CN113881810A - Novel detection method for pathogenic microorganisms of coronavirus - Google Patents
Novel detection method for pathogenic microorganisms of coronavirus Download PDFInfo
- Publication number
- CN113881810A CN113881810A CN202111289962.XA CN202111289962A CN113881810A CN 113881810 A CN113881810 A CN 113881810A CN 202111289962 A CN202111289962 A CN 202111289962A CN 113881810 A CN113881810 A CN 113881810A
- Authority
- CN
- China
- Prior art keywords
- primer
- molecular weight
- group
- coronavirus
- protein
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 241000711573 Coronaviridae Species 0.000 title claims abstract description 101
- 238000001514 detection method Methods 0.000 title claims abstract description 90
- 244000000010 microbial pathogen Species 0.000 title claims abstract description 36
- 238000006243 chemical reaction Methods 0.000 claims abstract description 66
- 239000000523 sample Substances 0.000 claims abstract description 53
- 150000007523 nucleic acids Chemical class 0.000 claims abstract description 40
- 230000003321 amplification Effects 0.000 claims abstract description 38
- 238000003199 nucleic acid amplification method Methods 0.000 claims abstract description 38
- 108020004707 nucleic acids Proteins 0.000 claims abstract description 20
- 102000039446 nucleic acids Human genes 0.000 claims abstract description 20
- 238000003752 polymerase chain reaction Methods 0.000 claims description 43
- 239000000203 mixture Substances 0.000 claims description 42
- 238000000034 method Methods 0.000 claims description 40
- 239000000243 solution Substances 0.000 claims description 40
- 108090000623 proteins and genes Proteins 0.000 claims description 29
- 108020004414 DNA Proteins 0.000 claims description 28
- 239000012634 fragment Substances 0.000 claims description 28
- 101710204837 Envelope small membrane protein Proteins 0.000 claims description 27
- 101710145006 Lysis protein Proteins 0.000 claims description 27
- 239000011259 mixed solution Substances 0.000 claims description 26
- 239000002773 nucleotide Substances 0.000 claims description 24
- 125000003729 nucleotide group Chemical group 0.000 claims description 24
- 108090001074 Nucleocapsid Proteins Proteins 0.000 claims description 19
- 238000002330 electrospray ionisation mass spectrometry Methods 0.000 claims description 18
- 230000004544 DNA amplification Effects 0.000 claims description 16
- 108091028043 Nucleic acid sequence Proteins 0.000 claims description 14
- 108700002099 Coronavirus Nucleocapsid Proteins Proteins 0.000 claims description 13
- 101710091045 Envelope protein Proteins 0.000 claims description 9
- 101710188315 Protein X Proteins 0.000 claims description 9
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Chemical compound O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 claims description 8
- 239000002299 complementary DNA Substances 0.000 claims description 7
- 238000011033 desalting Methods 0.000 claims description 7
- 239000000126 substance Substances 0.000 claims description 7
- 102000016928 DNA-directed DNA polymerase Human genes 0.000 claims description 6
- 108010014303 DNA-directed DNA polymerase Proteins 0.000 claims description 6
- 239000011347 resin Substances 0.000 claims description 6
- 229920005989 resin Polymers 0.000 claims description 6
- 108700002856 Coronavirus Envelope Proteins Proteins 0.000 claims description 5
- 230000000295 complement effect Effects 0.000 claims description 4
- 239000008367 deionised water Substances 0.000 claims description 4
- 229910021641 deionized water Inorganic materials 0.000 claims description 4
- 238000007789 sealing Methods 0.000 claims description 4
- 230000001502 supplementing effect Effects 0.000 claims description 4
- 238000000926 separation method Methods 0.000 claims description 3
- 230000004907 flux Effects 0.000 abstract description 8
- 238000000605 extraction Methods 0.000 abstract description 7
- 230000035945 sensitivity Effects 0.000 abstract description 7
- 238000001819 mass spectrum Methods 0.000 abstract description 6
- 238000010612 desalination reaction Methods 0.000 abstract description 4
- 108091032973 (ribonucleotides)n+m Proteins 0.000 description 11
- 101710141454 Nucleoprotein Proteins 0.000 description 11
- 102100021696 Syncytin-1 Human genes 0.000 description 9
- 238000004949 mass spectrometry Methods 0.000 description 7
- 238000002474 experimental method Methods 0.000 description 6
- 241000700605 Viruses Species 0.000 description 5
- 230000008569 process Effects 0.000 description 4
- 102000004169 proteins and genes Human genes 0.000 description 4
- 101710121417 Envelope glycoprotein Proteins 0.000 description 3
- 108010000178 IGF-I-IGFBP-3 complex Proteins 0.000 description 3
- 238000012408 PCR amplification Methods 0.000 description 3
- 239000000427 antigen Substances 0.000 description 3
- 102000036639 antigens Human genes 0.000 description 3
- 108091007433 antigens Proteins 0.000 description 3
- 238000012986 modification Methods 0.000 description 3
- 230000004048 modification Effects 0.000 description 3
- 102000042567 non-coding RNA Human genes 0.000 description 3
- 239000002245 particle Substances 0.000 description 3
- 108091008146 restriction endonucleases Proteins 0.000 description 3
- 241001678559 COVID-19 virus Species 0.000 description 2
- 238000007400 DNA extraction Methods 0.000 description 2
- 108091034117 Oligonucleotide Proteins 0.000 description 2
- 238000010802 RNA extraction kit Methods 0.000 description 2
- 125000003275 alpha amino acid group Chemical group 0.000 description 2
- 238000004458 analytical method Methods 0.000 description 2
- 238000001840 matrix-assisted laser desorption--ionisation time-of-flight mass spectrometry Methods 0.000 description 2
- 108091027963 non-coding RNA Proteins 0.000 description 2
- 102000005962 receptors Human genes 0.000 description 2
- 108020003175 receptors Proteins 0.000 description 2
- 230000009385 viral infection Effects 0.000 description 2
- 101710114810 Glycoprotein Proteins 0.000 description 1
- 108010090054 Membrane Glycoproteins Proteins 0.000 description 1
- 102000012750 Membrane Glycoproteins Human genes 0.000 description 1
- 108010052285 Membrane Proteins Proteins 0.000 description 1
- 101710167605 Spike glycoprotein Proteins 0.000 description 1
- 108010003533 Viral Envelope Proteins Proteins 0.000 description 1
- 108020000999 Viral RNA Proteins 0.000 description 1
- 208000036142 Viral infection Diseases 0.000 description 1
- 230000009286 beneficial effect Effects 0.000 description 1
- 108700010904 coronavirus proteins Proteins 0.000 description 1
- 230000007547 defect Effects 0.000 description 1
- 238000004925 denaturation Methods 0.000 description 1
- 230000036425 denaturation Effects 0.000 description 1
- 238000011161 development Methods 0.000 description 1
- 230000000694 effects Effects 0.000 description 1
- 210000002889 endothelial cell Anatomy 0.000 description 1
- 238000005516 engineering process Methods 0.000 description 1
- 230000002068 genetic effect Effects 0.000 description 1
- 230000007236 host immunity Effects 0.000 description 1
- 230000036737 immune function Effects 0.000 description 1
- 238000004519 manufacturing process Methods 0.000 description 1
- 230000007246 mechanism Effects 0.000 description 1
- 210000004779 membrane envelope Anatomy 0.000 description 1
- 244000052769 pathogen Species 0.000 description 1
- 230000001717 pathogenic effect Effects 0.000 description 1
- 238000012257 pre-denaturation Methods 0.000 description 1
- 238000002331 protein detection Methods 0.000 description 1
- 238000004153 renaturation Methods 0.000 description 1
- 238000011160 research Methods 0.000 description 1
- 238000003757 reverse transcription PCR Methods 0.000 description 1
- 238000005070 sampling Methods 0.000 description 1
- 239000007921 spray Substances 0.000 description 1
- 238000012360 testing method Methods 0.000 description 1
- 229960005486 vaccine Drugs 0.000 description 1
- 230000002792 vascular Effects 0.000 description 1
- 238000012795 verification Methods 0.000 description 1
- 230000008478 viral entry into host cell Effects 0.000 description 1
- 230000029812 viral genome replication Effects 0.000 description 1
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N27/00—Investigating or analysing materials by the use of electric, electrochemical, or magnetic means
- G01N27/62—Investigating or analysing materials by the use of electric, electrochemical, or magnetic means by investigating the ionisation of gases, e.g. aerosols; by investigating electric discharges, e.g. emission of cathode
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Abstract
The invention provides a novel detection method for pathogenic microorganisms of coronavirus. Comprises the steps of nucleic acid extraction, amplification reaction, desalination, mass spectrum detection and the like. The detection method provided by the invention combines various specific primers and probe sequences, and can be used for rapidly detecting the new coronavirus by utilizing an electrospray mass spectrometer. The detection method has the advantages of high flux, low cost, high specificity, high sensitivity and the like, greatly reduces the probability of false positive during detection, and provides technical support for accurate detection of pathogenic microorganisms of the novel coronavirus.
