CN113881764A

CN113881764A - Rheumatoid arthritis related application of biomarker Jmjd1c

Info

Publication number: CN113881764A
Application number: CN202111210693.3A
Authority: CN
Inventors: 王晓明; 殷玉叶; 许桐畅; 张圣泽; 车楠
Original assignee: Nanjing Medical University
Current assignee: Nanjing Medical University
Priority date: 2021-10-18
Filing date: 2021-10-18
Publication date: 2022-01-04
Anticipated expiration: 2041-10-18
Also published as: CN113881764B

Abstract

The invention relates to application of a biomarker Jmjd1c related to rheumatoid arthritis, which specifically comprises the following steps: use of the biomarker Jmjd1c for the preparation of a diagnostic tool for rheumatoid arthritis or for the preparation of a medicament for the treatment or prevention of rheumatoid arthritis; a rheumatoid arthritis diagnostic tool comprising a Jmjd1c detection reagent; a medicament for treating or preventing rheumatoid arthritis comprising a JMJD1C agonist; use of a JMJD1C agonist for the preparation of a medicament for the treatment or prevention of rheumatoid arthritis. The invention discovers and verifies the close correlation between Jmjd1c gene expression and rheumatoid arthritis for the first time, determines that the biomarker Jmjd1c gene and/or JMJD1C protein can be universally used for diagnosing the rheumatoid arthritis, and develops a diagnostic tool for the rheumatoid arthritis and a medicament for treating or preventing the rheumatoid arthritis according to the diagnosis.

Description

Rheumatoid arthritis related application of biomarker Jmjd1c

Technical Field

The invention relates to application of a biomarker Jmjd1c related to rheumatoid arthritis, in particular to application of a biomarker Jmjd1c in diagnosis and treatment of rheumatoid arthritis, and belongs to the technical field of molecular diagnosis and treatment.

Background

Rheumatoid arthritis is a chronic autoimmune disease with unclear etiology and unknown prognosis, which can affect joints of the whole body, cause bone and cartilage injuries and finally cause serious joint damage. Statistically, about 35% of rheumatoid arthritis patients lose their ability to work for various reasons after 10 years of disease onset. Joint damage is the most common result of rheumatoid arthritis, mainly manifested by bone loss and cartilage loss, and joint destruction can be verified imagewise. In addition, as a systemic immune disease, rheumatoid arthritis can also cause ocular inflammation, including scleritis, iritis, keratitis; cause C1, C2 cervical spondylosis and even cause neuropathy; it can also cause rheumatoid arthritis syndrome in the lung, including interstitial pulmonary fibrosis, rheumatoid silicosis, pulmonary nodules, and pleural effusion. Due to the complexity of the etiology, patients with rheumatoid arthritis are mostly difficult to cure, and clinical treatment only aims at controlling the activity of the disease and improving the life quality of the patients. Early diagnosis and early treatment are important for improving the prognosis of patients with rheumatoid arthritis, and are helpful for reducing the death rate and reducing complications, thereby improving the quality of life of the patients.

According to epidemiological statistical analysis, the prevalence rate of rheumatoid arthritis in the global population is about 0.5% to 1%, which is more susceptible to north america and northern europe, but is relatively low in africa and south china. Rheumatoid arthritis is more common in women, with approximately 3/4 (77.5%) of patients being women. A study in the uk showed that in the uk the prevalence was approximately 1.16% for women and 0.44% for men. Rheumatoid arthritis is likely to occur in almost all ages, but the median age of onset in most patients is around 50 years.

At present, the cause of rheumatoid arthritis is not clear, but it is generally considered that various factors such as environmental factors and genetic factors act together to promote the generation of arthritis. The research shows that the smoking can obviously increase the prevalence rate of the rheumatoid arthritis and is in a dose-dependent relationship. In addition, high birth weight, alcohol consumption, ultraviolet irradiation, air pollution, diabetes are known as causative factors of rheumatoid arthritis. The genetic factors are believed to account for 50% -60% of the risk factors for the onset of arthritis, and it has been reported that the risk factors for the onset of rheumatoid arthritis can be increased 3 to 9-fold in members of a family with a family genetic history of rheumatoid arthritis. Widely recognized genes associated with rheumatoid arthritis include the human leukocyte antigens HLA-DR45 and-DRB 1; in addition, genome-wide association analysis also found some other related genes, including STAT4, CD40, PADI4, PTPN22, and the like.

The joint injury of patients with rheumatoid arthritis is mainly mediated by various immune cells, including dendritic cells, T cells, macrophages, B cells, neutrophils, fibroblasts, osteoclasts and the like. The synovial tissue of the patient is immune attacked by the components recognized as "isohexides" by these immune cells, inducing persistent and chronic persistent inflammatory infiltration, causing synovial damage, bone and cartilage defects, and finally causing swelling and deformation of the joints. In recent decades, researchers have come to recognize the important role of B-cell and rheumatoid arthritis-associated autoantibodies in the development of disease, among which the well-known autoantibodies are Rheumatoid Factor (RF) and anti-citrullinated protein antibody (ACPA). The rheumatoid factor is an autoantibody taking an Fc fragment of denatured IgG as a target antigen and comprises three subclasses of IgM, IgG and IgA. One of the major characteristics of anti-citrullinated protein antibodies is that they are rich in glycan variable domains that can be recognized by citrullinated protein-specific B cells, transmitting activation information, leading to B cell hyperreactivity. Several other autoimmune antibodies have also been discovered in recent years, similar to ACPA, which are capable of recognizing other post-translational modifications, such as anti-carbamoylated antibodies, anti-acetylated antibodies.

The typical symptoms of rheumatoid arthritis are symmetrical and multiple arthritis of hands, feet and the like, and the inflammation is generally characterized by chronic persistence and the like. However, in the actual diagnosis process, the symptoms of most patients are not typical. Although most patients exhibit chronic and slow progression of joint inflammation, some patients develop acute disease. The typical symptoms of rheumatoid arthritis patients are joint pain, stiffness and swelling, but at the time of early diagnosis of rheumatoid arthritis, the symptoms are not obvious and are easily confused with other diseases, which brings difficulty to early diagnosis and treatment.

With the development of medical technology, a series of laboratory indexes are also used as the diagnosis or early screening basis of rheumatoid arthritis, for example, the rheumatoid factor and the anti-citrulline protein antibody are both the diagnosis indexes of classical laboratory rheumatoid arthritis. However, statistically, about 30% of patients have a negative serum for rheumatoid factor and about 33% of patients have a negative serum for anti-citrullinated protein antibody. In general, rheumatoid arthritis patients can be divided into two categories based on the presence or absence of these two autoimmune antibodies in the patient: seronegative or positive. It is generally believed that the correlation of serum autoantibodies with a patient's clinical disease score can affect the prognosis of the patient. However, statistically, only 50% of patients with early-stage rheumatoid arthritis are seropositive, and even among patients diagnosed with rheumatoid arthritis, only 80% are positive. This indicates that there is some degree of false negatives in the laboratory test serum autoantibodies. In addition, rheumatoid factors may also be present in other patients, for example, 30% of systemic lupus erythematosus patients are positive for rheumatoid factors, hepatitis c patients are also likely to be positive for rheumatoid factors, and the elderly also show the change of increase of rheumatoid factors with age. This also indicates that there is some false positive in the serum index in the laboratory. The diversity of the symptoms of patients and the false negative and false positive phenomena existing in laboratory detection results bring certain difficulties to the diagnosis and treatment of rheumatoid arthritis patients, and an accurate and reliable index is urgently needed clinically at present for diagnosing the rheumatoid arthritis. Furthermore, it is statistically expected that the life of patients with rheumatoid arthritis will be significantly shortened by 3-12 years compared to healthy people. If the diagnosis is confirmed as early as possible from the onset of symptoms and the treatment is started within the window period of onset, the disease progression can be delayed obviously and the prognosis of the patient can be improved. Therefore, it is important to find an index or a method which can effectively diagnose the disease in the early stage of the rheumatoid arthritis and has certain help for the treatment of the disease.

