DNA fragment with the help of the helper, and then a higher temperature is applied to the system, so that the hot-started dNTP enters an activated working state; finally, giving a relatively low temperature, using an assistant or a primer, and using the DNA fragment as a template to extend forwards to obtain a complementary strand of the DNA fragment;

if the processes of auxiliary connection and extension of the 3' end of the DNA fragment into a DNA double strand are not carried out in the same reaction system, hot-started dNTP is not needed, but common dNTP is adopted, a higher temperature of a donor system is not needed, and the hot-started dNTP enters a process of an activated working state; one, two or three of the four common dNTPs are used for tailing, and the four common dNTPs are used for extension.

The common dNTP selects any one, two or three of the four dNTPs, and the hot-started dNTP corresponds to the remaining three, two or one of the selected common dNTPs; for example: it can be understood that: one common dNTP is selected, and the other three kinds of hot start dNTPs are selected; two common dNTPs are selected, and the other two hot start dNTPs are selected; three kinds of common dNTPs are selected, and the other one is selected as the hot start dNTP.

In the 1) above mode:

the blocking mode is a modification which can prevent the extension of the DNA 3' end, and comprises the following steps: any one of a phosphate group modification, a C3Spacer modification or an RNA base modification.

Further, the air conditioner is provided with a fan,

or, the 3 'end of the helper is blocked by phosphate group or C3spacer, the last base at the 3' end of the helper is a non-complementary base, and the helper contains at least 1 specially modified base or base analogue, including: RNA base, deoxyhypoxanthine, or abasic sites; after the connection reaction of the connexons is finished, carrying out enzyme digestion by using RnaseH or Endonuclease IV to repair DNA damage without base site enzyme, so that the auxiliary molecules are broken and the hydroxyl groups which can be extended and polymerized by polymerase are exposed; deblocking and polymerizing by using polymerase to form a DNA fragment complementary strand;

the RNA base modification mode is that at least the 1 st base at the 3' end of the helper adopts RNA base for blocking; the RNA basic group is rA, rG, rC or rU, and the blocking is released through high-temperature treatment.

Specifically, the non-complementary blocked base is dropped under high temperature (e.g., 95 ℃) to expose the 3' hydroxyl group of the helper, and polymerase in the donor system is used for polymerization to generate the template complementary strand.

In the 1) above mode: the 3' end of DNA fragments for auxiliary connection using two artificially synthesized nucleotide fragments, the helper and linker interactions with DNA before connection occurs will produce three intermediates: product 1: the 3 'end tail of the DNA and the linker are exactly and completely complementary with the help of the helper, and there is no base gap or redundant region between the 3' end tail of the DNA and the linker, and then the product is connected by the DNA ligase through forming a phosphodiester bond; and (3) a product 2: a base gap is formed between the tail of the 3 'end of the DNA and the 5' end of the connexon, and the DNA ligase is used for connection after the gap is polymerized and supplemented by the DNA polymerase; and (3) a product: there is base redundancy between the 3 'end tail of the DNA and the 5' end of the linker, and the redundant bases need to be cut off by endonuclease or exonuclease and then ligated by DNA ligase.

Further, the air conditioner is provided with a fan,

the DNA3 'helper ligation reduces or eliminates the production of product 3 by limiting the number of bases of the helper to be less than 10 complementary to the DNA 3' tail.

Further, the air conditioner is provided with a fan,

the length range of the linker is 5-80nt, preferably 10-60nt, further preferably 20-50nt, the length range of the auxiliary linker is 5-80nt, preferably 10-60nt, further preferably 20-50 nt; the tailing length ranges from 1 nt to 30nt, preferably from 2 nt to 25nt, and further preferably from 3 nt to 20 nt; the length of the extended primer is in the range of 5 to 75nt, preferably 8 to 70nt, and more preferably 10 to 60 nt.

Further, the air conditioner is provided with a fan,

if the process of the auxiliary connection and the extension of the 3' end of the DNA fragment into the DNA double strand is carried out in the same reaction system, the reaction is carried out for 1 minute to 60 minutes at the temperature of 25 ℃ to 42 ℃, and the tailing of the DNA fragment is carried out by utilizing the common dNTP; then, connecting the DNA fragment to both the linker and the helper, and reacting at 90-100 ℃ for 5 seconds-60 minutes to enable the hot-started dNTP to enter an activated working state; finally reacting for 5 seconds to 60 minutes at the temperature of 42 ℃ to 75 ℃ to obtain the complementary strand of the DNA fragment.

If the process of auxiliary connection and extension of the 3 'end of the DNA fragment into a DNA double strand is not carried out in the same reaction system, the 3' end auxiliary connection reaction program: 1 minute to 60 minutes at 25 ℃ to 42 ℃; 5 seconds to 60 minutes at 55 ℃ to 75 ℃; extension into DNA double strand reaction program: 5 seconds to 60 minutes at 55 ℃ to 75 ℃.