Description
Technical Field
The invention belongs to the technical field of detection of new coronavirus, and particularly relates to a novel detection method of pathogenic microorganisms of coronavirus.
Background
Novel coronaviruses (New coronaviruses, the new coronaviruses 2019 in the present application, also known as 2019-nCoV, SARS-CoV-2, the basic biological structure of which is shown in FIG. 1). In order to control the epidemic situation of the spread of the current new coronavirus in time, the high-throughput detection method is extremely important for quickly diagnosing potential patients, quickly isolating the potential patients and quickly taking measures.
There are two types of conventional detection methods for coronavirus: 1. by detecting coronavirus antigen or antibody proteins. The detection of antigen or antibody protein in a patient in time can reflect that the patient is infected, but because the body produces specific antibodies to viruses for several days to several weeks, and the production of antibodies by patients with poor immune function is not enough to be recognized by the detection method, false negative is easily caused. Antigen-antibody protein detection differs from nucleic acid detection in that it cannot amplify the signal by amplification, resulting in insufficient signal intensity to allow early identification of patients with viral infections. 2. Polymerase Chain Reaction (PCR) techniques, which amplify signals by nucleic acid amplification reactions, are considered to be the most widely used pathogen detection techniques. At present, pathogenic microorganisms mainly pass through an RT-PCR method, but the flux is low, 2-3 hours are needed per sample, and the development of a rapid and high-flux new coronavirus detection method is very necessary.
On the basis, clinical application and experimental application show that the mass spectrometry technology can carry out high-sensitivity detection on the new coronavirus nucleotide. Based on the nucleic acid mass spectrometry method, there are methods that are currently available, the iPLEX method by Agena, USA, and the RFMP method by GENEMatrix, Korea: (1) an iPLEX method, wherein a single base extension step is added on the basis of PCR, and the generated short oligonucleotide fragment is subjected to MALDI-TOF mass spectrometry; (2) RFMP method, through containing single nuclear polymorphism site multiple PCR products restriction enzyme cutting, the short oligonucleotide fragment produced is subjected to MALDI-TOF mass spectrometry detection.
Technical defects of iPLEX method and RFMP method: (1) the experimental process comprises the following steps: the steps of single base extension or restriction are added, so that the operation is complicated and time-consuming; (2) the experimental principle is as follows: the mass spectrometry platform is a mass spectrometry platform based on laser-assisted mechanism analysis-time of flight (MALDI-TOF), and when measuring macromolecular nucleic acid, the sample ionization degree is weak, the sensitivity is poor, and the mass spectrometry platform is only suitable for measuring nucleic acid with low molecular weight (lower than 25 kDa).
Therefore, it is necessary to develop a new rapid and high-throughput method for detecting nucleic acid for application to a new coronavirus.
Disclosure of Invention
In order to solve the above problems, the present invention provides a primer set for a long fragment of a nucleocapsid protein, which is used for detecting a novel coronavirus nucleocapsid protein and is a first primer set;
the first primer set includes: a first forward primer and a first reverse primer;
wherein the nucleotide sequence of the first forward primer comprises the following tag sequence:
TCATAGCACTTCGTTGTAGCTAGCCTATCGGTCAGA。
preferably, the nucleotide sequence of the first forward primer is:
TCATAGCACTTCGTTGTAGCTAGCCTATCGGTCAGATAATCAGA CAAGGAACTGATTA;
the nucleotide sequence of the first reverse primer is as follows:
CGAAGGTGTGACTTCCATG。
in addition, in order to solve the above problems, the present application also provides a primer set of a short fragment of a nucleocapsid protein, which is used for detecting a novel coronavirus nucleocapsid protein and is a second primer set;
the second primer group comprises a second forward primer and a second reverse primer; wherein the content of the first and second substances,
the nucleotide sequence of the second forward primer is as follows:
GGGGAACTTCTCCTGCTAGAAT;
the nucleotide sequence of the second reverse primer is as follows:
AGCAAGAGCAGCATCACC。
in addition, in order to solve the above problems, the present application also provides a primer set of envelope protein gene fragments, which is a third primer set for detecting novel coronavirus envelope proteins;
the third primer group comprises a third E protein forward primer and a third E protein reverse primer; wherein the content of the first and second substances,
the nucleotide sequence of the third E protein forward primer is as follows:
CGTGGTATTCTTGCTAGTTAC;
the nucleotide sequence of the third E protein reverse primer is as follows:
CGCACACAATCGAAGCG。
in addition, in order to solve the above problems, the present application also provides a novel method for detecting pathogenic microorganisms of coronavirus, which is a detection method using a combination of specific primers and probe sequences of the novel coronavirus in combination with polymerase chain reaction amplification-electrospray mass spectrometry, and comprises:
extracting nucleic acid to obtain reaction solution to be detected containing DNA or cDNA;
taking a primer mixed solution containing a specific primer of the novel coronavirus and a probe sequence combination, and carrying out amplification reaction on the primer mixed solution and the reaction solution to be detected to obtain a first PCR product;
desalting the first PCR product to obtain a second PCR product;
purifying the second PCR product, detecting the molecular weight of the amplified gene by using electrospray mass spectrometry, and determining whether the DNA or cDNA in the reaction solution to be detected contains a corresponding target novel coronavirus nucleic acid sequence according to the molecular weight of the amplified gene;
wherein, the primer mixture containing the combination of the specific primer and the probe sequence of the novel coronavirus is a primer mixture containing the following specific primer groups:
a single primer set as one of said first primer set as described above, said second primer set as described above, or said third primer set as described above; alternatively, the first and second electrodes may be,
a plurality of mixed primer sets of the first primer set and the second primer set; alternatively, the first and second electrodes may be,
a plurality of mixed primer sets of the first primer set and the third primer set.