Disclosure of Invention

The main purposes of the invention are: the method overcomes the problems in the prior art, provides the application of the biomarker Jmjd1c related to the rheumatoid arthritis, and can realize the diagnosis or treatment of the rheumatoid arthritis through the biomarker Jmjd1 c.

The technical scheme for solving the technical problems of the invention is as follows:

use of a biomarker, wherein the biomarker is Jmjd1c gene and/or Jmjd1C protein; the GeneBank serial numbers of the Jmjd1c gene are NC-000010.11: c63167221-63521890Homo sapiens chromosome 10 and GRCh38.p13 Primary Assembly; the JMJD1C protein is obtained by encoding Jmjd1c gene; the application is used for preparing a diagnostic tool for rheumatoid arthritis or preparing a medicament for treating or preventing rheumatoid arthritis.

The invention also proposes:

a diagnostic tool for rheumatoid arthritis is characterized by comprising a Jmjd1c detection reagent, wherein a target biomarker aimed at by the Jmjd1c detection reagent is Jmjd1c gene and/or JMJD1C protein; the GeneBank serial numbers of the Jmjd1c gene are NC-000010.11: c63167221-63521890Homo sapiens chromosome 10 and GRCh38.p13 Primary Assembly; the JMJD1C protein is obtained by encoding Jmjd1c gene.

Preferably, the types of diagnostic tools include kits, chips, test strips, high throughput sequencing platforms.

Preferably, the Jmjd1c detection reagent comprises a Jmjd1c gene expression level detection reagent;

when the Jmjd1c gene is targeted, the Jmjd1c gene expression amount detection reagent comprises a Jmjd1c gene mRNA quantitative detection reagent;

when the JMJD1C protein is targeted, the Jmjd1c gene expression quantity detection reagent comprises a JMJD1C protein quantitative detection reagent.

More preferably, the Jmjd1c gene mRNA quantitative detection reagent at least comprises one of a primer specific to Jmjd1c gene or transcript, and a recognition probe specific to Jmjd1c gene or transcript; alternatively, the JMJD1C protein quantitative detection reagent comprises an antibody or an antibody fragment specifically binding to JMJD1C protein.

More preferably, the primers specific to the Jmjd1c gene or transcript comprise real-time quantitative PCR primers that specifically amplify Jmjd1c gene; alternatively, the antibody or antibody fragment that specifically binds to the JMJD1C protein is monoclonal or polyclonal, and specific forms of the antibody or antibody fragment include F (ab ') 2, Fab', Fab, scFv, dsFv or polymers thereof, dimerized V regions, or peptides containing CDRs; or, the JMJD1C protein quantitative determination reagent also comprises a nucleic acid encoding an antibody or antibody fragment specifically binding to the JMJD1C protein, or a vector containing the nucleic acid, or a cell containing the vector.

More preferably, the real-time quantitative PCR primer consists of an upstream primer shown by SEQ ID No.1 and a downstream primer shown by SEQ ID No.2, or consists of an upstream primer shown by SEQ ID No.3 and a downstream primer shown by SEQ ID No. 4; alternatively, the antibody or antibody fragment is linked to a label.

The invention also proposes:

a medicament for the treatment or prevention of rheumatoid arthritis, characterized by comprising JMJD1C agonist; the JMJD1C agonist is an agonist of Jmjd1c gene and/or JMJD1C protein; the GeneBank serial numbers of the Jmjd1c gene are NC-000010.11: c63167221-63521890Homo sapiens chromosome 10 and GRCh38.p13 Primary Assembly; the JMJD1C protein is obtained by encoding Jmjd1c gene.

Preferably, the functions of the JMJD1C agonist at least comprise one of increasing the expression level of Jmjd1c gene, increasing the activity of JMJD1C protein, and increasing the expression of the upstream gene or the downstream gene of Jmjd1c gene; alternatively, the JMJD1C agonist comprises an exogenous overexpression vector for JMJD1c gene expression, a forward activated CRISPR SAM technology tool, a gene activated saRNA, a positive regulatory transcriptional regulator, or an activated targeting molecule compound.

The invention also proposes:

use of a JMJD1C agonist for the manufacture of a medicament for the treatment or prevention of rheumatoid arthritis, said JMJD1C agonist being an agonist of JMJD1c gene and/or JMJD1C protein; the GeneBank serial numbers of the Jmjd1c gene are NC-000010.11: c63167221-63521890Homo sapiens chromosome 10 and GRCh38.p13 Primary Assembly; the JMJD1C protein is obtained by encoding Jmjd1c gene.

The invention has the following beneficial effects:

the invention discovers and verifies the close correlation between Jmjd1c gene expression and rheumatoid arthritis for the first time, and the results are reliable and repeatable by verifying clinical patient data and carrying out disease model evidence by adding knockout gene mice. According to the findings, the biomarker Jmjd1c gene and/or JMJD1C protein can be universally used for diagnosing rheumatoid arthritis, so that the disease activity of patients with rheumatoid arthritis can be distinguished from normal people, the disease prognosis of the patients can be identified, and accordingly, a diagnostic tool for the rheumatoid arthritis is developed, and a medicine for treating or preventing the rheumatoid arthritis is developed.

Drawings

FIG. 1 is a statistical chart comparing the difference in the expression level of Jmjd1c gene in peripheral blood mononuclear cells of rheumatoid arthritis patients and healthy controls in example 1 of the present invention.

FIG. 2 is a statistical chart comparing differences in the expression levels of Jmjd1c gene in peripheral blood B cells of rheumatoid arthritis patients and healthy controls in example 1 of the present invention.

FIG. 3 is a graph showing the results of example 2 of the present invention. Wherein, the graph a is a statistical graph for analyzing the correlation between the mRNA level of the Jmjd1c gene in the peripheral blood B cells of the patients with rheumatoid arthritis and the number of the peripheral plasma cells, and the graph B is a statistical graph for analyzing the correlation between the mRNA level of the Jmjd1c gene in the peripheral blood B cells of the patients with rheumatoid arthritis and the clinical disease score.

FIG. 4 is a graph showing the change in the mRNA level (graph a) and the protein level (graph B) of Jmjd1c gene in B cells of a mouse in which Jmjd1c gene is specifically deleted in B cells, as compared with a control mouse in example 3 of the present invention.

FIG. 5 is a graph (a) showing the onset of arthritis, a statistical graph (B) showing the disease scores of the joints of the four limbs of mice, and a photograph (c) showing the joints of affected mice, in example 4 of the present invention, by comparing the onset of arthritis between a control mouse and a B cell-specific knockout Jmjd1c mouse, by constructing a collagen-induced arthritis model.

FIG. 6 is a statistical chart of the levels of antigen-specific antibodies IgG2b, IgG2c, and IgG1 in the serum of a collagen-induced arthritis model mouse according to example 5 of the present invention.

FIG. 7 shows that embodiment 6 of the present invention modifies B1-8 by Crispr technology^hiCas9 mouse B cells were subjected to adoptive transfer experiments followed by flow charts and plasma cell ratio statistics.

Detailed Description

The technical scheme of the specific implementation of the invention is detailed as follows.

(1) The invention provides application of a biomarker, wherein the biomarker is Jmjd1c gene and/or JMJD1C protein; the GeneBank sequence number of the Jmjd1c gene is NC-000010.11: c63167221-63521890Homo sapiens chromosome 10, GRCh38.p13 Primary Assembly; the JMJD1C protein is obtained by encoding Jmjd1c gene; the application is used for preparing a diagnostic tool for rheumatoid arthritis or preparing a medicament for treating or preventing rheumatoid arthritis. Note: the sequence length of the Jmjd1c gene is 354670bp, and the specific sequence can be obtained by searching in the gene database of NCBI according to the above GeneBank sequence number.