Reacting for 1-60 minutes at 25-42 ℃, wherein in the temperature range, mainly tail addition of terminal transferase and DNA ligase connection are performed, and only common dNTP types can be added in tail addition; reacting at 90-100 deg.C for 5 s-60 min, adding tail end transferase, inactivating DNA ligase, activating dNTP, denaturing helper from DNA chain, deblocking RNA when the RNA block is at the temperature, or degrading the whole RNA helper at the temperature; the reaction is carried out at 42 ℃ to 75 ℃ for 5 seconds to 60 minutes, if the DNA helper is present in the system, the helper can be reannealed to bind to the original position of the DNA in the temperature range in which the helper containing the mismatched base at the 3' end can be cleaved by the high fidelity polymerase to effect deblocking, and the enzyme for the polymerase to extend or cleave the helper comes into action.

In general, each enzyme used in the present invention functions only at a specific step sequence and a specific temperature. If the primer is adopted in the system and the tailing, auxiliary connection and extension are carried out in a total reaction system, the 5' end of the primer is closed in a mode including RNA base, and if the extension is not connected with the tailing and auxiliary connection in the same reaction system, the primer does not need to be closed.

Further, the air conditioner is provided with a fan,

the concentration of the helper in the total reaction system is 10nM-20uM, preferably 50nM-10uM, and more preferably 100nM-5 uM.

The concentrations of the linker and the auxiliary in the total reaction system are as follows: 1: 1-1: 10, preferably 1: 3-1: 5, further preferably 1: 5;

the total amount of DNA fragments in the total reaction system is 1fmol-1nmol/50 uL;

the concentration of the extended primer in the total reaction system is 10nM-10uM, preferably 20nM-1uM, and more preferably 50nM-200 nM;

the concentration range of RNA auxiliary seed in the total reaction system is 10nM-50 uM; preferably 50nM to 5uM, more preferably 150nM to 500 nM;

the concentration of common dNTP in the total reaction system is 2uM-2 mM; preferably 10uM to 1 mM; further preferably 30uM to 0.5 mM; the concentration of common dNTP in the total reaction system is 1-3 times of that of each hot start dNTP.

Further, the air conditioner is provided with a fan,

DNA ligases for ligation include: one or more of T4DNA ligase, T3DNA ligase, T7DNA ligase, Taq DNA ligase, e.coli DNA ligase, 9 ° N DNA ligase, splntr ligase; the concentration of the ligase in the reaction system is 0.02U/uL-2U/uL;

the polymerase used for polymerization comprises one or more of T4DNA polymerase, E.coli DNA polymerase I, Klenow large fragment, DNA polymerase I (E.coli), T7DNA polymerase and Bsu DNA polymerase large fragment; the concentration of polymerase in the reaction system is 0.01U/uL-2U/uL;

the enzyme for cutting off the redundant bases between the tail end of the DNA3 'end and the 5' end of the connector comprises one or more of T4DNA polymerase, DNA polymerase I Klenow large fragment, DNA polymerase I and endonuclease FEN 1; the concentration in the reaction system is 0.01U/uL-2U/uL, preferably 0.1U/uL-1U/uL, and further preferably 0.2U/uL-0.8U/uL;

the concentration range of terminal transferase in the reaction system is 0.15U/uL-15U/uL, preferably 0.3U/uL-3U/uL, and further preferably 0.5U/uL-2U/uL;

polymerases having strand displacement activity or exo-activity in the 5 'to 3' direction include: at least one of VentDNA polymerase, Deep VentDNA polymerase, phi29DNA polymerase, Bsu DNA polymerase large fragment, BstDNA polymerase full length, wild type Taq polymerase, preferably: at least one of 2G Robust DNA polymerase, rTaq DNA polymerase and TaqB DNA polymerase, wherein the concentration in the reaction system is 0.01U/uL-20U/uL, preferably 0.1U/uL-10U/uL, and further preferably 0.5U/uL-2U/uL;

RnaseH or Endonuclase IV repair DNA damage without base site enzyme, the concentration in the reaction system is 0.01U/uL-5U/uL, preferably 0.1U/uL-2U/uL, and further preferably 0.2U/uL-1U/uL;

enzymes that cleave non-complementary bases for deblocking with high fidelity polymerases or other 3' exo-active enzymes include: one or more of the kata HIFI hot start high fidelity polymerase, pfu DNA polymerase and phusion DNA polymerase; the concentration in the reaction system is 0.01U/uL to 20U/uL, preferably 0.04U/uL to 5U/uL, and more preferably 0.1U/uL to 0.5U/uL.

Further, the air conditioner is provided with a fan,

and (3) connecting the 5' end connector by using a connection reinforcing agent, wherein the connection reinforcing agent comprises: 3-dimethylamino-1, 2-propanediol, R- (-) -1, 2-propanediol, (S) - (-) -1, 1-diphenyl-1, 2-propanediol, (S) - (+) -1, 2-propanediol, hydroxypropyl methacrylate, tripropylene glycol, butyl propylene glycol, (S) - (+) -3-chloro-1, 2-propanediol, (R) - (-) -3-chloro-1, 2-propanediol acetonide, 1, 2-diacetoxypropane, (S) - (-) -propylene carbonate, (R) - (+) -propylene carbonate, 3-amino-1, 2-propanediol, propylene glycol, and propylene glycol, and propylene glycol, propylene, At least one of propylene glycol methyl ether, 1-thioglycerol, (R) -3-amino-1, 2-propylene glycol, tris (2-carboxyethyl) phosphate, propylene glycol methyl ether acetate, and 1, 2-propylene glycol; the concentration (W/W) in the reaction system is 0.1% to 50%, preferably 1% to 10%, and more preferably 2% to 6%.