Preferably, the step of determining whether the DNA or RNA in the reaction solution to be tested contains the corresponding target novel coronavirus nucleic acid sequence according to the molecular weight of the gene after amplification comprises:
when the combination of the specific primers and the probe sequences of the novel coronavirus is a primer mixed solution containing the following components, judging that the DNA or cDNA in the reaction solution to be detected contains a corresponding target novel coronavirus sequence:
the primer mixture is a single primer group, and when the first primer group is used, the molecular weight after gene amplification is shown as the following molecular weight, or the molecular weight within the deviation range of plus or minus 5 Da: the molecular weight of a positive chain corresponding to the first forward primer is 44910Da, and the molecular weight of a reverse chain corresponding to the first reverse primer is 45180 Da;
the primer mixture is a single primer group, and when the primer mixture is the second primer group, the molecular weight after gene amplification is shown as the following molecular weight, or the molecular weight within the deviation range of plus or minus 5 Da: the molecular weight of a forward chain corresponding to the second forward primer is 16540Da, and the molecular weight of a reverse chain corresponding to the first reverse primer is 16720 Da;
in the case of the single primer set and the third primer set in the primer mixture, the molecular weight after gene amplification is as follows, or within a deviation range of plus or minus 5 Da: the molecular weight of the positive chain corresponding to the third E protein forward primer is 16860 Da;
when the primer mixture is a mixed primer group, and the mixed primer group is a mixed primer group of the first primer group and the second primer group, the molecular weight after gene amplification is shown as the following molecular weight, or the molecular weight within the deviation range of plus or minus 5 Da: the molecular weight of a positive chain corresponding to the first forward primer is 44910Da, and the molecular weight of a reverse chain corresponding to the first reverse primer is 45180 Da; the molecular weight of a positive chain corresponding to the second forward primer is 16720Da, and the molecular weight of a reverse chain corresponding to the first reverse primer is 16540 Da;
when the primer mixture is a mixed primer group, and the mixed primer group is a mixed primer group of the first primer group and the third primer group, the molecular weight after gene amplification is shown as the following molecular weight, or the molecular weight within the deviation range of plus or minus 5 Da: the molecular weight of a positive chain corresponding to the first forward primer is 44910Da, and the molecular weight of a reverse chain corresponding to the first reverse primer is 45180 Da; and the molecular weight of the positive chain corresponding to the third E protein forward primer is 16860 Da.
Preferably, the step of taking a primer mixture containing a combination of a specific primer and a probe sequence of the novel coronavirus and performing an amplification reaction with the reaction solution to be detected to obtain a first PCR product comprises:
preparing a reaction system: taking the primer mixed solution, the reaction solution to be detected, DNA polymerase and template DNA, supplementing the primer mixed solution, the reaction solution to be detected, the DNA polymerase and the template DNA with sterilized deionized water, sealing the mixture, and placing the mixture in a thermal cycler;
and carrying out amplification reaction on a reaction system configured in a thermal cycler to obtain the first PCR product.
Preferably, the amplification conditions of the amplification reaction are that the first stage is 42 ℃/15min, the second stage is 92 ℃/3min, the third stage is 92 ℃/15s,53 ℃/10s and 60 ℃/35s, and the total cycle is 40;
at least two complementary paired specific primers are contained in each specific primer group, wherein the concentration of each specific primer is 10 mu mol/L.
Preferably, said "desalting said first PCR product to obtain a second PCR product" comprises:
and adding water and resin into the first PCR product, mixing and then carrying out centrifugal separation to obtain a second PCR product.
In addition, in order to solve the above problems, the present application also provides a novel coronavirus pathogenic microorganism detection kit, comprising a primer mixture solution containing a combination of a specific primer and a probe sequence of a novel coronavirus;
the primer mixed solution comprises the following specific primer groups: a single primer set as one of said first primer set as described above, said second primer set as described above, and said third primer set as described above; alternatively, the first and second electrodes may be,
a mixed primer set of the first primer set and the second primer set; alternatively, the first and second electrodes may be,
a mixed primer set of the first primer set and the third primer set.
The invention provides 3 specific primers, a novel detection method for coronavirus pathogenic microorganisms, and a novel detection kit for coronavirus pathogenic microorganisms. Wherein, the specific primer comprises: a primer group for detecting the long fragment of the nucleocapsid protein of the novel coronavirus nucleocapsid protein, a primer group for detecting the short fragment of the nucleocapsid protein, and a primer group for detecting the gene fragment of the envelope protein of the novel coronavirus envelope protein. The novel detection method for the coronavirus pathogenic microorganisms comprises the following steps: nucleic acid extraction, amplification reaction, desalination, mass spectrum detection and the like. The method aims to provide a method for rapidly identifying pathogenic microorganisms such as new coronavirus and the like by polymerase chain reaction amplification-electrospray mass spectrometry combined with specific primers and probe sequences. The method is simple to operate, the sample can be directly detected on a computer after being subjected to PCR amplification of the specific primers, the probe and the gene, the step of single base extension or restriction enzyme cutting is not required, the additional step is not required, and the method is simple and convenient to operate and high in rapid flux.
Compared with a MALDI-TOF detection method, the method can be widely applied to detection of long (above 25kDa) or short (below 25kDa) nucleic acid fragments and is not limited by a nucleic acid molecular weight detection area.
In conclusion, the detection method provided by the invention can be used for rapidly detecting the new coronavirus by combining a plurality of specific primers and probe sequences and utilizing an electrospray mass spectrometer. The detection method has the advantages of high flux, low cost, high specificity, high sensitivity and the like, greatly reduces the probability of false positive during detection, and provides technical support for accurate detection of pathogenic microorganisms of the novel coronavirus.
Drawings
FIG. 1 is a schematic representation of the biological structure of a novel coronavirus;
FIG. 2 is a mass spectrometric detection result of a test reaction using a single primer set of the first primer set as a primer mixture containing a combination of a specific primer of a novel coronavirus and a probe sequence in example 1 of the present application;
FIG. 3 is the mass spectrometric detection result of the detection of the reaction solution to be detected by the primer mixture solution containing the combination of the specific primer and the probe sequence of the novel coronavirus using the single primer set of the second primer set in example 2 of the present application;
FIG. 4 shows the mass spectrometric detection results of the detection of the reaction solution to be detected by the primer mixture solution containing the combination of the specific primer of the novel coronavirus and the probe sequence, using the primer set of the E protein of the third primer set in example 3 of the present application;
FIG. 5 shows the mass spectrometric detection result of the detection of the reaction solution to be detected by the primer mixture solution containing the combination of the specific primer of the novel coronavirus and the probe sequence, in example 4 of the present application, using the mixed primer set of the first primer set and the second primer set;
FIG. 6 shows the mass spectrometric detection result of the detection of the reaction solution to be detected by the primer mixture containing the combination of the specific primer of the novel coronavirus and the probe sequence, which is obtained by using the mixed primer set of the first primer set and the third E protein primer set in example 5 of the present application.
The implementation, functional features and advantages of the objects of the present invention will be further explained with reference to the accompanying drawings.
Detailed Description
The technical solution of the present invention is further described in detail by way of the following specific embodiments, but the present invention is not limited thereto, and any limited number of modifications made by anyone within the scope of the claims of the present invention are still within the scope of the claims of the present invention.