Wherein, the application for preparing the medicament for treating or preventing the rheumatoid arthritis comprises the screening of the rheumatoid arthritis medicament, and the screening process comprises the following steps: the effect of the drug was determined by measuring the expression level of Jmjd1c gene or Jmjd1C protein in peripheral blood B cells at some time after addition of the test drug to the bone cells or after administration of the test drug to the model animals. More specifically, when the expression level of Jmjd1c gene or Jmjd1C protein is increased and even restored to a normal level after the addition or administration of a test drug, the drug can be selected as a drug for the treatment of rheumatoid arthritis.

(2) The invention provides a diagnostic tool for rheumatoid arthritis, which comprises a Jmjd1c detection reagent, wherein a target biomarker aimed by the Jmjd1c detection reagent is Jmjd1c gene and/or JMJD1C protein.

Specifically, the Jmjd1c detection reagent comprises a Jmjd1c gene expression level detection reagent. When the Jmjd1c gene is targeted, the Jmjd1c gene expression amount detection reagent comprises a Jmjd1c gene mRNA quantitative detection reagent; when the JMJD1C protein is aimed at, the Jmjd1c gene expression quantity detection reagent comprises a JMJD1C protein quantitative detection reagent.

More specifically, the reagent for quantitative determination of mRNA of Jmjd1c gene can exert its function based on a known method using nucleic acid molecules: such as PCR, e.g., Southern hybridization, Northern hybridization, dot hybridization, Fluorescence In Situ Hybridization (FISH), DNA microarray, ASO methods, high throughput sequencing platforms, etc. The assay can be performed qualitatively, quantitatively, or semi-quantitatively using the reagent. Among them, the PCR method is a known method, for example, ARMS (Amplification mutagenesis System) method, RT-PCR (reverse transcriptase-PCR) method, nested PCR method, etc. The amplified nucleic acid can be detected by using a dot blot hybridization method, a surface plasmon resonance method (SPR method), a PCR-RFLP method, an in situ RT-PCR method, a PCR-SSO (sequence specific oligonucleotide) method, a PCR-SSP method, an AMPFLP (amplifiable fragment length polymorphism) method, an MVR-PCR method, and a PCR-SSCP (single strand conformation polymorphism) method.

The Jmjd1c gene mRNA quantitative detection reagent at least comprises one of a primer specific to Jmjd1c gene or transcript and a recognition probe specific to Jmjd1c gene or transcript (namely, one or both of the primers can be selected). Wherein, the specific primer of the Jmjd1c gene or transcript comprises a real-time quantitative PCR primer for specifically amplifying the Jmjd1c gene. The primer can be prepared by chemical synthesis, appropriately designed by referring to known information using a method known to those skilled in the art, and prepared by chemical synthesis. The probe may be prepared by chemical synthesis, by appropriately designing with reference to known information using a method known to those skilled in the art, and by chemical synthesis, or may be prepared by preparing a gene containing a desired nucleic acid sequence from a biological material and amplifying it using a primer designed to amplify the desired nucleic acid sequence. Specific sequence examples: the real-time quantitative PCR primer consists of an upstream primer shown by SEQ ID No.1 and a downstream primer shown by SEQ ID No.2, or consists of an upstream primer shown by SEQ ID No.3 and a downstream primer shown by SEQ ID No. 4; alternatively, the antibody or antibody fragment is linked to a label.

More specifically, the JMJD1C protein quantitative detection reagent can exert its function based on a known method using an antibody: for example, ELISA, radioimmunoassay, immunohistochemistry, Western blotting, etc. may be included.

The JMJD1C protein quantitative detection reagent comprises an antibody or an antibody fragment specifically binding to JMJD1C protein. An antibody or antibody fragment of any structure, size, immunoglobulin class, origin, etc., may be used so long as it binds to the target protein. The antibody or antibody fragment may be monoclonal or polyclonal. An antibody fragment refers to a portion of an antibody (partial fragment) or a peptide containing a portion of an antibody that retains the binding activity of the antibody to an antigen. Specific forms of antibodies or antibody fragments may include F (ab ') 2, Fab', Fab, single chain fv (scfv), disulfide-bonded fv (dsfv) or polymers thereof, dimerized V regions (diabodies), or peptides containing CDRs. Antibodies can be obtained by methods well known to those skilled in the art. For example, mammalian cell expression vectors that retain all or part of the target protein or incorporate polynucleotides encoding them are prepared as antigens. After immunizing an animal with the antigen, obtaining immune cells from the immunized animal and fusing myeloma cells to obtain hybridomas; the antibody is then collected from the hybridoma culture; finally, a monoclonal antibody against the JMJD1C protein can be obtained by subjecting the obtained antibody to antigen-specific purification using the JMJD1C protein or a portion thereof used as an antigen. For another example, polyclonal antibodies can be prepared as follows: an animal is immunized with the same antigen as above, a blood sample is collected from the immunized animal, serum is separated from the blood, and then antigen-specific purification is performed on the serum using the above antigen. The antibody fragment can be obtained by treating the obtained antibody with an enzyme or by using sequence information of the obtained antibody.

The antibody or antibody fragment may be linked to a label, and binding of the label to the antibody or fragment thereof may be carried out by methods generally known in the art. For example, proteins or peptides may be fluorescently labeled as follows: the protein or peptide is washed with phosphate buffer, a dye prepared with DMSO, buffer, or the like is added, and then the solution is mixed and left at room temperature for 10 minutes. In addition, labeling can be carried out using a commercially available labeling kit, such as a biotin labeling kit, e.g., biotin labeling kit-NH₂Biotin labeling kit-SH (Dojindo laboratories); alkaline phosphatase labeling kit such as alkaline phosphatase labeling kit-NH₂Alkaline phosphatase labeling kit-SH (Dojindo laboratories); peroxidase labeling kit such as peroxidase labeling kit-NH₂Peroxidase labeling kit-NH₂(Dojindo Laboratories); phycobiliprotein labeling kit such as phycobiliprotein labeling kit-NH₂Phycobiliprotein labeling kit-SH, B-phycoerythrin labeling kit-NH₂B-phycoerythrin labeling kit-SH, R-phycoerythrin labeling kit-NH₂R-phycoerythrin labeling kit S (Dojindo laboratories); fluorescent labeling kit such as fluorescein labeling kit-NH₂HiLyte Fluor (TM)555 labeling kit-NH₂HiLyte Fluor (TM)647 marker kit-NH₂(Dojindo Laboratories); and DyLight 547 and DyLight647(Techno Chemical Corp.), Zenon (TM), Alexa Fluor (TM) antibody labeling kit, Qdot (TM) antibody labeling kit (Invitrogen Corporation), and EZ-marker protein labeling kit (Funakoshi Corporation). For proper labeling, a suitable instrument can be used to detect the labeled antibody or fragment thereof.

In addition, the JMJD1C protein quantitative detection reagent can also comprise nucleic acid encoding an antibody or antibody fragment specifically binding to the JMJD1C protein, or a vector containing the nucleic acid, or a cell containing the vector.

Specifically, in the present invention, the sample for detecting the expression level of Jmjd1c gene is obtained by a conventional technique in the art, and preferably, it can be obtained by a method selected from non-invasive methods and minimally invasive methods. The sample may be (but is not limited to): peripheral blood, bone marrow, lymph nodes, peritoneal lavage fluid, parietal cells or gastric juice. In a particular embodiment of the invention, the sample is from a tissue of the subject.

In particular, in the diagnostic tool of the present invention, the reagent is typically present in a suitable container. Each reagent, such as a primer or probe, can be adjusted to at least one desired amount of concentration using a diluent, such as deionized water, and dispensed into a container.

Specifically, in the diagnostic tool of the present invention, a reagent for extracting nucleic acid, a reagent for PCR, a reagent for staining or developing color, and the like may be further included in the kit. For example, such agents include, but are not limited to: an extraction solution, an amplification solution, a hybridization solution, a color development solution, a washing solution, and the like. In addition, instructions describing the method for detecting rheumatoid arthritis and the like may also be included in the kit. The kit may further contain a plurality of different reagents suitable for practical use (e.g., for different detection methods), and is not limited to the reagents listed so far, and any reagent that can determine rheumatoid arthritis based on the detection of Jmjd1c gene or transcript is included in the scope of the present invention.