For a better understanding of the present invention, various specific examples for achieving the object of the present invention are described in more detail below.

Fragmenting nucleic acid: the starting template of the present invention may be double-stranded or single-stranded DNA, or may be RNA. Can be various lengths from 10bp to 1000 bp. Preferably 50bp to 800bp, and more preferably 100bp to 300 bp. If the DNA or RNA is too long, the fragmentation process is first required. The fragmentation protocol may be one commonly used in the genetic testing industry. For example, the long double-stranded DNA can be subjected to ultrasonication, endonuclease cleavage, or the like. The long-chain RNA may be treated with divalent metal ions at a high temperature of 95 ℃ or higher. Not only the treatment method exemplified above but also any method capable of efficiently fragmenting nucleic acids may be used. Fragmentation is not necessary if the nucleic acid itself is already a shorter fragment.

Phosphorylation and hydroxylation treatment of the 3 'end of cDNA 5': for RNA molecules, reverse transcription may be performed using a reverse transcription primer phosphorylated at the 5 ' end, so that the product of reverse transcription is a cDNA phosphorylated at the 5 ' end and hydroxylated at the 3 ' end, which satisfies the conditions. Modification of 5' end phosphorylation may also be performed during reverse transcription or at the same time during reverse transcription using an enzyme with similar effect as the T4PNK enzyme. For the DNA molecule, 5 '-end phosphorylation modification and 3' -end hydroxylation treatment can be performed using an enzyme having the same effect as that of the T4PNK enzyme. The processing method of the step is not limited to the described scheme, and any processing scheme capable of achieving the same effect can be implemented in the invention.

Nucleic acid 3' end tailing: the 3' tailing of nucleic acids can be accomplished in a number of ways. Such as RNA terminal adenylyl transferase, with ATP or an analog thereof as a precursor, and a single nucleotide is added to the 3' terminal tail of the nucleic acid. If the 3 ' end of the nucleic acid is tailed in this way, the steps of the present invention may be reversed, for example, the 3 ' end of the nucleic acid is tailed first, then the 3 ' end is assisted for ligation, then reverse transcription of RNA is performed, etc. The 3' end of the nucleic acid can also be tailed using terminal transferase (TdT) with one or two or three of the A, T, G, C4 dNTPs as material. The number of tails added can be from 1 base to tens of bases. The length of the added tail can be controlled by adjusting the concentration of the various dNTPs.

In some cases it may contain one or two or three of the modified dNTPs, making them unusable by the tailing enzyme or polymerase enzyme at lower temperatures and only usable by the enzyme at higher temperatures. A similar example of such a modifiable dNTP is the TriLINK Hot Start dNTP. In some cases, the next reaction, i.e., the auxiliary ligation of DNA3 'end, can be performed in the same reaction system and reaction conditions as the nucleic acid 3' end tailing reaction.