This example provides a primer set of a long fragment of a nucleocapsid protein, which is used for detecting a novel coronavirus nucleocapsid protein and is a first primer set;
the first primer set includes: a first forward primer and a first reverse primer;
wherein the nucleotide sequence of the first forward primer comprises the following tag sequence:
TCATAGCACTTCGTTGTAGCTAGCCTATCGGTCAGA。
the first primer set includes two primers, a first forward primer and a first reverse primer, and at least the nucleotide sequence of the first forward primer includes the tag sequence.
The primer group of the long fragment of the nucleocapsid protein is the primer group of the long fragment of the N protein, is used for detecting the novel coronavirus nucleocapsid protein, can be pertinently suitable for detecting the long fragment of the N protein nucleic acid fragment, and particularly can be used for detecting the long fragment of the nucleic acid fragment with the length of more than 25 kDa. The selection range expands the limitation of the existing detection method (MALDI-TOF related method only can be used for below 25kDa), improves the sensitivity and the application range, and reduces the probability of false positive in detection.
Preferably, the nucleotide sequence of the first forward primer is:
TCATAGCACTTCGTTGTAGCTAGCCTATCGGTCAGATAATCAGA CAAGGAACTGATTA;
the nucleotide sequence of the first reverse primer is as follows:
CGAAGGTGTGACTTCCATG。
the nucleotide sequence of the first forward primer includes a tag sequence "TCATAGCACTTCGTTGTAGCTAGCCTATCGGTCAGA".
The present embodiment also provides a primer set for detecting a short N protein fragment of a novel coronavirus nucleocapsid protein, wherein the primer set is a second primer set;
the second primer group comprises a second forward primer and a second reverse primer; wherein the content of the first and second substances,
the nucleotide sequence of the second forward primer is as follows:
GGGGAACTTCTCCTGCTAGAAT;
the nucleotide sequence of the second reverse primer is as follows:
AGCAAGAGCAGCATCACC。
the primer group for detecting the short fragment of the nucleocapsid protein of the novel coronavirus, which is used for detecting the short fragment of the nucleocapsid protein of the novel coronavirus, can be pertinently suitable for detecting the nucleic acid fragment aiming at the short fragment, can be used for more accurately detecting the short fragment on the basis of compensating the wide applicability of the detection of the long fragment, and particularly can be used for detecting the nucleic acid fragment aiming at the short fragment within the range of below 25 kDa.
The embodiment also provides a primer group of the envelope protein gene segment, which is used for detecting the novel coronavirus envelope protein and is a third primer group;
the third primer group comprises a third E protein forward primer and a third E protein reverse primer; wherein the content of the first and second substances,
the nucleotide sequence of the third E protein forward primer is as follows:
CGTGGTATTCTTGCTAGTTAC;
the nucleotide sequence of the third E protein reverse primer is as follows:
CGCACACAATCGAAGCG。
it is known from the prior art that the new coronavirus particle is composed of five components in terms of biological structure: one strand of RNA genes and four proteins. The outermost layer of the particle is Spike glycoprotein (S), the viral Envelope under the Spike is composed of small Envelope glycoprotein (E, Envelope Protein in this application) and Membrane glycoprotein (M, Membrane Protein), and the core hidden in the Envelope is a spiral folding structure composed of RNA gene chain and Nucleocapsid Protein (N, Nucleocapsid Protein in this application).
The N Protein, i.e. the Nucleocapsid Protein (N Protein, N, Nucleocapsid Protein) of the new coronavirus, is a helical folding structure formed by combining the Nucleocapsid Protein and the viral RNA gene chain in the present application, and is used for expressing the amino acid sequence of the N Protein. The N protein plays an important role in the viral replication process.
The above-mentioned E Protein, i.e. the small Envelope glycoprotein of the new coronavirus, is a component of the Envelope of the virus particle (E Protein, E, Envelope Protein) described in this application. Amino acid sequence for expressing E protein. The major function of the E protein is to protect the RNA gene strand inside the virus. The envelope proteins mediate viral entry into host cells by binding to receptors and can disrupt the integrity of the microvasculature by binding to endothelial cells, causing vascular leakage. In addition, the envelope glycoprotein has important receptor binding sites and antigen epitopes, plays an important role in the virus infection and host immunity process, and is a hotspot of vaccine research. Therefore, by utilizing the genetic characteristics of the envelope protein, the novel coronavirus can be more accurately detected, and particularly, mass spectrum detection is carried out after the E protein and other protein combinations and specific primers are amplified, so that the probability of false positive in detection can be greatly reduced.
The present invention also provides a method for detecting pathogenic microorganisms of a novel coronavirus, which is a detection method using a combination of specific primers and probe sequences of the novel coronavirus in combination with polymerase chain reaction amplification-electrospray mass spectrometry, and comprises:
extracting nucleic acid to obtain reaction solution to be detected containing DNA or RNA;
taking a primer mixed solution containing a specific primer of the novel coronavirus and a probe sequence combination, and carrying out amplification reaction on the primer mixed solution and the reaction solution to be detected to obtain a first PCR product;
desalting the first PCR product to obtain a second PCR product;
purifying the second PCR product, detecting the molecular weight of the amplified gene by using electrospray mass spectrometry, and determining whether the DNA or RNA in the reaction solution to be detected contains a corresponding target novel coronavirus nucleic acid sequence according to the molecular weight of the amplified gene;
wherein, the primer mixture containing the combination of the specific primer and the probe sequence of the novel coronavirus is a primer mixture containing the following specific primer groups:
a single primer set as one of said first primer set as described above, said second primer set as described above, or said third primer set as described above; alternatively, the first and second electrodes may be,
a plurality of mixed primer sets of the first primer set and the second primer set; alternatively, the first and second electrodes may be,
a plurality of mixed primer sets of the first primer set and the third primer set.
In the nucleic acid extraction step, the automatic nucleic acid extractor can be operated according to the instructions of the virus DNA/RNA extraction kit to extract the DNA or RNA of the sample to be detected, so as to extract the reaction solution to be detected containing the DNA or RNA. The specific extraction process is not described herein.
The amplification reaction refers to PCR amplification of DNA, and PCR is polymerase chain reaction. The reaction is designed according to the principle of DNA denaturation and renaturation. The general reaction system comprises a micro-sample containing the target gene, thermostable DNA polymerase, 4 dNTPs (deoxynucleotides) and two kinds of excess primers. The primers are typically 20-30bp in length (the primers provided in this example are artificially synthesized).
The primer mixture containing the combination of the specific primer and the probe sequence of the novel coronavirus may be a primer mixture containing different specific primer groups, and the primer mixture may be different combinations, specifically, the following 5 schemes (see table 1):
TABLE 1, 5 schemes overview
It should be noted that, the molecular weights of the primers in the second primer set and the third primer set are relatively close to each other when mass spectrometry is performed, and in order to achieve accurate detection results and eliminate false positive detection results, in this embodiment, mixed detection of the second primer set and the third primer set is avoided, and analysis obstacles when the molecular weights are close to each other are eliminated. In the two combination schemes, the first primer group and the third primer group or the first primer group and the second primer group have larger molecular weight difference, can be suitable for being used as mixed primers to carry out joint detection, can produce multiple results and carry out verification analysis on multiple molecular weights, and carry out mutual and cross comparison on data, thereby being beneficial to further improving the accuracy and reducing the occurrence of false positive situations.