In particular, the diagnostic tool of the present invention may be implemented in a method of diagnosing rheumatoid arthritis, the method comprising the steps of:

s1, obtaining a blood sample of a subject;

s2, separating to obtain B lymphocytes of the testee;

s3, detecting the expression level of Jmjd1c gene in B lymphocyte of a subject;

s4, correlating the measured Jmjd1c gene expression level with the disease relevance of the subject;

s5, compared with a normal control, the Jmjd1c gene expression level is obviously reduced statistically, which indicates that the subject is judged to have the rheumatoid arthritis or has high risk of having the rheumatoid arthritis.

(3) The invention provides a medicament for treating or preventing rheumatoid arthritis, which comprises JMJD1C agonist; the JMJD1C agonist is an agonist of Jmjd1c gene and/or JMJD1C protein. The invention also provides application of the JMJD1C agonist in preparing a medicament for treating or preventing rheumatoid arthritis.

Specifically, the functions of the JMJD1C agonist at least comprise increasing the expression quantity of Jmjd1c gene, increasing the activity of JMJD1C protein, and increasing the expression of the upstream gene or the downstream gene of Jmjd1c gene.

The JMJD1C agonist includes an exogenous overexpression vector for JMJD1c gene expression, a forward activated CRISPR SAM technology tool, a gene activated saRNA, a positive regulatory transcriptional regulator, or an activated targeting molecule compound.

Specifically, the medicament of the present invention can be applied to a method for treating rheumatoid arthritis, which comprises increasing the expression of Jmjd1c gene or Jmjd1C protein, specifically comprising increasing the expression level of Jmjd1c gene, increasing the activity of Jmjd1C protein, and increasing the expression of Jmjd1c gene upstream gene or downstream gene.

The above-mentioned medicament may be a pharmaceutical composition, i.e., a pharmaceutical composition formulated for use by any means known in the art using the above-mentioned agonist. Such compositions comprise the active ingredient in admixture with one or more pharmaceutically acceptable carriers, diluents, fillers, binders and other excipients, depending on the mode of administration and the dosage form envisaged. Therapeutically inert inorganic or organic carriers known to those skilled in the art include, but are not limited to, lactose, corn starch or derivatives thereof, talc, vegetable oils, waxes, fats, polyols such as polyethylene glycol, water, sucrose, ethanol, glycerol and the like, various preservatives, lubricants, dispersants, flavors, moisturizers, antioxidants, sweeteners, colorants, stabilizers, salts, buffers and the like may also be added thereto as needed to aid in the stability of the formulation or to aid in the enhancement of activity or bioavailability or to produce an acceptable mouth feel or odor in the case of oral administration, and the formulations that may be used in such compositions may be in the form of their original compounds themselves, or optionally in the form of their pharmaceutically acceptable salts. The agonists described above may be administered alone or in various combinations, as well as in combination with other therapeutic agents. The compositions so formulated may be administered in any suitable manner known to those skilled in the art, as desired. In the case of pharmaceutical compositions, a safe and effective amount of the above agonist is administered to a human, wherein the safe and effective amount is generally at least about 100 micrograms per kilogram of body weight for oral administration. Of course, the particular dosage will depend upon such factors as the route of administration, the health of the patient, and the like, and is within the skill of the skilled practitioner.

The medicine can be prepared into various dosage forms according to requirements. Including, but not limited to, tablets, solutions, granules, patches, ointments, capsules, aerosols or suppositories for transdermal, mucosal, nasal, buccal, sublingual or oral use. The route of administration of the above drug is not limited as long as it exerts the desired therapeutic or prophylactic effect, and includes, but is not limited to, intravenous, intraperitoneal, intraocular, intraarterial, intrapulmonary, oral, intravesicular, intramuscular, intratracheal, subcutaneous, transdermal, transpleural, topical, inhalation, transmucosal, skin, gastrointestinal, intraarticular, intraventricular, rectal, vaginal, intracranial, intraurethral, intrahepatic, intratumoral. In some cases, the administration may be systemic. In some cases topical administration. The dose of the above-mentioned drug is not limited as long as the desired therapeutic effect or prophylactic effect is obtained, and can be appropriately determined depending on the symptoms, sex, age, and the like. The dose of the therapeutic agent or prophylactic agent of the present invention can be determined using, for example, the therapeutic effect or prophylactic effect on a disease as an index.

In the context of the present invention, "rheumatoid arthritis diagnosis" includes determining whether a subject has developed rheumatoid arthritis, determining whether a subject is at risk of having rheumatoid arthritis, and determining whether a rheumatoid arthritis patient has relapsed.

In the context of the present invention, "treatment" encompasses treatment of a related disease or condition in a mammal, such as a human, suffering from the related disease or condition, and includes: preventing the occurrence of a disease or condition in a mammal, particularly when the mammal is susceptible to said disease condition but has not been diagnosed as having such a disease condition; inhibiting a disease or disease state, i.e., preventing its occurrence; or ameliorating the disease or disease state, i.e., causing regression of the disease or disease state. The term "treatment" generally refers to the treatment of a human or animal (e.g., as applied by a veterinarian) wherein some desired therapeutic effect is achieved, e.g., inhibiting the progression of a condition (including slowing the progression, stopping the progression), ameliorating the condition, and curing the condition. Treatment as a prophylactic measure (e.g., prophylaxis) is also included. The use of a patient who has not yet developed a condition but who is at risk of developing the condition is also encompassed by the term "treatment".

The invention is described in further detail below with reference to embodiments and with reference to the drawings. The invention is not limited to the examples given. Experimental procedures without specific conditions noted in the examples, generally following conventional conditions, such as Sambrook et al, molecular cloning: the conditions described in the Laboratory Manual (New York: Cold Spring Harbor Laboratory Press,1989), or according to the manufacturer's recommendations.

Example 1

The main content of this embodiment is: analyzing the difference of Jmjd1c gene expression between healthy control and rheumatoid arthritis patient according to the existing database data.

B lymphocytes and Rheumatoid Arthritis (RA) are used as keywords for searching in an NCBI GEO database, the following GSE number data are obtained after screening, and further bioinformatics analysis is carried out:

(1) GSE 93272: comparing the expression quantity matrix of the probes obtained from NCBI GEO database with a gene name matrix of [ HG-U133_ Plus _2] Affymetrix Human Genome U133 Plus 2.0Array probes to obtain a gene name and expression quantity matrix, and carrying out median processing after removing obvious abnormal values according to the principle of statistical hypothesis testing when one gene corresponds to a plurality of probes. Initial calibration and analysis was performed using Microarray Suite version 5.0(MAS 5.0) software. And then carrying out t test or rank sum test on the data difference according to the two groups of data distribution.

(2) GSE 93777: comparing the expression quantity matrix of the probes obtained from NCBI GEO database with a gene name matrix of [ HG-U133_ Plus _2] Affymetrix Human Genome U133 Plus 2.0Array probes to obtain a gene name and expression quantity matrix, and carrying out median processing after removing obvious abnormal values according to the principle of statistical hypothesis testing when one gene corresponds to a plurality of probes. Initial normalization and analysis was performed using GCOS software. And then carrying out t test or rank sum test on the data difference according to the two groups of data distribution.

(3) GSE23561 comprises comparing the probe expression matrix obtained from NCBI GEO database with Human 50K exon evolution-Based Oligonucleotide array probe gene name matrix to obtain gene name and expression matrix, and taking median to process when one gene corresponds to multiple probes according to statistical hypothesis test principle to remove obvious abnormal value. Initial normalization and analysis was performed using GCOS software. And then carrying out t test or rank sum test on the data difference according to the two groups of data distribution.

(4) GSE 4588: comparing the expression quantity matrix of the probes obtained from NCBI GEO database with a gene name matrix of [ HG-U133_ Plus _2] Affymetrix Human Genome U133 Plus 2.0Array probes to obtain a gene name and expression quantity matrix, and carrying out median processing after removing obvious abnormal values according to the principle of statistical hypothesis testing when one gene corresponds to a plurality of probes. Initial normalization and analysis was performed using GCOS software. And then carrying out t test or rank sum test on the data difference according to the two groups of data distribution.