Auxiliary connection of DNA 3' end: the auxiliary connection of the DNA 3' end can use two artificially synthesized nucleotide fragments, an accessory seed and a linker. The 3 ' terminal sequence of the helper can be complementary to the tailing sequence at the 3 ' end of the nucleic acid and the 5 ' end of the helper can be partially complementary to the linker. The 3' ends of the helper and linker in this protocol need to be blocked to avoid the DNA tailing reaction mistaking the helper for template DNA for mistailing. The inventors have surprisingly found in the course of the present invention that in certain suitable reaction systems, the helper and linker do not require a prior additional annealing reaction. This makes possible subsequent experiments based on the decomposition of the helper molecule by a heating reaction. Since the facilitator is intended to be decomposed by a subsequent heating reaction, the facilitator and the linker cannot undergo an annealing reaction by thermal denaturation and annealing prior to the ligation event. The specific feasible process is as follows: in the reaction system, the helper first finds and complementarily binds to the 3 'terminal sequence of the nucleic acid to which the helper has been added, and the linker also binds to the 5' terminal sequence of the helper. Three types of products are possible here (see FIG. 3): product 1: the 3' end tail of the DNA is exactly completely complementary to the linker with the help of the helper without a base gap or redundant region between them, at which time the product can be ligated by DNA ligase by forming a phosphodiester bond; and (3) a product 2: a base gap is arranged between the tail of the 3 'end of the DNA and the 5' end of the connexon, and the gap is polymerized and supplemented by DNA polymerase and then connected by the DNA ligase; and (3) a product: the 3 'end tail of the DNA and the 5' end of the linker have base redundancy, and the redundant bases are cut off by endonuclease or exonuclease and then are connected by DNA ligase. Helper ligation of DNA3 ' can also reduce or eliminate the production of product 3 by limiting the number of bases that the helper is complementary to the tail of DNA3 ' (i.e., the number of complementary bases at the 3 ' end of the helper) (see FIG. 4). For example, the number of bases complementary to the end-to-end of DNA3 in the helper is reduced to 10 or 9 or 8 or 7 or 6 or 5 or 4 or 3 or 2 or 1. Since the helper is first complementary to the bases near the tail of the ' end of DNA3, reducing the number of bases to which the helper is complementary to the tail of the ' end of DNA3 not only significantly reduces or eliminates the production of product 3 in fig. 3, but also reduces the number of bases that are tailed at the ' end of DNA 3. Sequencing of the tailing base at the end of DNA 3' has no significance in NGS sequencing, so that the sequencing method is favorable for reducing the sequencing of meaningless bases and reducing the sequencing cost. The auxiliary connection of the DNA 3' end can also use only one artificially synthesized nucleotide fragment, i.e., an auxiliary. The specific principle of the scheme is (as shown in figure 5): the dNTPs in the system are a mixture of ordinary dNTPs and hot-start dNTPs. For example, as an example given in FIG. 5, dNTPs are ordinary dATP and hot-start dTTP, dCTP, dGTP. The method is suitable for DNA tailing reaction at a lower temperature, and the suitable tailing enzyme can only add common dATP to the 3' end of DNA. The donor system is then brought to a higher temperature to activate the hot-started dTTP, dCTP, dGTP. The helper is complementarily bound to the DNA3 'tail by a relatively low temperature, and then extended forward by DNA polymerase along the 3' tail of the DNA until the helper is used as a template to extend the complementary strand of the helper. The 3' end of the helper in the scheme needs to be closed so as to avoid the DNA tailing reaction from mistakenly considering the helper as the template DNA for carrying out the false tailing operation. The benefit of this scheme is that the three intermediates of the scheme of fig. 3 are not produced, and there is no need to link the three intermediates. Another advantage of this protocol is that DNA tailing and DNA 3' end-assisted ligation can be performed in one reaction system. Improving efficiency and reducing purification steps. This is significant for traces of DNA starting material. Another preferred embodiment of the auxiliary ligation of DNA 3' is shown in FIG. 6: the last base at the 3 'end of the helper is not complementary to the tail at the end of DNA 3'. The non-complementary bases (exemplified as G bases in FIG. 6) and the block are cleaved off by the corresponding orthotropic enzyme in the system under appropriate temperature conditions to expose the 3' hydroxyl group of the helper, which is polymerized by the polymerase in the donor system to form the template complementary strand. The advantage of this scheme is that not only the three intermediates in the scheme of FIG. 3 are not generated, but more importantly, DNA tailing, DNA 3' end assisted ligation, and template strand extension can be performed in one reaction system. Further improving efficiency and reducing operational steps. In another solution, a long linker and a short helper can be used for the secondary connection (see fig. 7). The complementary strand of the template strand is then polymerized using a short extension primer complementary to the 3' side of the linker. In this solution the polymerase needs to have strand displacement activity or exo activity in the 5 'to 3' direction. The advantage of this preferred embodiment is that the helper has no competitive relationship with the extension primer, ensuring high efficiency extension of the extension primer. In another preferred solution a long helper and a long linker can be used (see fig. 8). The long helper may contain 1 or more specifically modified bases or base analogues. Such as RNA bases, deoxyhypoxanthine, abasic sites, and the like. After the connection reaction of the connexons is finished, enzyme digestion can be carried out by using non-base site enzymes such as RnaseH or Endonuclease IV and the like for repairing DNA damage, so that the long auxiliary molecules are broken and the hydroxyl groups which can be extended and polymerized by polymerase are exposed. And then deblocking and polymerizing by polymerase to form a template complementary strand. The advantage of this preferred embodiment is that no additional extension primer is required to compete with the blocked helper, ensuring high efficiency in the formation of double-stranded extension products. In another preferred solution an RNA helper may be used. The ligation of this protocol is performed with a specific ligase (e.g., SplintR ligase, NEB, # M0375). As shown in FIG. 9, the preferred embodiment has the advantage that the first helper is a nucleic acid fragment of RNA bases, and the 3' end of the nucleic acid fragment does not need special base blocking, thereby saving the cost. Second, the helper base of the RNA base is more easily removed completely during the reaction (e.g., using RNase or the like) to prevent it from competing with the extended primer in subsequent extension reactions.

Converting and extending an extension primer: in some protocols described in the previous step (DNA 3' end assisted ligation), the conversion of the extension primer and the extension reaction have been performed simultaneously. In the extension reaction, various qualified DNA polymerases, such as high fidelity DNA polymerase, various Taq DNA polymerases, etc., can be used. Taq DNA polymerase is preferred for this step in the present invention because the extended product has an A base overhang at the 3' end. Products of this nature are of paramount importance in the following ligation step.