This example provides a novel method for detecting pathogenic microorganisms of coronavirus. Comprises the steps of nucleic acid extraction, amplification reaction, desalination, mass spectrum detection and the like. The method aims to provide a method for rapidly identifying pathogenic microorganisms such as the new coronavirus and the like by polymerase chain reaction amplification-electrospray mass spectrometry (Multitag-PCR-ESI-MS) combined with specific primers and probe sequences.
The method is simple to operate, the sample can be directly detected on a computer after being subjected to PCR amplification of the specific primers, the probe and the gene, the step of single base extension or restriction enzyme cutting is not required, the additional step is not required, and the method is simple and convenient to operate and high in rapid flux.
Compared with a MALDI-TOF detection method, the method can be widely applied to detection of long (above 25kDa) or short (below 25kDa) nucleic acid fragments and is not limited by a nucleic acid molecular weight detection area. During detection, the detection method can be selected according to the length and the detection area of the nucleic acid fragment, or can be used in a mixed mode by adopting a mixed primer group scheme, so that the effect of detecting the nucleic acids with different fragment lengths is achieved, the detection efficiency is improved, and the convenience and the adaptability are improved.
According to the scheme of the mixed primer group, the mixed primer group comprises a first primer group and a second primer group, and the mixed primer group comprises the first primer group and a third primer group, the molecular weight difference of different primer groups is large during detection, and the molecular weight detection results in different primer groups can be obviously distinguished, so that a plurality of results aiming at different gene fragment regions of the new coronavirus protein can be simultaneously obtained in one detection process, the molecular weight data are mutually cross-compared and mutually verified, the accuracy of the data is further improved, and the existence probability of false positive detection results is greatly reduced through one-time detection steps.
In conclusion, the detection method provided by the embodiment combines various specific primers and probe sequences, and can be used for rapidly detecting the new coronavirus by using an electrospray mass spectrometer. The detection method has the advantages of high flux, low cost, high specificity, high sensitivity and the like, greatly reduces the probability of false positive during detection, and provides technical support for accurate detection of pathogenic microorganisms of the novel coronavirus.
Preferably, the step of determining whether the DNA or RNA in the reaction solution to be tested contains the corresponding target novel coronavirus nucleic acid sequence according to the molecular weight of the gene after amplification comprises:
when the combination of the specific primers and the probe sequences of the novel coronavirus is a primer mixed solution containing the following components, judging that the DNA or RNA in the reaction solution to be detected contains a corresponding target new coronavirus sequence:
the primer mixture is a single primer group, and when the first primer group is used, the molecular weight after gene amplification is shown as the following molecular weight, or the molecular weight within the deviation range of plus or minus 5 Da: the molecular weight of a positive chain corresponding to the first forward primer is 44910Da, and the molecular weight of a reverse chain corresponding to the first reverse primer is 45180 Da;
the primer mixture is a single primer group, and when the primer mixture is the second primer group, the molecular weight after gene amplification is shown as the following molecular weight, or the molecular weight within the deviation range of plus or minus 5 Da: the molecular weight of a forward chain corresponding to the second forward primer is 16540Da, and the molecular weight of a reverse chain corresponding to the first reverse primer is 16720 Da;
in the case of the single primer set and the third primer set in the primer mixture, the molecular weight after gene amplification is as follows, or within a deviation range of plus or minus 5 Da: the molecular weight of the positive chain corresponding to the third E protein forward primer is 16860 Da;
when the primer mixture is a mixed primer group, and the mixed primer group is a mixed primer group of the first primer group and the second primer group, the molecular weight after gene amplification is shown as the following molecular weight, or the molecular weight within the deviation range of plus or minus 5 Da: the molecular weight of a positive chain corresponding to the first forward primer is 44910Da, and the molecular weight of a reverse chain corresponding to the first reverse primer is 45180 Da; the molecular weight of a positive chain corresponding to the second forward primer is 16720Da, and the molecular weight of a reverse chain corresponding to the first reverse primer is 16540 Da;
when the primer mixture is a mixed primer group, and the mixed primer group is a mixed primer group of the first primer group and the third primer group, the molecular weight after gene amplification is shown as the following molecular weight, or the molecular weight within the deviation range of plus or minus 5 Da: the molecular weight of a positive chain corresponding to the first forward primer is 44910Da, and the molecular weight of a reverse chain corresponding to the first reverse primer is 45180 Da; and the molecular weight of the positive chain corresponding to the third E protein forward primer is 16860 Da.
In the above, it is determined whether the DNA or RNA in the reaction solution to be tested contains the corresponding target novel coronavirus nucleic acid sequence according to the molecular weight after gene amplification, which is specifically shown in the following table:
table 2, different protocols containing data of theoretical detection of molecular weight of target novel coronavirus nucleic acid sequence
The allowable deviation range of the molecular weight mass spectrometry detection result after amplification of the corresponding primers in each primer group in Table 2 is + -5 Da.
Preferably, the step of taking a primer mixture containing a combination of a specific primer and a probe sequence of the novel coronavirus and performing an amplification reaction with the reaction solution to be detected to obtain a first PCR product comprises:
preparing a reaction system: taking 1 mu L of the primer mixed solution, 0.5-1 mu L of the reaction solution to be detected 12.5 mu L, DNA polymerase and 2-5 mu L of template DNA, supplementing the primer mixed solution with sterilized deionized water to 25 mu L, adding 20 mu L of sealing solution, and placing the mixture in a thermal cycler;
and carrying out amplification reaction on a reaction system configured in a thermal cycler to obtain the first PCR product.
Preferably, the amplification conditions of the amplification reaction are that the first stage is 42 ℃/15min, the second stage is 92 ℃/3min, the third stage is 92 ℃/15s,53 ℃/10s and 60 ℃/35s, and the total cycle is 40;
at least two complementary paired specific primers are contained in each specific primer group, wherein the concentration of each specific primer is 10 mu mol/L.
Preferably, said "desalting said first PCR product to obtain a second PCR product" comprises:
and adding 16 mu L of water and 6mg of resin into the first PCR product, mixing and then carrying out centrifugal separation to obtain a second PCR product.
In addition, the present embodiment also provides a novel detection kit for detecting a coronavirus pathogenic microorganism, which employs the novel detection method for a coronavirus pathogenic microorganism as described above. Comprises the steps of nucleic acid extraction, amplification reaction, desalination, mass spectrum detection and the like. The method aims to provide a method for rapidly identifying pathogenic microorganisms such as the new coronavirus and the like by polymerase chain reaction amplification-electrospray mass spectrometry (Multitag-PCR-ESI-MS) combined with specific primers and probe sequences.
The detection kit provided by the embodiment utilizes the combination of specific primers and probe sequences of the novel coronavirus and combines a detection method of polymerase chain reaction amplification-electrospray mass spectrometry; wherein, the kit comprises a primer mixed solution containing a specific primer of the novel coronavirus and a probe sequence combination;
the primer mixed solution comprises the following specific primer groups: a single primer set as one of said first primer set as described above, said second primer set as described above, and said third primer set as described above; alternatively, the first and second electrodes may be,
a mixed primer set of the first primer set and the second primer set; alternatively, the first and second electrodes may be,
a mixed primer set of the first primer set and the third primer set;
at least two complementary paired specific primers are contained in each specific primer group, wherein the concentration of each specific primer is 10 mu mol/L.