As a result: as shown in fig. 1, the expression level of Jmjd1c gene was significantly reduced in rheumatoid arthritis patients compared to healthy controls; as shown in fig. 2, further analysis of B cell data revealed that Jmjd1c gene expression was significantly reduced in B cells of rheumatoid arthritis patients compared to healthy controls, suggesting that Jmjd1c may be used as an index for determining or screening rheumatoid arthritis in the future.

Example 2

The main content of this embodiment is: detecting the correlation between the difference of the expression quantity of the Jmjd1c gene in peripheral blood B cells of the patients with rheumatoid arthritis and the clinical disease score.

Peripheral blood samples from 37 rheumatoid arthritis patients were obtained from hospital rheumatological patients, and diagnosis of all cases met the classification criteria of rheumatoid arthritis revised by the american rheumatology society in 1987, of which 29 women, 8 men, and an average age of 56 years. Clinical samples used in this study were informed and passed through the ethical committee of the hospital.

First, separation of patient peripheral blood lymphocytes (GE Ficoll-Paque lymphocyte separation liquid)

(1) The blood sampling of the patients is carried out by clinical nurse practitioners, and the patients are treated within 3 hours after the blood sampling by adopting heparin anticoagulation tubes.

(2) Placing the anticoagulated venous peripheral blood at room temperature for 5min, adding sterile physiological saline buffer solution placed at room temperature in equal volume for dilution, and reversing and mixing evenly for about 5 times.

(3) A clean 15ml centrifuge tube was then filled with 4ml of Ficoll-Paque lymphocyte isolate from GE Healthcare, and the diluted blood sample was gently added along the tube wall so that the blood floated on top of the Ficoll isolate.

(4) At 18 ℃ to 20 ℃, 400g, and at the lowest ramp rate for about 30min, the sample was found to separate into four layers: the first layer is a plasma layer, the second layer is an annular milky white lymphocyte layer, the third layer is a transparent separation liquid layer, and the fourth layer is a red blood cell layer.

(5) The second layer of milky white lymphocytes was gently aspirated, 10ml of PBS buffer was added and mixed back and forth, and the cells were washed by centrifugation at 1500rpm for 5min at room temperature.

(6) At this point the lymphocyte pellet was seen as white, the supernatant was discarded and 1ml of buffer was added to resuspend the cell pellet.

Second, sorting of patient peripheral blood B lymphocytes (BD Aria II flow cytometer)

(1) 500ul of the lymphocyte suspension is taken to be arranged in a flow tube, and the cell is centrifugated at 1500rpm for 5min to precipitate the cells.

(2) Diluting flow-type antibodies: the following antibodies were pipetted at the dilution ratio of the antibodies into 200ul PBS buffer, vortexed for several seconds, and centrifuged at 12000rpm for 5min at4 ℃. The antibody was anti-human CD19pecy 7.

(3) Discarding the supernatant in the step (1) as much as possible, adding the antibody uniform mixing solution which is centrifuged to remove impurities, lightly blowing, uniformly mixing, and dyeing for 15min at4 ℃ in a dark place.

(4) Cells were washed by dilution with 3ml PBS buffer and centrifuged at 1500rpm for 5 min.

(5) The supernatant was discarded and 1ml of PBS buffer was added to resuspend the cells, 1: 3000 DAPI was added and the cell suspension was filtered through a100 micron filter and sorted by flow cytometry.

(6) During flow cytometry sorting, the target cells are B cells which are negative in DAPI staining and positive in CD19pecy staining.

(7) The collection tubes were loaded with 750ul Trizol LS lysate and approximately 3 million B cells were sorted, and sorting was stopped when the total collection volume was approximately 1 ml.

(8) The collection tube was gently mixed back and forth 5 times to lyse the cells sufficiently, at which time the next step of RNA extraction could be performed directly, or frozen at-80 ℃ for storage.

Third, patient peripheral plasma cell detection (Beckman Cytoflex flow cytometry)

(1) Diluting flow-type antibodies: the following antibodies were pipetted into 200ul PBS buffer according to the dilution ratio of the antibodies, vortexed for several seconds, and centrifuged at 12000rpm for 5min at4 ℃; the antibody is anti-human CD3 APC; anti-human CD16 APC; anti-human CD14 APC; anti-human CD56 APC; anti-human CD19pecy 7; anti-human IgD FITC; anti-human CD27 Apcy 7; anti-human CD38 PE; anti-human CD138 bv 605.

(2) Pipette 500ul of the cell suspension of step one and (6) into a 1.5ml EP tube, centrifuge at 5000rpm at4 ℃ for 2min, and discard the supernatant.

(3) The centrifuged antibody supernatant was added to the cell pellet, the cells were suspended gently, and stained at4 ℃ for 15min in the dark.

(4) Adding 1ml PBS buffer solution to dilute and wash the cells, centrifuging at 5000rpm for 2min, and precipitating the cells;

(5) adding 200ul PBS buffer solution to gently resuspend the cells, and performing flow analysis on the cells on a machine, wherein the target plasma cell surface marker is as follows: CD3^-CD14^-CD16-CD56-B220⁺CD27^hiCD38^hiCD138⁺。

Fourth, the mRNA of the peripheral blood B lymphocyte of the patient is extracted and reversely transcribed

(1) Because RNA is very easy to degrade, a mask and gloves must be strictly worn in the extraction process, so that RNA enzyme pollution is avoided.

(2) Adding 200ul of chloroform into the sample cracked by Trizol LS according to the proportion of adding 200ul of chloroform into each 1ml of volume, shaking and mixing for 15s, cutting to avoid using a spiral mixer so as to avoid breaking the genome by violent shaking, and standing for 5-10min at room temperature.

(3) Centrifuging at 12000g for 15min at4 deg.C to obtain 3 layers of sample, wherein the upper transparent water phase is RNA layer, the middle white membrane layer is protein, and the lower pink layer is DNA layer; the upper RNA clear aqueous phase was carefully aspirated, the lower layer was removed without touching, and transferred to a new 1.5ml EP tube.

(4) Adding 500ul isopropanol, reversing and mixing for 10 times, standing at room temperature for 10-15min, and precipitating RNA.

(5) Centrifugation was carried out at 10000g for 10min at4 ℃ at which time RNA was precipitated at the bottom of the tube.

(6) The supernatant was discarded, 1ml of 75% ethanol was added, and the precipitate was washed by gentle suspension.

(7) Centrifuging at4 deg.C for 5min at 8000g, discarding supernatant, and air drying at room temperature for 5-10min without excessive air drying to avoid subsequent RNA dissolution.

(8) Adding 20-30ul of water without DNA/RNA enzyme, slightly suspending, dissolving the precipitate, and heating and dissolving at 55-60 ℃ for 5-10min to obtain an RNA sample.

(9) Reverse transcription: reverse transcription was performed using HiScript II Q RT SuperMix (R222-01) kit from Nanjing Novozam Bio Inc., and the specific reaction system was as follows:

preparing the following mixed solution in an RNase-free centrifuge tube

The reaction procedure was as follows:

the cDNA obtained by reverse transcription can be stored temporarily at-20 ℃.

Fifthly, detecting the difference of expression level of Jmjd1c gene of peripheral blood B cells of a patient (ABI stepone plus) by real-time fluorescent quantitative PCR (polymerase chain reaction)

A total of 20. mu.l of reaction system was used in a ChamQ SYBR qPCR Master Mix (Q311-02) kit from Nanjing Novozam Bio Inc., each sample was provided with 3 parallel reaction tubes, and the reaction system was as follows:

the reaction procedure was as follows:

wherein the primer sequence for detecting the Jmjd1c gene by amplification is as follows:

5F: 5'-GCATTACATCACGACGCAGGT-3' (this is the upstream primer SEQ ID No.1)

3R: 5'-GAGTTCATTGCTGGTCTGGGAC-3' (this is the downstream primer SEQ ID No.2)

The primer sequences of the housekeeping gene GAPDH gene are as follows:

5F：5’-ATGTTCCAATATGATTCCA-3’

3R：5’-GATTTCCATTGATGACAAG-3’。

whether the amplified gene is the target gene or not was analyzed by a melting curve, and relative quantification was performed by the Δ Δ CT method.