5' end joint connection: this reaction is complete to ligate the double stranded or partially double stranded DNA adaptor into the double stranded extension product. The adaptor for ligation depends on the characteristics of the double-stranded extension product. If a high fidelity polymerase (or a polymerase with exo activity in the 3 'to 5' direction) is used for extension then the product is blunt ended, the ligation linker used accordingly should also be blunt ended. If a polymerase not having exo activity in the 3 'to 5' direction, such as Taq DNA polymerase or the like, is used for extension, the product is a3 'sticky end with A bases, and the adaptor used correspondingly is a 3' sticky end adaptor with T bases. The latter variant is preferably used in the present invention. Since the latter scheme firstly ensures that the double-stranded extension products and the double-stranded linkers are not self-ligated, i.e., ensures that only the double-stranded extension products and the double-stranded linkers are ligated. More importantly, this ligation scheme allows both the upper and lower strands of the double stranded extension product to be ligated to the adaptor sequence. This also means that this approach further exploits the otherwise scarce trace amount of template DNA. Furthermore, the inventors of the present invention have surprisingly found that the use of certain chemicals as bonding enhancers in the bonding system can greatly improve the efficiency of bonding. This clearly further improves the library transformation efficiency of trace nucleic acids in comparison to the 30% -50% ligation efficiency prevalent in the industry.

Amplification of a dual-template substrate: as described in the previous step, in the preferred embodiment of the present invention, since the adaptor sequence is ligated to both the nucleic acid template itself and its extended complementary strand, library amplification can be performed using universal primers, resulting in a one-fold higher library yield in the PCR amplification exponential phase than in the case where only one strand (the nucleic acid template itself or its complementary strand) is ligated.

Drawings

FIG. 1 is a technical process of the present invention using RNA as an example;

FIG. 2 is a detail of the present invention;

FIG. 3 is three structures of products to be ligated;

FIG. 4 is a graph showing the effect of the number of DNA tailed bases on the ratio of three products to be ligated;

FIG. 5 is a scheme using hot-start dNTPs;

FIG. 6 is a preferred scheme using hot-start dNTPs;

FIG. 7 is a scheme for avoiding helper competition with the extension primer;

FIG. 8 is a scheme in which extension of the primer is not required;

FIG. 9 is a scheme of ligation of RNA as a helper;

FIG. 10 is a gel diagram of the library of example 1;

FIG. 11 is a gel diagram of the library of example 2;

FIG. 12 is the library gel of example 3;

FIG. 13 is the library gel of example 4;

FIG. 14 is a gel diagram of the library of example 5;

FIG. 15 is a gel diagram of the ligation product of example 6.

Detailed Description

The following examples are intended to further illustrate the invention without limiting it.

Example 1

Long-chain RNA molecule library preparation

Arabidopsis mRNA was extracted using a commercial kit. A library was constructed from 500pg of mRNA. Reverse transcription primer P1 sequence:

5’P-NNNNNNNN-3’

1. fragmentation of nucleic acids

The reaction system is as follows:

the reaction was carried out at 70 ℃ for 1.5 minutes.

Qiagen column purification.

Reverse transcription of RNA

The reaction system is as follows:

fragmenting mRNA	11uL
		Reverse transcription primer P1(0.3ug/uL)	1uL
Total volume	12uL

The reaction was carried out at 65 ℃ for 5 minutes and immediately placed on ice.

The following reaction reagents are prepared:

5x First Strand Buffer	4uL
		DTT(100mM)	2uL
dNTP(10mM each)	1uL
		Rnase inhibitor	0.5uL
total volume	7.5uL

The 12uL RNA-containing reaction system from the previous step was added to 7.5uL reagent.

After 2 minutes of reaction at 25 ℃ Superscript III reverse transcriptase was added immediately

1 uL. After mixing uniformly, the following reactions are carried out:

the mixture was stored at 25 ℃ for 10 minutes, 42 ℃ for 50 minutes, and 4 ℃.

Qiagen column purification after completion of the reaction.

cDNA 3' end tailing and assisted ligation

Helper a1 sequence:

GTGACTGGAGTTCAGACGTGT-ap-CTCTTCCGATCTTTTT-C3 (3' end C3spacer closed) sequence is shown in SEQ ID NO.1,

(ap is a vacant base site that can be cleaved by a specific enzyme, such as the enzyme Tth Endonuclease IV in this example)

Linker L1 sequence:

the sequence of p-AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC-C3 (3' end C3spacer closed) is shown in SEQ ID NO. 2;

the reaction system is as follows:

30uL of cDNA was stored on a PCR instrument at 95 ℃ for 1 minute and 4 ℃.

The 20uL reaction mixture was added to the cDNA and mixed well.

The PCR product was stored at 37 ℃ for 10 minutes, 65 ℃ for 15 minutes and 4 ℃ on a PCR instrument.

4. Converting and extending the extended primer

In step 3 of this example, the conversion of the helper to the extension primer has been completed by the enzymatic cleavage of the helper, and therefore, only the extension reaction solution needs to be prepared.

The following reaction solution was prepared:

20uL of the reaction solution was added to the reaction system completed in step 3.

The samples were stored at 72 ℃ for 12 minutes and 4 ℃ on a PCR instrument.

2x Ampure xp beads.

5.5' end fitting connection

5' end fitting ADT1 preparation:

ADT1-U:

AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT, the sequence is shown in SEQ ID NO. 3;

ADT1-D:

p-GATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG, the sequence is shown in SEQ ID NO. 4;

mixing the amounts of ADT1-U and ADT1-D, and annealing to double strand at 98 deg.C for 2 min in PCR instrument.

The following reaction system was prepared:

the samples were stored in a PCR apparatus at 25 ℃ for 15 minutes, at 65 ℃ for 20 minutes and at 4 ℃.

2x Ampure xp beads.

6. Dual template substrate amplification

The amplification primer sequences are as follows:

PCR-F1:

AATGATACGGCGACCACCGA, the sequence is shown in SEQ ID NO.5,

PCR-R1:

CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCAGACGT, the sequence is shown in SEQ ID NO.6,

the amplification reaction system is as follows:

ligation product	33uL
		5x buffer A	10uL
2G Robust DNA polymerase (5U/uL)	1uL
		dNTP(2.5mM)	4uL
Primer PCR-F1(10uM)	1uL
		Primer PCR-R1(10uM)	1uL
Total volume	50uL

The amplification procedure was as follows:

the final library was run on a 2% agarose gel at 5 uL.

The experimental results of example 1 are shown in fig. 10.

Example 2

Method for position competition of extension primer and helper

A180 bp PCR product with phosphorylated 5' end was obtained.

1.3' end auxiliary connection

Helper a2 sequence:

GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTTTTT-C3 (3' end C3spacer closed) sequence is shown in SEQ ID NO.7,

linker L1 sequence:

p-AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC-C3 (3' end C3spacer closed) extension primer Y1 sequence:

the sequence of GTGACTGGAGTTCAGACGTGTGCTCTTCCGATrC (3' end RNA base rC is closed) is shown in SEQ ID NO.8,

the reaction system is as follows:

30uL of 30ng of 180bp PCR product was stored on a PCR machine at 95 ℃ for 1 minute and 4 ℃.

The 20uL reaction mixture was added to the DNA and mixed well.

The samples were stored in a PCR apparatus at 37 ℃ for 10 minutes, 95 ℃ for 2 minutes, 72 ℃ for 5 minutes, and 4 ℃.

Purification was performed using 2X AmpureXP beads.

2.5' end fitting connection

5' end fitting ADT1 preparation:

ADT1-U:

AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTADT1-D:

the 5' end linker ADT1 was prepared by mixing amounts of p-GATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTGADT1-U and ADT1-D, and annealing the mixture at 98 ℃ for 2 minutes in a PCR instrument to double strand by slowly cooling the mixture to room temperature.

The following reaction system was prepared:

2x Ampure xp beads.

3. Dual template substrate amplification

The amplification primer sequences are as follows:

PCR-F1:

AATGATACGGCGACCACCGA

PCR-R1:

CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCAGACGT

the amplification reaction system is as follows:

The amplification procedure was as follows:

the final library was run on a 2% agarose gel at 5 uL.

The experimental results of example 2 are shown in fig. 11.

Example 3

Method for carrying out DNA tailing, DNA 3' end auxiliary connection and template strand extension in same reaction system

Take 180bp PCR product.

Helper A3 sequence (3' blocked with C3 spacer):

TTCAGACGTGTGCTCTTCCGATCTTTTTTTTTTTTTTG-C3 is shown in SEQ ID NO.9,

1. the reaction system is as follows:

30uL (10ng) of 180bp PCR product was stored at 95 ℃ for 1 minute and 4 ℃ on a PCR instrument.

The 20uL reaction mixture was added to the DNA and mixed well.

The samples were stored in a PCR apparatus at 37 ℃ for 10 minutes, 95 ℃ for 10 minutes, 72 ℃ for 15 minutes, and 4 ℃.

2x Ampure xp beads.

2.5' end fitting connection

5' end fitting ADT1 preparation:

ADT1-U:

AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT

ADT2-D:

the sequence of p-AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG is shown in SEQ ID NO.10,

ADT1-U and ADT2-D were mixed and annealed into double strands at 98 ℃ for 2 minutes in a PCR instrument, and then 5' end linker ADT2 was prepared.

The following reaction system was prepared:

2x Ampure xp beads.

3. Dual template substrate amplification

The amplification primer sequences are as follows:

PCR-F1:

AATGATACGGCGACCACCGA

PCR-R1:

CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCAGACGT

the amplification reaction system is as follows:

the amplification procedure was as follows:

the final library was run on a 2% agarose gel at 5 uL.

The experimental results of example 3 are shown in fig. 12.

Electrophoresis results FIG. 12 shows that the use of the helper A4 whose 3' end is not perfectly matched in this example in combination with a high fidelity polymerase enables efficient library construction.

Example 4

Method for making auxiliary connection using long connector and short auxiliary connector

10ng of PCR product of 220bp was taken.

Helper a4 sequence:

CTCTTCCGATCTTTTT-C3 (3' end is blocked by C3 spacer) is shown in SEQ ID NO.11,

linker L1 sequence:

p-AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC-C3 (C3 spacer closed 3' end)

Extension primer Y2 sequence:

GTGACTGGAGTTCAGACG is shown in SEQ ID NO.12,

The 20uL reaction mixture was added to the DNA and mixed well.

The PCR product was stored at 37 ℃ for 10 minutes, 65 ℃ for 20 minutes and 4 ℃ in a PCR apparatus.

The following reaction system was prepared

50uL of the reaction solution was added to the 50uL reaction system completed in the above step.

The samples were stored at 72 ℃ for 12 minutes and 4 ℃ on a PCR instrument.

2x Ampure xp beads.

2.5' end fitting connection

5' end fitting ADT1 preparation:

ADT1-U:

AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT

ADT1-D:

p-GATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG

ADT1-U and ADT1-D were mixed and annealed into double strands at 98 ℃ for 2 minutes in a PCR instrument, and then 5' end linker ADT1 was prepared.

The following reaction system was prepared:

2x Ampure xp beads.

3. Dual template substrate amplification

The amplification primer sequences are as follows:

PCR-F1:

AATGATACGGCGACCACCGA

PCR-R1:

CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCAGACGT

the amplification reaction system is as follows:

the amplification procedure was as follows:

the final library was run on a 2% agarose gel at 5 uL.

The experimental results of example 4 are shown in fig. 13.

Example 4 shows that this library can be efficiently constructed using a long linker and a short helper in combination with an extension primer that does not compete with the helper.

Example 5

Method for assisted ligation using RNA as helper

A180 bp PCR product with phosphorylated 5' end was obtained.

1.3' end auxiliary connection

Helper a5 sequence:

rUrArCrArGrrGrrGrUrGrUrGrrGrrCrUrCrrUrUrCrCrCrCrArrCrUrUrUrUrUrUrU, the sequence of which is shown in SEQ ID NO.13,

linker L1 sequence:

p-AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC-C3

extension primer Y1 sequence:

GTGACTGGAGTTCAGACGTGTGCTCTTCCGATrC

the reaction system is as follows:

30ng of 180bp PCR product was stored on a PCR instrument at 95 ℃ for 1 minute and 4 ℃.

The 20uL reaction mixture was added to the DNA and mixed well.

The PCR product was stored at 30 ℃ for 10 minutes, 95 ℃ for 2 minutes, 72 ℃ for 5 minutes, and 4 ℃ on a PCR instrument.

Purification was performed using 2X AmpureXP beads.

2.5' end fitting connection

5' end fitting ADT1 preparation:

ADT1-U:

AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT

ADT1-D:

p-GATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG

The following reaction system was prepared:

2x Ampure xp beads.

3. Dual template substrate amplification

The amplification primer sequences are as follows:

PCR-F1:

AATGATACGGCGACCACCGA

PCR-R1:

CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCAGACGT

the amplification reaction system is as follows:

the amplification procedure was as follows:

the final library was run on a 2% agarose gel at 5 uL.

The experimental results of example 5 are shown in fig. 14.

Example 6

Connection enhancer for 5' end joint connection to improve connection efficiency

The following oligonucleotide sequences were artificially synthesized:

OLG1 sequence:

ACCTTTCTTTTCCAATGTTACTTGGTTCCATGCTATACATGTCTCA sequence shown in SEQ ID NO.14, OLG2 sequence:

GAGACATGTATAGCATGGAACCAAGTAACATTGGAAAAGAAAGGTA sequence shown in SEQ ID NO.15, ADT1 sequence:

AGATCGGAAGAGCACT sequence shown in SEQ ID NO.16, ADT2 sequence:

GTGCTCTTCCGATCT is shown in SEQ ID NO.17,

the OLG1 sequence and the OLG2 sequence anneal to form about 47bp OLG double-stranded DNA with A bases suspended at the 3 'end of both ends, and the ADT1 sequence and the ADT2 sequence anneal to form about 16bp ADT double-stranded linker with T bases suspended at the 3' end of one end.

19 reagents commonly used in laboratories were selected as ligation enhancers, from which reagents having an enhancing effect on the ligation reaction were selected. The experimental system is as follows:

s0 is a negative control with no T4DNA ligase added.

S1 is a positive reaction control without an enhancer.

The corresponding enhancers and proportional concentrations are given in the following table:

the ligation product was run on 4% agarose gel.

The results of the experiment of example 6 are shown in FIG. 15.

The experimental results show that S4, S5, S6, S9, S13, S14, S15, S16, S19 and S20 have a relatively obvious enhancement effect on the connection reaction in the concentration range in the examples.

Sequence listing

<110> same-year-old-Earth Biotechnology Co., Ltd, Hunan

<120> a trace nucleic acid library construction method

<160> 17

<170> SIPOSequenceListing 1.0

<210> 1

<211> 37

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

gtgactggag ttcagacgtg tctcttccga tcttttt 37

<210> 2

<211> 34

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

agatcggaag agcacacgtc tgaactccag tcac 34

<210> 3

<211> 58

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

aatgatacgg cgaccaccga gatctacact ctttccctac acgacgctct tccgatct 58

<210> 4

<211> 63

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

gatcggaaga gcacacgtct gaactccagt cacatcacga tctcgtatgc cgtcttctgc 60

ttg 63

<210> 5

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

aatgatacgg cgaccaccga 20

<210> 6

<211> 49

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

caagcagaag acggcatacg agatcgtgat gtgactggag ttcagacgt 49

<210> 7

<211> 38

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

gtgactggag ttcagacgtg tgctcttccg atcttttt 38

<210> 8

<211> 33

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

gtgactggag ttcagacgtg tgctcttccg atc 33

<210> 9

<211> 38

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

ttcagacgtg tgctcttccg atcttttttt tttttttg 38

<210> 10

<211> 64

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

agatcggaag agcacacgtc tgaactccag tcacatcacg atctcgtatg ccgtcttctg 60

cttg 64

<210> 11

<211> 16

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

ctcttccgat cttttt 16

<210> 12

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

gtgactggag ttcagacg 18

<210> 13

<211> 29

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

uucagacgug ugcucuuccg aucuuuuuu 29

<210> 14

<211> 46

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

acctttcttt tccaatgtta cttggttcca tgctatacat gtctca 46

<210> 15

<211> 46

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

gagacatgta tagcatggaa ccaagtaaca ttggaaaaga aaggta 46

<210> 16

<211> 16

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

agatcggaag agcact 16

<210> 17

<211> 15

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

gtgctcttcc gatct 15

Claims

1. A trace nucleic acid library construction method is characterized by comprising the following steps:

2. The method according to claim 1, wherein the DNA fragment obtained in step (1) has a length of 10bp to 1000 bp; preferably 50bp to 800bp, and more preferably 100bp to 300 bp.

3. The method of claim 1, wherein the process of step (2) is performed in any one of the following ways:

B. on the basis of the mode A, auxiliary ligation is performed using a short helper whose helper 5 ' end is at least 5 bases shorter than the long linker 3 ' end, and then complementary strand polymerization of the DNA fragment is performed using an extension primer complementary to the linker in the 3 ' direction; the polymerase needs to have strand displacement activity or 5 'to 3' direction exo-activity to remove the attached helper;

D. on the basis of the mode A, an RNA helper is used for replacing a DNA helper, the RNA helper is degraded at high temperature or in ribonuclease A, and the degraded RNA helper does not compete with the extension primer in position; the RNA helper does not need to be closed at the 3' end; the ligase capable of performing DNA strand ligation on the DNA and RNA hybrid strands is preferably: SplintR ligase, followed by complementary strand polymerization of the DNA fragment using an extension primer;

3 ' end of the helper is blocked by phosphate group modification or C3Spacer modification, so that base designed at the 3 ' end of the helper is not complementary to a DNA chain, and deblocking is carried out by adding high-fidelity polymerase or other enzymes with 3 ' exo activity to cut out non-complementary base;

alternatively, the 3 'end of the helper is blocked with a phosphate group or C3spacer, the last base at the 3' end of the helper is not required to be a non-complementary base, and the helper contains at least 1 specifically modified base or base analog, including: RNA base, deoxyhypoxanthine, or abasic sites; after the connection reaction of the connexons is finished, carrying out enzyme digestion by using RnaseH or Endonuclease IV to repair DNA damage without base site enzyme, so that the auxiliary molecules are broken and the hydroxyl groups which can be extended and polymerized by polymerase are exposed; then, the complementary strand of the DNA fragment is formed by deblocking and polymerization with a polymerase.

4. The method of claim 3,

in the 1) above mode:

5. The method of claim 3,

in the 1) above mode:

the blocking mode is a modification which can prevent the extension of the DNA 3' end, and comprises the following steps: any of a phosphate group modification, a C3Spacer modification, or an RNA base modification.

6. The method of claim 5,

alternatively, the 3 'end of the helper is blocked with a phosphate group or C3spacer, the last base at the 3' end of the helper is a non-complementary base, and the helper contains at least 1 specifically modified base or base analog, including: RNA base, deoxyhypoxanthine, or abasic sites; after the connection reaction of the connexons is finished, carrying out enzyme digestion by using RnaseH or Endonuclease IV to repair DNA damage without base site enzyme, so that the auxiliary molecules are broken and the hydroxyl groups which can be extended and polymerized by polymerase are exposed; deblocking and polymerizing by using polymerase to form a DNA fragment complementary strand;

7. The method of claim 3,

8. The method of claim 7,

9. The method of claim 3,

10. The method of claim 3,

if the process of the auxiliary connection and the extension of the 3' end of the DNA fragment into the DNA double strand is carried out in the same reaction system, the reaction is carried out for 1 minute to 60 minutes at the temperature of 25 ℃ to 42 ℃, and the tailing of the DNA fragment is carried out by utilizing the common dNTP; then, connecting the DNA fragment to both the linker and the helper, and reacting at 90-100 ℃ for 5 seconds-60 minutes to enable the hot-started dNTP to enter an activated working state; finally reacting for 5 seconds to 60 minutes at the temperature of 42 ℃ to 75 ℃ to obtain a complementary strand of the DNA fragment;

11. The method of claim 3,

12. The method of claim 3,

the enzyme for cutting off the redundant bases between the tail end of the DNA3 'end and the 5' end of the connexon comprises one or more of T4DNA polymerase, DNA polymerase I Klenow large fragment, DNA polymerase I and endonuclease FEN 1; the concentration in the reaction system is 0.01U/uL-2U/uL, preferably 0.1U/uL-1U/uL, and further preferably 0.2U/uL-0.8U/uL;

13. The method of claim 1,