The present embodiment provides a novel kit for detecting a pathogenic microorganism of a coronavirus. The kit is used for rapidly identifying pathogenic microorganisms such as new coronavirus and the like by polymerase chain reaction amplification-electrospray mass spectrometry (Multitag-PCR-ESI-MS) combined with specific primers and probe sequences, and can be used for rapidly detecting the new coronavirus. The novel detection kit for the pathogenic microorganisms of the coronavirus has the advantages of high flux, low cost, high specificity, high sensitivity and the like, greatly reduces the probability of false positive during detection, and provides technical support for accurate detection of the pathogenic microorganisms of the coronavirus.
To better illustrate the detection methods provided herein and the protocol without specific primer sets, the following specific examples are provided.
The experimental method comprises the following steps:
step 1, nucleic acid extraction: operating the automatic nucleic acid extractor according to the instruction of the virus DNA/RNA extraction kit to extract the DNA or RNA of the sample to be detected; obtaining a reaction solution to be detected containing DNA or RNA;
step 2, amplification reaction:
(1) reaction system: a reaction system was prepared in a 200. mu.L PCR tube: taking 1 mu L of primer mixed solution containing the combination of the specific primer of the novel coronavirus and the probe sequence, 0.5-1 mu L of polymerase of reaction solution to be detected, 12.5 mu L, DNA and 2-5 mu L of template DNA, supplementing the mixture to 25 mu L by using sterilized deionized water, then adding 20 mu L of sealing solution, and placing the PCR reaction tube in a thermal cycler;
(2) amplification conditions: the first stage of pre-denaturation, 42 ℃/15 min; the second stage is 92 ℃/3 min; in the third stage, the temperature is 92 ℃/15s,53 ℃/10s and 60 ℃/35 s; a total of 40 cycles;
carrying out amplification reaction on the PCR reaction tube under the amplification condition to obtain a first PCR product;
step 3, desalting treatment: adding 16 mu L of pure water and 6mg of resin into a PCR tube containing the first PCR product, vertically rotating at a low speed for 30min to ensure that the resin is fully contacted with the first PCR product, and centrifuging to ensure that the resin is sunk to the bottom of a hole to obtain a second PCR product;
step 4, mass spectrum detection: and purifying the second PCR product, detecting by using electrospray mass spectrometry, and analyzing the molecular weight of the report group, thereby identifying pathogenic microorganisms such as the new coronavirus and the like.
Experimental biochemical specimens:
and (3) performing on-site nasal swab collection and sampling on the same patient (diagnosed case) with positive coronavirus, subpackaging to obtain an experimental biochemical specimen, and preparing to obtain a reaction solution to be detected.
Experimental equipment: thermo Tsq quantiva (electrospray mass spectrometry, specific clinical application not limited to brand model in this example)
Example 1:
the experimental method, the experimental equipment and the experimental biochemical specimen are adopted, and the following primer mixed solution containing the combination of the specific primer of the novel coronavirus and the probe sequence is adopted, and the method specifically comprises the following steps:
example 2:
the experimental method, the experimental equipment and the experimental biochemical specimen are adopted, and the following primer mixed solution containing the combination of the specific primer of the novel coronavirus and the probe sequence is adopted, and the method specifically comprises the following steps:
example 3:
the experimental method, the experimental equipment and the experimental biochemical specimen are adopted, and the following primer mixed solution containing the combination of the specific primer of the novel coronavirus and the probe sequence is adopted, and the method specifically comprises the following steps:
example 4:
the experimental method, the experimental equipment and the experimental biochemical specimen are adopted, and the following primer mixed solution containing the combination of the specific primer of the novel coronavirus and the probe sequence is adopted, and the method specifically comprises the following steps:
example 5:
the experimental method, the experimental equipment and the experimental biochemical specimen are adopted, and the following primer mixed solution containing the combination of the specific primer of the novel coronavirus and the probe sequence is adopted, and the method specifically comprises the following steps:
the experimental results are as follows:
TABLE 3, examples 1-5Multitag-PCR-ESI-MS detection data
In the present embodiment, the molecular weight of the gene in the reaction solution to be tested in embodiments 1 to 5 is detected by electrospray mass spectrometry, so as to identify pathogenic microorganisms such as new coronavirus, and the specific data are shown in table 3 and fig. 2 to 6. Wherein the content of the first and second substances,
in example 1, referring to FIG. 2, it can be seen that the molecular weight of the gene after the amplification of the first forward primer is 44910Da, and the molecular weight of the gene after the amplification of the first reverse primer is 45180Da, so that the sample to be tested is judged to contain the new coronavirus N protein nucleic acid sequence.
In example 2, referring to FIG. 3, it can be seen that the molecular weight of the gene after amplification by the second forward primer is 16720Da, and the molecular weight of the gene after amplification by the second reverse primer is 16540Da, so that the sample to be detected is judged to contain the new coronavirus N protein nucleic acid sequence.
In example 3, referring to fig. 4, it can be seen that the molecular weight of the E protein gene fragment after amplification is 16860Da, and thus it is determined that the sample to be tested contains a new coronavirus N protein nucleic acid sequence.
In example 4, referring to FIG. 5, it can be seen that the molecular weight of the gene after amplification of the first N protein forward primer is 44910Da, the molecular weight of the gene after amplification of the first N protein reverse primer is 45180Da, the molecular weight of the second N protein forward primer is 16720Da, and the molecular weight of the second N protein forward primer is 16540Da, so that the sample to be detected is determined to contain the new coronavirus N protein nucleic acid sequence.
In example 5, referring to FIG. 6, it can be seen that the molecular weight of the gene after the amplification of the first forward primer is 44910Da, the molecular weight of the gene after the amplification of the first reverse primer is 45180Da, and the molecular weight of the third E protein forward primer is 16860Da, so that the sample to be detected is judged to contain the new coronavirus N protein nucleic acid sequence.
In conclusion, the invention provides 3 specific primers, a novel detection method for coronavirus pathogenic microorganisms and a novel detection kit for coronavirus pathogenic microorganisms. Wherein, the specific primer comprises: a primer group for detecting the long fragment of the nucleocapsid protein of the novel coronavirus nucleocapsid protein, a primer group for detecting the short fragment of the nucleocapsid protein, and a primer group for detecting the gene fragment of the envelope protein of the novel coronavirus envelope protein. The novel detection method for the pathogenic microorganisms of the coronavirus is combined with a plurality of specific primers and probe sequences, and an electric spray mass spectrometer can be used for rapidly detecting the novel coronavirus. The detection method has the advantages of high flux, low cost, high specificity, high sensitivity and the like, greatly reduces the probability of false positive during detection, and provides technical support for accurate detection of pathogenic microorganisms of the novel coronavirus.
While the preferred embodiment and the corresponding examples of the present invention have been described, it should be understood that various changes and modifications, including but not limited to, adjustments of proportions, flows and amounts, which are within the scope of the invention, may be made by those skilled in the art without departing from the inventive concept thereof. While the preferred embodiment and the corresponding examples of the present invention have been described, it should be understood that various changes and modifications, including but not limited to, adjustments of proportions, flows and amounts, which are within the scope of the invention, may be made by those skilled in the art without departing from the inventive concept thereof.