Sixthly, analyzing the statistical relevance: the Correlation between the relative expression level of the patient peripheral blood B cell Jmjd1c gene compared to the Gapdh gene, the peripheral plasma cell ratio, the Clinical Disease Activity Index (CDAI), the Simplified Disease Activity Index (SDAI) and the disease activity index 28(DAS28) was analyzed by Linear regression analysis using the software GraphPad Prism 6.01, and the Correlation was analyzed by Correlation using Linear regression.

As a result: as shown in panel a of FIG. 3, the expression level of Jmjd1c gene in peripheral blood B cells of rheumatoid arthritis patients is inversely related to the ratio of peripheral plasma cells; as shown in panel B of FIG. 3, the expression level of Jmjd1c gene in peripheral blood B cells of rheumatoid arthritis patients was negatively correlated with clinical disease scores and disease activity indexes of the patients.

And (4) conclusion: from the above results, it was found that the expression level of Jmjd1c gene in B cells of rheumatoid arthritis patients is negatively correlated with the progress of arthritis disease, suggesting that the expression level of Jmjd1c gene in B cells can be used as a standard for disease diagnosis in the future; according to the correlation between the expression level of the Jmjd1c gene and the disease activity, the fact that the expression level of Jmjd1c in peripheral blood B cells of a patient can be detected for evaluating the disease activity and prognosis of the patient is also suggested in the future.

Example 3

The main content of this embodiment is: a B cell-specific Jmjd1c gene-deleted mouse was constructed.

Construction of B cell specificity deletion Jmjd1c gene mouse

Jmjd1c is designed and constructed by Cambridge-Su big genome resource center according to Jmjd1c gene sequence^fl/flMice, in which loxp sequences were inserted in the mouse at both ends of the 9 th and 10 th exons, and when bred with Mb1-cre, Jmjd1c was obtained^fl/ ^flMb1-cre + mice, which are capable of specifically knocking out the Jmjd1c gene in B cells, all mice used in the experiment were 8-10 weeks old.

Secondly, verifying knockout efficiency of B cell specific deletion Jmjd1c gene mouse from mRNA level

(1) Subject: a control (Jmjd 1c) of 8 weeks old, normal development and same sex was selected^+/+Mb1-cre +) mice and experimental groups (Jmjd 1c)^fl/flMb1-cre +) mice.

(2) Magnetic beads enriched mouse spleen B cells (Biolegend corporation):

1) the mice were euthanized and placed in the right position, the peritoneum was cut open, spleen tissue was visualized, removed, the attached fascial tissue was removed, and the cells were soaked in a1 × mojoport buffer (#480017) from Biolegend, and ground and filtered using a100 μm cell sieve to obtain a spleen mononuclear cell suspension.

2) The cells were pelleted by centrifugation at 1500rpm for 5min at4 deg.C, the supernatant was discarded, 500. mu.l of 1 XMojoStort buffer was added to resuspend the cells, 30. mu.l of Biotin-Antibody Cocktail from PanB Cell Isolation Kit (#480051) was added and gently blown and mixed, and the mixture was stained in the dark at4 deg.C for 15 min.

3) Adding 3ml of 1 XMojoSOr buffer to dilute the redundant antibody, centrifuging at 1500rpm and 4 ℃ for 5min to precipitate cells, discarding the supernatant, adding 500. mu.l of 1 XMojoSOr buffer to resuspend the cells, adding 30. mu.l of Streptavidin Nanobeads, gently blowing, uniformly mixing, and dyeing at4 ℃ in dark for 15 min.

4) Adding 3ml of 1 XMojoSOr buffer to dilute the redundant antibody, centrifuging at 1500rpm and 4 ℃ for 5min to precipitate cells, discarding the supernatant, adding 3ml of 1 XMojoSOr buffer to resuspend the cells, and filtering the cell suspension into a flow tube through a 100-micron cell sieve.

5) The flow tube was inserted into a Magnet (#480019), allowed to stand on ice for 5min, and the cell suspension was poured out into a new collection tube while keeping the flow tube inserted into the Magnet, to obtain a spleen B cell suspension.

6) And (3) verifying enrichment efficiency: and (3) taking 50 mu l of cells from the cell suspension, adding 1 mu l of anti-mouse B220 FITC flow antibody, dyeing for 10min at room temperature in a dark place, and detecting the purity of the B cells by a flow cytometer, wherein the purity of the B cells can be generally more than 95 percent.

7) Verification of Jmjd1c gene knockout efficiency from mRNA levels:

adding 5ml of PBS buffer solution into the cell suspension to wash the cells, centrifuging at 1500rpm and 4 ℃ for 5min to precipitate the cells, removing supernatant, adding 1ml of Trizol lysate, performing room-temperature lysis for 5min, and temporarily storing at-80 ℃ or directly performing the next RNA extraction process.

Extraction and reverse transcription of RNA: the procedure is as in example 2.

Thirdly, real-time fluorescent quantitative PCR analysis: the procedure was as in example 2, wherein the primer sequences for detecting Jmjd1c gene amplification were as follows:

5F: 5'-GAAAGCAAGTCGGAGCAGAGG-3' (this is the upstream primer SEQ ID No.3)

3R: 5'-CTTCCGCCAGTCTTTCAGCA-3' (this is the downstream primer SEQ ID No.4)

The primer sequences of the Hprt gene are as follows:

5F：5’-CGTGATTAGCGATGAACCA-3’

3R：5’-TGTAATCCAGCAGGTCAGCAAA-3’。

fourthly, the result is: as shown in a-diagram of FIG. 4, by measuring the mRNA level of Jmjd1c gene in B cells, it was found that the experimental group Jmjd1c was compared with the control group mice^fl/flThe expression level of the Jmjd1c gene of the B cell of the Mb1-cre + mouse is obviously reduced, which indicates that the mouse is successfully constructed and provides a reliable mouse foundation for subsequent experiments.

8) Validation of Jmjd1c gene knockout efficiency from protein level:

cracking protein: adding 5ml PBS buffer solution into the cell suspension to wash the cells, centrifuging at 1500rpm and 4 ℃ for 5min to precipitate the cells, removing the supernatant, adding 200 mul RIPA lysate (Biyun, # P0013C) to resuspend the cells, transferring into a 1.5ml EP tube, lysing on ice for 20min, centrifuging at 12000rpm and 4 ℃ for 15min, collecting the supernatant in a new 1.5ml EP tube, adding an equal volume of 2 × loading buffer, and heating at 95 ℃ for 5 min.

② Western blotting: the extracted protein is subjected to SDS-PAGE electrophoresis, and JMJD1C protein has a large molecular weight (about 280 KD), 8-10% gel electrophoresis is recommended, membrane transfer is carried out by adopting 300mA constant current for 200min, and then blocking, primary antibody incubation, secondary antibody incubation and color development are carried out.

③ obtaining the result: as shown in B-Panel of FIG. 4, by measuring the expression level of JMJD1C protein in B cells, it was found that it was small compared to the control groupMouse, Experimental group Jmjd1c^fl/flThe JMJD1C protein expression quantity of the Mb1-cre + mouse B cell is obviously reduced and hardly detected, which indicates that the mouse is successfully constructed and provides a reliable mouse foundation for subsequent experiments.

Example 4

The main content of this embodiment is: the fact that the Jmjd1c gene deletion of the mouse B cell can accelerate the onset of arthritis is verified.

Collagen-induced arthritis model construction (Chondrex):

(1) subject: the control mice used for the arthritis model construction were all 9-10 week old adult C57/BL6 background, and the experimental mice used the B cell-specific deletion Jmjd1C gene mice of example 3, using Chondrex complete freund's adjuvant (concentration 5mg/ml, #7023), and Chondrex immune-grade type chicken collagen (concentration 2mg/ml, # 20012).

(2) Day 1: the emulsified antigens were mixed well according to the dose of 100 μ g of collagen type II chicken per mouse: shaking and mixing 50 mul CII +50 mul CFA/mouse in a spiral mixer for about 3-4h, and ensuring the activity of collagen because the collagen is easy to degrade and needs to be operated on ice in the whole process; indication of successful complete emulsification: one drop is dropped into clear water, and the liquid floats on the water surface in a water-in-oil state and is not scattered at all.

(3) Immunizing a mouse: sucking the emulsified antigen by a 1ml syringe, removing bubbles, and placing on ice for later use; after the mice are completely anesthetized, 100 mu l of antigen mixture is injected into a plurality of subcutaneous and dorsal parts of the tail of the mice in total in an intradermal mode, and the mice are placed in a place with proper temperature and wait for revival.

(4) Day 21: the second immunization is carried out, and the antigen preparation is the same as that of the first immunization mouse: mice were immunized subcutaneously for 100 μ l together subcutaneously at the tail and heel of the hind paw.

(5) Measurement indexes are as follows:

1) recording the time of onset: observing whether the ankle sole of the mouse swells or not every day from D15 days, wherein the incidence of the disease is 1, and the incidence of the disease is 0;

2) measuring ankle joint swelling condition: d21 days prior to immunization as an initial value, the thickness of two ankle joints of the mouse hind limb was measured every two days in units: mm, accurate to three bits after decimal point;

3) disease scoring: a single foot was scored from 0 to 4 points for a total of 0 to 16 points:

the scoring means are as follows:

0: normal, no inflammation or redness.

1: mild but definite redness of the ankle or wrist, or significant redness limited to individual fingers/toes, regardless of the number of fingers/toes involved.

2: the medial redness and swelling of the ankle or wrist.

3: the entire paw, including the fingers/toes, is severely inflamed.

4: the limbs are inflamed to the greatest extent and involve multiple joints.

4) CT 3-dimensional reconstruction: taking a joint of a 42 th day euthanasia mouse, soaking the joint in a 4% paraformaldehyde solution for fixation, and performing CT (computed tomography) shooting on the joint at the later stage and performing 3D (three-dimensional) reconstruction;

5) joint sectioning: a42 th day of model building mouse killed by Anle is soaked in 4% paraformaldehyde solution for fixation, and then sent to Severe Biotech limited company for joint decalcification embedding and paraffin section HE tissue staining.

As a result:

(1) as shown in a diagram of fig. 5, the mice in the experimental group had a significantly increased disease rate and a significantly increased disease rate in the arthritis model construction, compared to the mice in the control group.

(2) As shown in b-diagram of fig. 5, the incidence of arthritis was significantly severe in the mice of the experimental group after the arthritis molding, compared to the mice of the control group.

(3) As shown in the c-chart of FIG. 5, photographs of (left) unmolded antigen, (middle) control group unmodeled mouse, and (right) experimental group unmolded mouse were taken on the 42 th day of the molding.

And (4) conclusion: according to the data, the fact that the B cells of the mice lack the Jmjd1c gene can cause the arthritis to be obviously increased, and the result is consistent with that the expression level of the Jmjd1c gene in the B cells of the patients with rheumatoid arthritis is obviously lower than that of normal healthy people analyzed before.

Example 5

The main content of this embodiment is: it was verified that the deletion of Jmjd1c gene in mouse B cells accelerated the onset of arthritis due to increased antibody secretion.

Mouse serum antigen-specific antibody detection (Elisa):

(1) serum samples: on the basis of example 4, the mice were subjected to angular vein blood collection on days 21 and 42 of arthritis model construction, blood samples were left to stand at room temperature for about 2 hours, and centrifuged at 12000rpm for 5min, at which time blood clots were precipitated at the tube bottom, and the supernatant was a serum sample; serum was aspirated into a clean 1.5ml EP tube and stored temporarily at-20 ℃ or-80 ℃.

(2) Coating antigen: antigen coating Elisa plates were performed the evening before the experiment, using a high light transmission high adhesion 96-well flat bottom plate, diluting the type II collagen with PBS buffer to a final concentration of 2.5. mu.g/ml, spreading the antigen dilution into 96-well plates using a line gun, and coating overnight at4 ℃.

(3) And (3) sealing: the plate was removed, spun off, washed three times with 0.05% Tween20 in PBST, and blocked with 2% BSA in PBS for 2h at room temperature.

(4) And (3) serum incubation: the serum was diluted with 1% BSA in PBS according to a certain ratio, the blocking solution was spun off, the serum sample was added and incubated for about 2h at room temperature.

(5) Washing the plate for 10 times: wash 10 times with PBST of 0.05% Tween 20.

(6) And (3) secondary antibody incubation: according to the following steps of 1: secondary antibodies (IgG1, IgG2b, IgG2c HRP) were diluted with 5000 and incubated at room temperature for 1 h.

(7) Washing the plate for 10 times: wash 10 times with PBST of 0.05% Tween 20.

(8) Color development: TMB was developed and OD was measured with a microplate reader.

As a result: as shown in fig. 6, compared with the control group of mice, the serum anti-type two collagen antibodies (IgG1, IgG2B, IgG2c subtypes) of the mice with Jmjd1c deleted in B cells were significantly increased, which may be the reason for significantly accelerated onset and serious disease condition of the experimental group of mice in the modeling process of arthritis model.

Example 6

The main content of this embodiment is: it was verified that deletion of the Jmjd1c gene in mouse B cells resulted in a significant increase in plasma cell production.

Construction of the sgJmjd1c plasmid

(1) Design of sgRNA sequence: based on the structural domain of the mouse Jmjd1c protein, the sequence of sgRNA is designed among the functional domains thereof, and the specificity of the sequence is ensured, wherein the sequence is as follows: GTGATGCCAGTAAATGCTGG are provided.

(2) The addgene reticulum plasmid MSCV-pU6- (BbsI) -CcdB- (BbsI) -Pgk-Puro-T2A-BFP (#86457) was digested with restriction enzyme BbsI in a 37 ℃ water bath for 2h and recovered on a 1% agarose gel.

(3) Annealing of sgRNA fragments: the following sequences were synthesized by Nanjing Kingsrei Biotech Ltd:

5F：5’-CACCGTGATGCCAGTAAATGCTGGGT-3’

3R：5’-TAAAACCCAGCATTTACTGGCATCAC-3’

mu.l of 5F primer (100 μm) and 5. mu.l of 3R primer (100 μm) were mixed in a PCR tube and annealed, and the product was diluted 100-fold.

(4) T4 connection: ligation was performed using T4 ligase (Takara) overnight at 16 ℃ in the following manner: mu.l of annealing product dilution, 1. mu. l T4 ligase, 1. mu.l of 10 XT 4 ligase buffer, about 50. mu.g of vector, H₂O final volume 10. mu.l.

(5) And (3) conversion coating: the ligation product was placed on ice for 2min, added to competent cells (Biotech Co., Ltd., Nanjing Optimus department), ice-cooled for 30min, placed at 42 ℃ for 90s, cooled on ice for 2min, added with 1ml of preheated non-resistant LB liquid, revived at 37 ℃ for 1h, centrifuged at 4000rpm for 2min, discarded the supernatant and left only 100. mu.l of liquid, gently resuspended the bacterial pellet, added to LB plate containing ampicillin resistance, smeared with a glass rod, and cultured at 37 ℃ for about 12h, at which time the formation of monoclonal colonies was observed.

(6) Selecting bacteria for sequencing: monoclonal colonies were picked up in 5ml of LB liquid containing ampicillin resistance, incubated overnight at 37 ℃ with shaking at 200rpm, and the bacterial suspension was centrifuged to extract the plasmid (OMEGA) which was then sent to the company for one-generation sequencing (department of Oncology).

(7) And (4) screening a correct plasmid with the sgRNA according to a sequencing result.

II,B1-8^hiCas9 mouse:

cas9 mice are provided by Nanmo organisms, B1-8^hiMice were donated by professor qihai, Qinghua university; cas9 mice systemically express Cas9 protein and can recognize sgRNA sequences for shearing; b1-8^hiThe immunoglobulin heavy chain region of the B cell of the mouse is modified, so that the BCR specificity of the B cell of the mouse can recognize NP protein; cas9 mice were combined with B1-8^hiBreeding mouse to obtain B1-8^hiCas9 mouse whose B cells are capable of specifically recognizing NP protein and whose B cells are capable of expressing Cas9 protein.

III, transfection of SgRNA B1-8^hiCas9 mouse B cells

(1) Transfection of platE cells to prepare virus:

1) d0: a well-grown disc of platE cells (T25) was prepared at a density of approximately 90% -100%, according to 1: 3, two dishes of cells were prepared (T25).

2) D1: cell transfection is carried out when the cell passage is about 20-22h and the density reaches about 80%, 10% DMEM culture medium is preheated, about 5ml of cell liquid is changed, transfection reagent preparation is carried out about 20min after the liquid is changed, and the cell transfection reagent preparation is carried out according to the following ratio of 3: 1, preparing sgRNA (no-load control and target plasmid) and packaging-assisting plasmid pge, mixing with transfection reagent, standing for 15min, uniformly dripping on the cell surface, and continuously culturing at 37 ℃.

3) D2: cells were replaced with approximately 6ml of 10% DMEM.

(2) Transfection of B cells:

1) d2: b cells were enriched by the magnetic bead enrichment method described above, stimulated with anti-CD180 (1: 4000 ratio), and stimulated using a 24-well plate.

2) D3: virus infection was performed within 24h of B cell stimulation, and platE supernatants were collected, 1: 100 adding Hepes, 1: 1000 polybrene was added, and the mixture was centrifuged at 1500rpm for 5min to discard the precipitate, and the supernatant was collected.

3) Centrifuging 1000g of stimulated B cells for 8min, temporarily collecting and storing the supernatant at 37 ℃, uniformly distributing and adding the virus supernatant into the B cells, infecting the B cells for 2h at 1000g of room temperature spin, discarding the supernatant, adding the previously collected stimulated supernatant into the B cells again, slightly blowing and suspending the B cells, and putting the cells back to 37 ℃ for culturing.

4) D4: repeating the operation D3, and carrying out secondary infection;

(3) adoptive transfer:

1) preparation of OT2 cells: OT2 mice specifically recognized OVA protein by CD 4T cells, OT2 mice were euthanized, peripheral lymph nodes and spleens were taken, treated with red cleavage in ACK, washed 2 times with PBS, and counted for staining, and OT2 cells were injected intravenously to eyes of each recipient mouse at approximately 0.1 milliton.

2) Preparation of B cells: the B cells infected twice are collected in a 15ml centrifugal tube, the cells are washed twice by PBS, about 1ml PBS buffer solution is added for resuspending the cells, and the eyes are injected into the mice by vein injection.

(4) Immunizing a mouse:

d5: antigen immunization was prepared the morning of the next day of adoptive transfer, and each mouse was injected intraperitoneally with NP-OVA 100. mu.g + 100. mu.l of AL adjuvant.

(5) Flow analysis: at day 6 post-immunization, spleens were removed from euthanized mice for flow analysis.

(6) As a result: as shown in fig. 7, which is a circled graph of flow results, the experimental group of mice (sgJmjd1c) resulted in a significant increase in plasma cell production after knocking out Jmjd1c in B cells compared to the control group of mice (control), which is associated with the above results, indicating that the deletion of Jmjd1c gene in B cells resulted in a significant increase in plasma cells, which in turn resulted in an increase in antibody production, and finally in exacerbation of arthritis disease.

In addition to the above embodiments, the present invention may have other embodiments. All technical solutions formed by adopting equivalent substitutions or equivalent transformations fall within the protection scope of the claims of the present invention.

Sequence listing

<110> Nanjing university of medical science

<120> rheumatoid arthritis-related use of biomarker Jmjd1c

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

gcattacatc acgacgcagg t 21

<210> 2

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

gagttcattg ctggtctggg ac 22

<210> 3

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

gaaagcaagt cggagcagag g 21

<210> 4

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

cttccgccag tctttcagca 20

Claims

1. Use of a biomarker, wherein the biomarker is Jmjd1c gene and/or Jmjd1C protein; the GeneBank serial numbers of the Jmjd1c gene are NC-000010.11: c63167221-63521890Homo sapiens chromosome 10 and GRCh38.p13 Primary Assembly; the JMJD1C protein is obtained by encoding Jmjd1c gene; the application is used for preparing a diagnostic tool for rheumatoid arthritis or preparing a medicament for treating or preventing rheumatoid arthritis.

2. A diagnostic tool for rheumatoid arthritis is characterized by comprising a Jmjd1c detection reagent, wherein a target biomarker aimed at by the Jmjd1c detection reagent is Jmjd1c gene and/or JMJD1C protein; the GeneBank serial numbers of the Jmjd1c gene are NC-000010.11: c63167221-63521890Homo sapiens chromosome 10 and GRCh38.p13 Primary Assembly; the JMJD1C protein is obtained by encoding Jmjd1c gene.

3. The diagnostic tool of claim 2, wherein the type of diagnostic tool comprises a kit, a chip, a strip, a high throughput sequencing platform.

4. The diagnostic tool of claim 2, wherein the reagent for detecting Jmjd1c comprises a reagent for detecting the expression level of Jmjd1c gene;

5. The diagnostic tool as set forth in claim 4, wherein the reagent for quantitatively detecting mRNA of Jmjd1c gene comprises at least one of a primer specific to Jmjd1c gene or transcript, a recognition probe specific to Jmjd1c gene or transcript; alternatively, the JMJD1C protein quantitative detection reagent comprises an antibody or an antibody fragment specifically binding to JMJD1C protein.

6. The diagnostic tool of claim 5, wherein the primers specific for the Jmjd1c gene or transcript comprise real-time quantitative PCR primers that specifically amplify Jmjd1c gene; alternatively, the antibody or antibody fragment that specifically binds to the JMJD1C protein is monoclonal or polyclonal, and specific forms of the antibody or antibody fragment include F (ab ') 2, Fab', Fab, scFv, dsFv or polymers thereof, dimerized V regions, or peptides containing CDRs; or, the JMJD1C protein quantitative determination reagent also comprises a nucleic acid encoding an antibody or antibody fragment specifically binding to the JMJD1C protein, or a vector containing the nucleic acid, or a cell containing the vector.

7. The diagnostic tool of claim 6, wherein the real-time quantitative PCR primer consists of an upstream primer shown in SEQ ID No.1 and a downstream primer shown in SEQ ID No.2, or consists of an upstream primer shown in SEQ ID No.3 and a downstream primer shown in SEQ ID No. 4; alternatively, the antibody or antibody fragment is linked to a label.

8. A medicament for the treatment or prevention of rheumatoid arthritis, characterized by comprising JMJD1C agonist; the JMJD1C agonist is an agonist of Jmjd1c gene and/or JMJD1C protein; the GeneBank serial numbers of the Jmjd1c gene are NC-000010.11: c63167221-63521890Homo sapiens chromosome 10 and GRCh38.p13 Primary Assembly; the JMJD1C protein is obtained by encoding Jmjd1c gene.

9. The medicament as claimed in claim 8, wherein the functions of the JMJD1C agonist include at least one of increasing the expression level of JMJD1c gene, increasing the activity of JMJD1C protein, increasing the expression of the upstream gene or downstream gene of JMJD1c gene; alternatively, the JMJD1C agonist comprises an exogenous overexpression vector for JMJD1c gene expression, a forward activated CRISPR SAM technology tool, a gene activated saRNA, a positive regulatory transcriptional regulator, or an activated targeting molecule compound.