Claims (10)
1. A primer group of a long fragment of a nucleocapsid protein is used for detecting the nucleocapsid protein of a novel coronavirus, and is characterized in that the primer group is a first primer group;
the first primer set includes: a first forward primer and a first reverse primer;
wherein the nucleotide sequence of the first forward primer comprises the following tag sequence:
TCATAGCACTTCGTTGTAGCTAGCCTATCGGTCAGA。
2. the primer set for the long fragment of a nucleocapsid protein of claim 1, wherein the first forward primer has the nucleotide sequence:
TCATAGCACTTCGTTGTAGCTAGCCTATCGGTCAGATAATCAGACAAGGAACTGATTA;
the nucleotide sequence of the first reverse primer is as follows:
CGAAGGTGTGACTTCCATG。
3. a primer group of a nucleocapsid protein short segment, which is used for detecting novel coronavirus nucleocapsid protein and is characterized by being a second primer group;
the second primer group comprises a second forward primer and a second reverse primer; wherein the content of the first and second substances,
the nucleotide sequence of the second forward primer is as follows:
GGGGAACTTCTCCTGCTAGAAT;
the nucleotide sequence of the second reverse primer is as follows:
AGCAAGAGCAGCATCACC。
4. a primer group of envelope protein gene segments is used for detecting novel coronavirus envelope proteins and is characterized by being a third primer group;
the third primer group comprises a third E protein forward primer and a third E protein reverse primer; wherein the content of the first and second substances,
the nucleotide sequence of the third E protein forward primer is as follows:
CGTGGTATTCTTGCTAGTTAC;
the nucleotide sequence of the third E protein reverse primer is as follows:
CGCACACAATCGAAGCG。
5. a novel detection method for pathogenic microorganisms of coronavirus is characterized in that the detection method utilizes the combination of specific primers and probe sequences of the novel coronavirus and combines polymerase chain reaction amplification-electrospray mass spectrometry, and comprises the following steps:
extracting nucleic acid to obtain reaction solution to be detected containing DNA or cDNA;
taking a primer mixed solution containing a specific primer of the novel coronavirus and a probe sequence combination, and carrying out amplification reaction on the primer mixed solution and the reaction solution to be detected to obtain a first PCR product;
desalting the first PCR product to obtain a second PCR product;
purifying the second PCR product, detecting the molecular weight of the amplified gene by using electrospray mass spectrometry, and determining whether the DNA or cDNA in the reaction solution to be detected contains a corresponding target novel coronavirus nucleic acid sequence according to the molecular weight of the amplified gene;
wherein, the primer mixture containing the combination of the specific primer and the probe sequence of the novel coronavirus is a primer mixture containing the following specific primer groups:
a single primer set of one of the first primer set of any one of claims 1-2, the second primer set of claim 3, or the third primer set of claim 4; alternatively, the first and second electrodes may be,
a plurality of mixed primer sets of the first primer set and the second primer set; alternatively, the first and second electrodes may be,
a plurality of mixed primer sets of the first primer set and the third primer set.
6. The novel method for detecting pathogenic microorganisms of coronavirus according to claim 5,
the step of determining whether the DNA or cDNA in the reaction solution to be detected contains the corresponding target novel coronavirus nucleic acid sequence according to the molecular weight of the amplified gene comprises the following steps:
when the combination of the specific primers and the probe sequences of the novel coronavirus is a primer mixed solution containing the following components, judging that the DNA or cDNA in the reaction solution to be detected contains a corresponding target novel coronavirus nucleic acid sequence:
the primer mixture is a single primer group, and when the first primer group is used, the molecular weight after gene amplification is shown as the following molecular weight, or the molecular weight within the deviation range of plus or minus 5 Da: the molecular weight of a positive chain corresponding to the first forward primer is 44910Da, and the molecular weight of a reverse chain corresponding to the first reverse primer is 45180 Da;
the primer mixture is a single primer group, and when the primer mixture is the second primer group, the molecular weight after gene amplification is shown as the following molecular weight, or the molecular weight within the deviation range of plus or minus 5 Da: the molecular weight of a forward chain corresponding to the second forward primer is 16540Da, and the molecular weight of a reverse chain corresponding to the first reverse primer is 16720 Da;
in the case of the single primer set and the third primer set in the primer mixture, the molecular weight after gene amplification is as follows, or within a deviation range of plus or minus 5 Da: the molecular weight of the positive chain corresponding to the third E protein forward primer is 16860 Da;
when the primer mixture is a mixed primer group, and the mixed primer group is a mixed primer group of the first primer group and the second primer group, the molecular weight after gene amplification is shown as the following molecular weight, or the molecular weight within the deviation range of plus or minus 5 Da: the molecular weight of a positive chain corresponding to the first forward primer is 44910Da, and the molecular weight of a reverse chain corresponding to the first reverse primer is 45180 Da; the molecular weight of a positive chain corresponding to the second forward primer is 16720Da, and the molecular weight of a reverse chain corresponding to the first reverse primer is 16540 Da;
when the primer mixture is a mixed primer group, and the mixed primer group is a mixed primer group of the first primer group and the third primer group, the molecular weight after gene amplification is shown as the following molecular weight, or the molecular weight within the deviation range of plus or minus 5 Da: the molecular weight of a positive chain corresponding to the first forward primer is 44910Da, and the molecular weight of a reverse chain corresponding to the first reverse primer is 45180 Da; and the molecular weight of the positive chain corresponding to the third E protein forward primer is 16860 Da.
7. The method for detecting a pathogenic microorganism of a novel coronavirus according to claim 5, wherein the step of obtaining a primer mixture containing a combination of a specific primer and a probe sequence of the novel coronavirus and performing an amplification reaction with the reaction solution to be detected to obtain a first PCR product comprises:
preparing a reaction system: taking the primer mixed solution, the reaction solution to be detected, DNA polymerase and template DNA, supplementing the primer mixed solution, the reaction solution to be detected, the DNA polymerase and the template DNA with sterilized deionized water, sealing the mixture, and placing the mixture in a thermal cycler;
and carrying out amplification reaction on a reaction system configured in a thermal cycler to obtain the first PCR product.
8. The method for detecting pathogenic microorganisms of coronavirus according to claim 7, wherein the amplification conditions of the amplification reaction are 40 cycles of 42 ℃/15min in the first stage, 92 ℃/3min in the second stage, 92 ℃/15s in the third stage, 53 ℃/10s,60 ℃/35s in the third stage;
at least two complementary paired specific primers are contained in each specific primer group, wherein the concentration of each specific primer is 10 mu mol/L.
9. The method of detecting a coronavirus pathogenic microorganism according to claim 5, wherein desalting the first PCR product to obtain a second PCR product comprises:
and adding water and resin into the first PCR product, mixing and then carrying out centrifugal separation to obtain a second PCR product.
10. A novel coronavirus pathogenic microorganism detection kit is characterized by comprising a primer mixed solution containing a specific primer of a novel coronavirus and a probe sequence combination;
the primer mixed solution comprises the following specific primer groups: a single primer set of one of the first primer set of any one of claims 1-2, the second primer set of claim 3, and the third primer set of claim 4; alternatively, the first and second electrodes may be,
a mixed primer set of the first primer set and the second primer set; alternatively, the first and second electrodes may be,
a mixed primer set of the first primer set and the third primer set.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN202111289962.XA CN113881810A (en) | 2021-11-02 | 2021-11-02 | Novel detection method for pathogenic microorganisms of coronavirus |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN202111289962.XA CN113881810A (en) | 2021-11-02 | 2021-11-02 | Novel detection method for pathogenic microorganisms of coronavirus |
Publications (1)
Publication Number | Publication Date |
---|---|
CN113881810A true CN113881810A (en) | 2022-01-04 |
Family
ID=79016463
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN202111289962.XA Pending CN113881810A (en) | 2021-11-02 | 2021-11-02 | Novel detection method for pathogenic microorganisms of coronavirus |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN113881810A (en) |
Citations (8)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1997047766A1 (en) * | 1996-06-10 | 1997-12-18 | University Of Utah Research Foundation | Rapid, accurate identification of dna sequence variants by electrospray mass spectrometry |
US20050266397A1 (en) * | 2003-04-26 | 2005-12-01 | Ecker David J | Methods for identification of coronaviruses |
CN111394522A (en) * | 2020-06-03 | 2020-07-10 | 圣湘生物科技股份有限公司 | Composition, kit, method and use for detecting SARS-CoV-2 |
CN111471804A (en) * | 2020-06-05 | 2020-07-31 | 浙江迪谱诊断技术有限公司 | Kit for detecting novel coronavirus with high sensitivity and high throughput and application thereof |
CN111876524A (en) * | 2020-06-22 | 2020-11-03 | 江苏康为世纪生物科技有限公司 | Primer, probe combination and kit for detecting 34 respiratory pathogenic microorganisms based on multiple PCR-time-of-flight mass spectrometry |
CN112684060A (en) * | 2021-01-15 | 2021-04-20 | 北京生物制品研究所有限责任公司 | Method for detecting content of novel coronavirus S protein in novel coronavirus inactivated vaccine |
CN113025752A (en) * | 2021-03-24 | 2021-06-25 | 广州金域医学检验中心有限公司 | Internal reference gene, kit and detection method for PCR detection of 2019-nCoV and SARS virus |
CN113186346A (en) * | 2021-05-08 | 2021-07-30 | 北京华诺奥美医学检验实验室有限公司 | Novel coronavirus nucleic acid PCR-colloidal gold immunochromatography detection kit |
-
2021
- 2021-11-02 CN CN202111289962.XA patent/CN113881810A/en active Pending
Patent Citations (8)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1997047766A1 (en) * | 1996-06-10 | 1997-12-18 | University Of Utah Research Foundation | Rapid, accurate identification of dna sequence variants by electrospray mass spectrometry |
US20050266397A1 (en) * | 2003-04-26 | 2005-12-01 | Ecker David J | Methods for identification of coronaviruses |
CN111394522A (en) * | 2020-06-03 | 2020-07-10 | 圣湘生物科技股份有限公司 | Composition, kit, method and use for detecting SARS-CoV-2 |
CN111471804A (en) * | 2020-06-05 | 2020-07-31 | 浙江迪谱诊断技术有限公司 | Kit for detecting novel coronavirus with high sensitivity and high throughput and application thereof |
CN111876524A (en) * | 2020-06-22 | 2020-11-03 | 江苏康为世纪生物科技有限公司 | Primer, probe combination and kit for detecting 34 respiratory pathogenic microorganisms based on multiple PCR-time-of-flight mass spectrometry |
CN112684060A (en) * | 2021-01-15 | 2021-04-20 | 北京生物制品研究所有限责任公司 | Method for detecting content of novel coronavirus S protein in novel coronavirus inactivated vaccine |
CN113025752A (en) * | 2021-03-24 | 2021-06-25 | 广州金域医学检验中心有限公司 | Internal reference gene, kit and detection method for PCR detection of 2019-nCoV and SARS virus |
CN113186346A (en) * | 2021-05-08 | 2021-07-30 | 北京华诺奥美医学检验实验室有限公司 | Novel coronavirus nucleic acid PCR-colloidal gold immunochromatography detection kit |
Non-Patent Citations (4)
Title |
---|
DANDAN LI 等: "Primer design for quantitative real-time PCR for the emerging Coronavirus SARS-CoV-2-", THERANOSTICS, vol. 10, no. 16, pages 7156 * |
JUSTYNA SAADI 等: "Quantitative Assessment of SARS-CoV-2 Virus in Nasopharyngeal Swabs Stored in Transport Medium by a Straightforward LC-MS/MS Assay Targeting Nucleocapsid, Membrane, and Spike Proteins", JOURNAL OF PROTEOME RESEARCH, vol. 20, no. 2, pages 1434 - 1443, XP055876026, DOI: 10.1021/acs.jproteome.0c00887 * |
SIBYLE ETIEVANT 等: "Performance assessment of SARS-CoV-2 PCR assays developed by WHO referral laboratories", JOURNAL OF CLINICAL MEDICINE, vol. 9, no. 6, pages 62 - 63 * |
周国华 等: "SNP检测技术与个体化药物治疗", vol. 1, 28 February 2015, 苏州大学出版社, pages: 143 - 147 * |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN107955835B (en) | Primer pool and detection method for detecting BRCA1/2 gene mutation | |
CN110484655B (en) | Detection method for parainfluenza virus whole genome second-generation sequencing | |
CN102803512A (en) | Methods and kits for detecting pathogens of respiratory tract | |
CN116676429B (en) | LAMP primer group for detecting pangolin respiratory syncytial virus type B and application thereof | |
CN112176108A (en) | Primer probe combination, kit and detection method for detecting duck adenovirus type 3 based on RAA technology | |
CN111793704B (en) | SNP molecular marker for identifying Brucella vaccine strain S2 and wild strain and application thereof | |
CN108070677A (en) | The detection kit and its detection method that a kind of visualization for foot and mouth disease virus quickly detects | |
CN116024208B (en) | Kit capable of simultaneously detecting 26 pig epidemic diseases through single reaction | |
CN111676322A (en) | Primer composition, kit, method and protective case for 7 coronavirus typing | |
CN103210093B (en) | Method for detecting digestive tract pathogens | |
CN111471802A (en) | Porcine delta coronavirus rapid detection primer, kit and application thereof | |
WO2022257663A1 (en) | Method and kit for detecting and screening n501y mutation in covid-19 | |
CN114480744B (en) | New coronavirus isothermal detection kit based on CRISPR-Cas system, use method and application | |
CN113881810A (en) | Novel detection method for pathogenic microorganisms of coronavirus | |
CN111926109A (en) | African swine fever virus fluorescence thermal convection PCR amplification primer pair, probe primer and prepared kit | |
CN111257559B (en) | Kit for quick qualitative and quantitative detection of microorganisms and quick qualitative and quantitative detection method | |
CN111004869B (en) | Fluorescent quantitative PCR (polymerase chain reaction) primer and reference standard for identifying genetic evolutionary lineages of H1N1 subtype influenza viruses | |
CN114196779A (en) | Pathogenic microorganism detection method and kit based on targeted sequencing | |
CN113817870A (en) | Primer composition for simultaneously detecting seven respiratory tract-related viruses and application thereof | |
CN112899385A (en) | Primer group and probe for identifying Brucella S2 vaccine strain and wild strain and application of primer group and probe | |
CN111440902A (en) | Porcine epidemic diarrhea virus detection primer, kit and application thereof | |
CN112301151B (en) | RDA method and kit for rapidly detecting Canine Distemper Virus (CDV) | |
CN116515840B (en) | Kit and detection method for detecting bovine viral diarrhea virus type 3 | |
KR102402765B1 (en) | Multiplex RT-LAMP composition for diagnosis of SARS-CoV-2 infection and uses thereof | |
KR102143795B1 (en) | Loop Mediated Isothermal Amplification Primer Set for Detection of Dengue Virus Serotype 2 or 4 and Uses Thereof |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination |