CN113862291A - Maize leaf senescence regulating gene ZmUPF1, and identification primer and application thereof - Google Patents

Maize leaf senescence regulating gene ZmUPF1, and identification primer and application thereof Download PDF

Info

Publication number
CN113862291A
CN113862291A CN202111065183.1A CN202111065183A CN113862291A CN 113862291 A CN113862291 A CN 113862291A CN 202111065183 A CN202111065183 A CN 202111065183A CN 113862291 A CN113862291 A CN 113862291A
Authority
CN
China
Prior art keywords
leu
chr1
zmupf1
ala
lys
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN202111065183.1A
Other languages
Chinese (zh)
Other versions
CN113862291B (en
Inventor
汤继华
付志远
张慧
王洪秋
薛亚东
陈永强
陈晓阳
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Henan Agricultural University
Original Assignee
Henan Agricultural University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Henan Agricultural University filed Critical Henan Agricultural University
Priority to CN202111065183.1A priority Critical patent/CN113862291B/en
Publication of CN113862291A publication Critical patent/CN113862291A/en
Application granted granted Critical
Publication of CN113862291B publication Critical patent/CN113862291B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y306/00—Hydrolases acting on acid anhydrides (3.6)
    • C12Y306/04—Hydrolases acting on acid anhydrides (3.6) acting on acid anhydrides; involved in cellular and subcellular movement (3.6.4)
    • C12Y306/04013—RNA helicase (3.6.4.13)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/13—Plant traits
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Health & Medical Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Analytical Chemistry (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Botany (AREA)
  • Mycology (AREA)
  • Biomedical Technology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Immunology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses a maize leaf senescence regulating geneZmUPF1The identification primer and the application thereof aim at providing an efficient detection and identification method for the utilization of the maize inbred line. The invention verifies through map-based cloning and transgenosisZmUPF1The gene influences the senescence phenotype of the corn leaves, and provides a primer, an amplification system and a PCR reaction program for detecting the influence of the gene on the senescence phenotype; the distribution and utilization potential of different haplotypes in an inbred line are researched; the detection method provided by the invention has high accuracy and simple operation, and can be used for detecting the target proteinZmUPF1Provides technical support for green-keeping and seed machine harvesting corn new variety breeding.

Description

Maize leaf senescence regulating gene ZmUPF1, and identification primer and application thereof
Technical Field
The invention relates to the technical field of genetic engineering, in particular to a maize leaf senescence regulating geneZmUPF1Identification primers and application thereof.
Background
Plant leaves are the main organs of photosynthesis, during the growth of the leaves, photosynthetic products and nutrients are accumulated in the leaves continuously, and when the leaves begin to age, the photosynthetic products and nutrients accumulated in mature leaves are transferred to new developing leaves and seeds, which are important factors for promoting dry matter accumulation of the seeds at the later stage of development (Buchanan-Wollaston et al, 2003). Therefore, extension of the functional period of the leaves contributes to the improvement of plant yield. Corn is an important grain, feed, chemical and energy crop, and plays an irreplaceable role in industrial and agricultural production and the aspect of guaranteeing national grain safety. The corn belongs to a C4 plant, and the leaf blade of the corn has stronger photosynthetic efficiency than that of a C3 plant, but the growth period of the corn is shorter, and the yield and the quality of grains can be seriously influenced by the early senescence of the leaf blade of the corn; on the other hand, the timely senescence of leaves is an important mark for the corn to enter the mature period, and the early stage of dehydration of the stalks, the ears and the grains is an important secondary character for stalk standing and grain harvesting.
DNA/RNA helicase is ubiquitous in various tissues and organs, and researches show that the DNA/RNA helicase plays an important role in response to plant biotic stress. Helicases from eukaryotes comprise two subfamilies, SF1 and SF2, based on motif sequences common to helicases, of which the SF1 class is in turn divided into three subgroups, the Upf1 class, the Pif1 class and the UvrD/Rep class (Fairman-Williarms et al, 2010). The Upf1 helicase acts on DNA and RNA (JanKowsky, 2011) to regulate DNA replication, transcription termination, translation and nonsense-mediated mRNA attenuation, thereby directly or indirectly determining cell proliferation, differentiation and cell death (Avery et al, 2011). Knockout of UPF1 in zebrafish, mice and drosophila led to embryonic lethality (Weischenfeldt et al, 2008; Wittkopp et al, 2009; Avery et al, 2011), suggesting that UPF1 is a helicase essential for growth and development of animal cells. T-DNA insertional mutation of the UPF1 gene in Arabidopsis thaliana plants results in different degrees of dysplasia, e.g.upf1-1/lba1Mutants exhibit early flowering and elongated seed phenotypes (Yoine et al, 2006 b),upf1-3Mutants exhibit a seedling-stage lethal phenotype under continuous light conditions (Yoine et al, 2006 a),upf1-4Reduced leaf size in mutants (Arciga-Reyes et al, 2006),upf1-5Leaf senescence of the mutants was accelerated (kalina et al, 2012).
Rice (Oryza sativa L.) with improved resistance to stressospls2The mutant (mutant leaf senescence 2) began to develop leaf damage and early senescence phenotype in the 4-5 leaf stage of seedlings, accompanied by massive accumulation of ROS in the leaves, and genetic and functional analysis indicated that the mutant phenotype is caused by the loss of function of the Upf1 type helicase (RBP-59) (Gong et al, 2019). The Upf1 class helicases from gramineous crops contain 14 conserved motifs of the SF1 family helicases (Fairman-Williams et al 2010), but are structurally different from other Upf1 class helicases, with only conserved RecA1 (I, Ia-c, II, III and Q) and RecA2 (IIIa, IV, V, Va, Vb and VI) domains, and lack the R3H domain and zinc finger structure (DNA specific binding) compared to the human IGHMBP2 helicase, suggesting that Upf1 from gramineous crops is a new member of the Upf1 class helicases, possibly in a different mechanism of action from homologous genes in animals.
And currently for cornZmUPF1The biological mechanism of gene regulation and control of leaf senescence and the utilization path thereof need to be explored and solved.
Disclosure of Invention
Based on maizeZmUPF1The invention identifies the technical problems that the action mechanism of the gene causing leaf senescence is not clear and can not be applied to corn breedingZmUPF1The functional nucleotide sequence leading to premature senility defines the specificity of the mutation, designs a primer for amplifying the functional nucleotide sequence and provides a utilization way of the primer.
In order to solve the technical problems, the invention adopts the following specific technical scheme:
method for obtaining and controlling premature senility of corn leaf by map-based cloningZmUPF1Gene (Zm 00001d 033109) (see FIG. 1A),ZmUPF1the maize B73 reference genome is a single copy gene, the nucleotide sequence of which is shown as SEQ ID NO.2, the amino acid sequence of which is shown as SEQ ID NO.4, and the markers for map-based cloning of the gene are shown in Table 1.
The sequencing analysis shows that the DNA sequence of the DNA sequence,ZmUPF1the gene comprises 15 exons, and a 140bp insertion is arranged between a splicing acceptor site of a 14 th intron and the 15 th exon of the mutant, so that reading frame shifting and protein translation early termination are caused (see figures 1B and 1C), and the nucleotide sequence of the gene is shown in SEQ ID NO. 5; this 140bp insertion results inels2The chlorophyll a, B and the total content in the leaves are both obviously reduced (half of the wild type, see figure 2A), and the chloroplast gene expression and the protein accumulation thereof are obviously reduced (see figures 2B and 2C). The mutant leaves began to undergo leaf senescence at the 7-leaf stage (V7), and DAP7 (7 days after pollination, about 70 days after sowing) extended leaf senescence to the uppermost leaves of the plants (see fig. 2D).
Will be provided withels2Individuals of heterozygous mutantsZmUPF1The EMS early stops heterozygous mutant individuals to carry out allelic hybridization test, the analysis result of offspring shows that the individuals with premature leaf senescence and normal individuals accord with the Mendel segregation ratio of 1:3, and the phenotype is cosegregated with the corresponding detection marker (see figure 3), and the result shows thatZmUPF1The gene mutation is to causeels2The cause of the early leaf senescence phenotype.
Provides a molecular marker primer pair developed based on a 140bp functional nucleotide insertion sequence, which can be used for detecting the nucleotide sequenceZmUPF1The state of the gene, the primer pair sequence of which is:
F: 5’- CTTCAGCTGTACTATACCCTGATGCACATAC-3’，
R: 5’- GGCAACGTCACAACAATACATCATTTATGCG -3’。
according toZmUPF1Nucleotide polymorphism distribution of the gene in 507 inbred lines and candidate gene association analysis are carried out to obtain SNPs (single nucleotide polymorphisms) and favorable haplotypes which are obviously associated with grain dehydration, and intermediate materials for favorable haplotype breeding and stable inbred lines are utilized for cultivationBreeds a new nationally examined corn variety Yudan 888 suitable for being harvested by a seed machine.
Compared with the prior art, the invention has the main beneficial technical effects that:
the invention utilizes the corn leaf premature senility natural mutant discovered in the breeding and line selection processels2Clone intoZmUPF1Genes, the biological functions of which are verified, reveal gramineous cropsUPF1Has the function of regulating and controlling the aging of the corn leaves; identified to obtainZmUPF1The functional nucleotide sequence causing the premature senility and the specificity of the mutation is determined based on the distribution research of the functional nucleotide sequence in 140 parts of maize inbred lines; provide for identificationZmUPF1The identification method has high accuracy and simple operation, and lays a good technical foundation for the gene in the aspects of corn (stay green and grain machine harvest) germplasm resource analysis and application.
Drawings
FIG. 1 is a drawing ofZmUPF1Gene structure and amino acid sequence diagram; in the figure, A:ZmUPF1map-based cloning of the gene; b:ZmUPF1gene structure and 140bp insertion position; c: alignment of amino acid sequences of wild type and mutant ZmUPF 1.
FIG. 2 is a graph of the aging phenotype and associated indicators; in the figure, A: difference in chlorophyll content in wild type and mutant leaves; b: differences in chloroplast gene expression in wild type and mutant leaves; c: differences in chloroplast protein accumulation in wild-type and mutant leaves; d: phenotypic differences between wild type and mutant leaves. L represents ear position leaves, L-1 represents first leaves below the ear, L-2 represents second leaves below the ear, L +1 represents first leaves above the ear, L +2 represents second leaves above the ear, and L +3 represents third leaves above the ear.
FIG. 3 is a drawing showingZmUPF1Testing allelism of the gene; in the figure, A: the left picture is F6Wild type in the population andels2the phenotype of the mutant plant in the pollen stage is shown as F in the right picture6Wild type and mutant in a populationels2Leaf phenotype from leaf L at ear position to fifth leaf on ear; b: left panel shows wild type and wild type in EMS mutagenesis materialels2-1The phenotype of the mutant plant in the pollen stage is shown in the right picture, wild type and wild type in EMS mutagenesis materialels2-1MutantsLeaf phenotype of leaf from ear position L to fifth leaf on ear; c: the left picture isels2Hybrid andels2-1allelic test of the hybrids, right panelels2+×els2-1+ leaf phenotype of leaf from the leaf L at the ear position of WT plant to the fifth leaf on the ear; d: 140bp insertion site detection, wherein the upper band (890 bp) is a mutant with 140bp insertion, the lower band (750 bp) is a wild type without 140bp insertion, and a Lane 1 isels2Andels2-1double heterozygous individuals, wild type individuals in lane 2 and F in lane 36In a groupels2Mutant Individual, lane 4F6Wild type individuals in the population; e: and detecting the genotype of the mutation site of the EMS mutagenesis material.
FIG. 4 is a photograph of maturation period of Yudan 888, a new variety whose seeds are suitable for mechanical harvest.
Detailed Description
The following examples are intended to illustrate the present invention in detail and should not be construed as limiting the scope of the present invention in any way.
The instruments and devices referred to in the following examples are conventional instruments and devices unless otherwise specified; the related reagents and raw materials are all conventional products sold in the market if not specified; the related test and detection methods are conventional methods unless otherwise specified.
Example 1:ZmUPF1cloning and functional verification of genes
Maize leaf senescence natural mutant discovered in breeding and line selection process by using subject group of the inventorels2(Jiuzhonghua collected in the summer of 2018 from Henan Yuanyang) and its combination with L119-8F2The population was isolated and the gene of interest was located within a physical interval of approximately 91.7kb on chromosome 1 of maize by genetic analysis and map-based cloning (see FIG. 1A).
The linkage markers and their sequences used in the map-based cloning procedure are shown in Table 1. Sequencing analysis of the 3 protein-encoding genes within the candidate segment indicated that the Zm00001d033109 gene encoding a Smubp-2 DNA binding protein (646 amino acids as shown in SEQ ID No. 3) was a potential candidate gene with a unique 140bp insertion between the splice acceptor site of the 14 th intron and the 15 th exon of Zm00001d033109 in the mutant, resulting in a frameshift mutation, producing a protein comprising 628 amino acids (see fig. 1B) as shown in SEQ ID No. 4.
To verify the candidate gene, EMS early-terminated mutant using Zm00001d033109 gene andels2performing allelism test, and selfing the two heterozygous individuals to obtain F2And (3) performing phenotype and marker identification, wherein the result shows that the ratio of the individuals with early leaf senescence to the normal individuals is 1:3, indicating that Zm00001d033109 isZmUPF1Is to produce an allele ofels2A gene of interest for the senescent phenotype.
TABLE 1ZmUPF1Primers and sequences for cloning
Figure RE-DEST_PATH_IMAGE001
。
Example 2:ZmUPF1design of molecular markers of
PCR molecular markers for the insertion of 140bp (InDel 1) were developed to facilitate detection of this functional nucleotide sequence.
B73V 4: chr1:250359942 and 250359943, which indicated the actual location of the InDel1 marker product on the fourth version of the reference genome B73; based on the primer, the following InDel1 primers (shown as SEQ ID NO. 6-7) are designed:
F: 5’ CTTCAGCTGTACTATACCCTGATGCACATAC3’，
R: 5’ GGCAACGTCACAACAATACATCATTTATGCG3’；
the detection of the InDel1 molecular marker comprises the following steps:
(1) the reaction system is as follows:
DNA template (30-50 ng/. mu.L) 2. mu.L
Left primer (10μM) 0.4μL
Right primer (10μM) 0.4μL
ddH2O 2μL
2×Taq Plus Master Mix II 5μL 。
(2) The PCR amplification procedure for InDel1 was:
1 cycle 95℃ 3min
35 cycles of denaturation at 95 ℃ for 15s, annealing at 60 ℃ for 20s, and extension at 72 ℃ for 30s
Delay 72℃ 5min
Soak 25℃。
The PCR signature for InDel1 is shown in fig. 3D:
aiming at the difference of 140bp insertion deletion fragments, an InDel1 marker is designed for identifyingZmUPF1The lengths of the amplification products are 750bp and 890bp respectively, wherein 890bp represents an individual with 140bp insertionels2And 750bp represents 140bp deleted material.
Example 3:ZmUPF1candidate gene association analysis
For analytical studyZmUPF1The gene utilization pathway extracts 262 single nucleotide polymorphism Sites (SNP) (B73V 4: 250341839) -2503788) of the gene and the upstream and downstream 3kb intervals in 507 inbred lines, and correlation analysis is carried out on 9 SNPs (chr 1.s _250348609, chr1.s _250359798, chr1.s _250359799, chr1.s _250360261, chr1.s _250360272, chr1.s _250346896, chr1.s _250347681, chr1.s _250347702, chr1.s _ 250349740) and a plurality of traits are obviously correlated with each other when the gene and the upstream and downstream 3kb intervals of the gene are in a 507 inbred line, and the chlorophyll and grain water content related traits (the chlorophyll and grain water content related traits of the inbred lines are in a perfect linkage state with each other and are in a perfect linkage state with each other when the inbred lines are in a dehydration state of chr1.s _ 3653, chr1.s _ 4624, chr1.s _250349740, chr1.s _ 3653, chr1.s _ 599. s _ 3653, chr1. sec # and chr1. 94. sec # 865, chr1. sec # and the dehydration state are in a dehydration state, b. The a + b, a/b and SPAD traits were significantly correlated (see Table 2).
TABLE 2 Association analysis of the ZmUPF1 gene
Trait Marker P value
HB_SPAD chr1.s_250346896 1.27E-09
HB_ab_ratio chr1.s_250346896 1.23E-04
HB_Chla（mg/L) chr1.s_250346896 1.24E-04
HB_total_chl（mg/L) chr1.s_250346896 1.24E-04
HB_Chlb（mg/L) chr1.s_250346896 1.24E-04
HB_SPAD chr1.s_250347681 7.33E-04
HB_ab_ratio chr1.s_250347681 2.95E-03
HB_Chla（mg/L) chr1.s_250347681 2.98E-03
HB_total_chl（mg/L) chr1.s_250347681 3.00E-03
HB_Chlb（mg/L) chr1.s_250347681 3.00E-03
HB_SPAD chr1.s_250347702 7.33E-04
HB_ab_ratio chr1.s_250347702 2.95E-03
HB_Chla（mg/L) chr1.s_250347702 2.98E-03
HB_total_chl（mg/L) chr1.s_250347702 3.00E-03
HB_Chlb（mg/L) chr1.s_250347702 3.00E-03
HB_SPAD chr1.s_250347720 1.43E-03
HB_SPAD chr1.s_250349740 1.74E-09
HB_ab_ratio chr1.s_250349740 1.27E-04
HB_Chla（mg/L) chr1.s_250349740 1.28E-04
HB_total_chl（mg/L) chr1.s_250349740 1.29E-04
HB_Chlb（mg/L) chr1.s_250349740 1.29E-04
BLUP_AUDDC_2_1 chr1.s_250359798 5.54E-04
BLUP_AUDDC_3_1 chr1.s_250359798 1.08E-03
BLUP_40DAP chr1.s_250359798 2.26E-03
BLUP_AUDDC_4_1 chr1.s_250359798 3.33E-03
BLUP_AUDDC_2_1 chr1.s_250359799 6.36E-04
BLUP_AUDDC_3_1 chr1.s_250359799 8.71E-04
BLUP_40DAP chr1.s_250359799 1.73E-03
BLUP_AUDDC_4_1 chr1.s_250359799 2.18E-03
BLUP_AUDDC_3_2 chr1.s_250359799 3.50E-03
BLUP_40DAP chr1.s_250360261 1.21E-04
BLUP_AUDDC_3_1 chr1.s_250360261 2.03E-04
BLUP_AUDDC_2_1 chr1.s_250360261 2.27E-04
BLUP_AUDDC_4_1 chr1.s_250360261 5.50E-04
BLUP_AUDDC_3_2 chr1.s_250360261 6.09E-04
BLUP_AUDDC_5_1 chr1.s_250360261 1.54E-03
BLUP_AUDDC_4_2 chr1.s_250360261 1.63E-03
BLUP_40DAP chr1.s_250360272 1.21E-04
BLUP_AUDDC_3_1 chr1.s_250360272 2.03E-04
BLUP_AUDDC_2_1 chr1.s_250360272 2.27E-04
BLUP_AUDDC_4_1 chr1.s_250360272 5.50E-04
BLUP_AUDDC_3_2 chr1.s_250360272 6.09E-04
BLUP_AUDDC_5_1 chr1.s_250360272 1.54E-03
BLUP_AUDDC_4_2 chr1.s_250360272 1.63E-03
Note: p value threshold (1/n = 3.82E-03).
Example 4:ZmUPF1analysis of haplotype of
InDel1 is a mutantels2Specifically, there was no 140bp insertion in the inbred lines. The 9 SNPs were significantly associated with chlorophyll and grain moisture content and dehydration rate-related traits (see table 2), of which 6 non-fully linked SNPs had 11 combinations in 236 inbred lines (see table 3): hap1 (1 part), Hap2 (1 part), Hap3 (4 parts), Hap4 (3 parts), Hap5 (4 parts), Hap6 (7 parts), Hap7 (160 parts), Hap8 (6 parts), Hap9 (16 parts), Hap10 (41 parts), Hap11 (20 parts). Wherein, the grains of Hap1 (GACCTA) and Hap8 (GATCTG) have low water content and quick dehydration, the chlorophyll a/b ratio of Hap1 is low (resistant to negative), the distribution frequency of the two haplotypes in an inbred line is low (1/236, 6/236), and the haplotypes belong to rare haplotypes and have potential application in breeding improvement; the grains of the Hap4 (GATCTA) and the Hap3 (GTCCTA) have high water content and slow dehydration, belong to unfavorable haplotypes and have low distribution frequency (3/236 and 4/236); the haplotype of most inbred lines is Hap7 (TTTTGG), the distribution frequency of the haplotype is high (160/236), and the moisture content and dehydration rate of grains are moderate (see table 3).
TABLE 3 haplotype analysis
Figure RE-294018DEST_PATH_IMAGE002
Note: 34-40 DAP (AUDDC _2_1), 40-46 DAP (AUDDC _3_2), 46-52 DAP (AUDDC _4_3), 52-58 DAP (AUDDC _5_4), 34-46 DAP (AUDDC _3_1), 40-52 DAP (AUDDC _4_2), 46-58 DAP (AUDDC _5_3), 34-52 DAP (AUDDC _4_1), 40-58 DAP.
Example 5:ZmUPF1application of favorable haplotypes in breeding
By means of havingZmUPF1The self-selection lines T4565 (female parent) and T884-5 (male parent) which are favorable for haplotype breed the excellent new variety Yudan 888 suitable for mechanically harvesting seeds, the plant height is 2.5m, the ear position is 97cm, the ear is long and cylindrical, the ear length is 17cm, the ear row number is 16-18, the ear axis is white, the seeds are yellow and hard, and the hundred grain weight is 32.95 g. Yudan 888 is a new corn variety suitable for grain machine harvesting, and creates a record of 1205.1kg per mu yield in Liuzhai village demonstration planting in Bingshan district of Jigong city in 2020; demonstration tests show that the variety has the advantages of rapid yellow falling and dehydration, good maturity consistency (see figure 4) and suitability for seed grain harvesting by a grain machine; the volume weight of the grains is 796 g/l, the content of crude protein is 10.38%, the content of crude fat is 4.87%, the content of crude starch is 72.94%, and the content of lysine is 0.31%.
The invention is explained in detail above with reference to the drawings and the embodiments; however, those skilled in the art should understand that they can make various changes, modifications, substitutions, combinations, and simplifications in the various embodiments without departing from the spirit of the invention.
SEQUENCE LISTING
<110> Henan university of agriculture
<120> maize leaf senescence regulation gene ZmUPF1, and identification primer and application thereof
<130> /
<160> 7
<170> PatentIn version 3.2
<210> 1
<211> 1941
<212> DNA
<213> corn UPF1
<400> 1
atggcgggga gaggcggcgg cggcaaaggc gccgcaggga ggatgatgtc gctgcaggaa 60
ttcgtgtcct gcatgcagcc gctcatcgat ctcgagaagg cggcggagat atcggcggag 120
tccgagacga gcgctaagag cctggagagg agggggtgcg tcattgccaa cctcaagtgc 180
accgatgccc agacgggact gatggggaag acgctcctgg agttccaacc caacaaaggc 240
gacgttctcc cgtctcacaa gtttggaaca catgatgtgg ttgccctgaa gccaaataag 300
gcagatgctg gatctgcttc acttggtcaa ggtgtagttt atcgcttaaa ggattcttcc 360
attactgttg cttttgatga tattcctgaa gatggtttaa acagtcctct gcgtcttgag 420
aagcttgcaa atgaggtcac ttatcgcagg atgaaggatg cactaattga acttagcaag 480
gctgtccaaa caggaccttg tgcaaacctt gttcctgttt tatttggaga gaaggcaccc 540
atgcgctcca aggatgctat gaaattcagt ccattcaaca agaacttgga tgattcacag 600
aaagaggcta tttcgaaggc tcttggatca agggatgttt tcttgcttca tgggcctcct 660
ggaactggga aaacaacaac tattattgag ataatattgc aggaggtcaa gcgtggatca 720
aagattcttg cctgtgctgc ttccaatatt gctgtggata atattgttga gcgacttgca 780
cgatacagaa caaaattggt gaggttaggg catcctgctc gtttactacc tcaagtactc 840
ggcagcgctc ttgatgcaca ggttttacga gctgataata gtagcttggc aggagacatt 900
cgcaaggaaa tgaaggtgct caatagcaaa ttgctgaagg ctaaagatag gaacactaaa 960
cgggacatca ggaaagagct caaaacactt gcaaaagagg agagaaaacg acagcagctt 1020
gcagtcactg atgtactgaa aaatgcagat gttgtgctga ccactctgac tggtgcatct 1080
tcgaaaaagt taaacggaat tacatttgat ttggttgtta ttgatgaagc tgcccaggca 1140
cttgaggtgg catgctggat agccttgttg aaagggccga gatgtattct tgctggagac 1200
catcttcaac ttcctccaac aattcaaagt gttgaggctg aaaagaaggg gatggggaag 1260
acactctttg aacgccttac tgaagcttat ggagaggaaa tcacatccat gctcactgtg 1320
cagtacagaa tgcacgagca cattatgagc tggtcatcta aagaacttta caataataag 1380
atcaaagcac attctagtgt tgctgggcat atgctctatg atctagaaga agtcactaga 1440
tcttcttcaa cagaaccaac tattgtactc attgacacta cagggtgtga tatggaagaa 1500
gtaaaagatg aagaggagag caccatgaat gagggcgagg cagcagtatc cattgcccat 1560
gccaagttgc ttgttgagag tggcgttaat gcttctgata ttggaataat tacgccttac 1620
gctgcacagg taacctgctt gaagatgatg agaaacaaag atgccaagtt gaaagattta 1680
gagatatcga cagttgatgg gtttcaaggc cgggagaaag aagccatcat catttctatg 1740
gtccggtcta actcaaagaa agaggtgggg ttcttgagcg atcacaggcg gatgaacgtg 1800
gcggtgacgc gagccaggag gcagtgctgc ctggtgtgcg acgtggagac cgtgagcagc 1860
gacaggttcc tgaaacgctt ggtcgaatac ttcgaggaga acggggagta cttgagtgct 1920
tcagaatacc agagcagctg a 1941
<210> 2
<211> 2081
<212> DNA
<213> maize leaf senescence mutant els2
<400> 2
atggcgggga gaggcggcgg cggcaaaggc gccgcaggga ggatgatgtc gctgcaggaa 60
ttcgtgtcct gcatgcagcc gctcatcgat ctcgagaagg cggcggagat atcggcggag 120
tccgagacga gcgctaagag cctggagagg agggggtgcg tcattgccaa cctcaagtgc 180
actgatgccc agacgggact gatggggaag acgctcctgg agttccaacc caacaaaggc 240
gacgttctcc cgtctcacaa gtttggaaca catgatgtgg ttgccctgaa gccaaataag 300
gcagatgctg gatctgcttc acttggtcaa ggtgtagttt atcgcttaaa ggattcttcc 360
attactgttg cttttgatga tattcctgaa gatggcttaa acagccctct gcgtcttgag 420
aagcttgcaa atgaggtcac ttatcgcagg atgaaggatg cactaattga acttagcaag 480
gctgtccaaa caggaccttg tgcaaacctt gttcctgttt tatttggaga gaaggcaccc 540
atgcgctcca aggatgctat gaaattcagt ccattcaaca agaacttgga tgattcacag 600
aaagaggcta tttcgaaggc tcttggatca agggatgttt tcttgcttca cggacctcct 660
ggaactggga aaacaacaac tattattgag ataatattgc aggaggtcaa gcgtggatca 720
aagattcttg cctgtgctgc ttccaatatt gctgtggata atattgttga gcgacttgca 780
cgatacagaa caaaattggt gaggttaggg caccctgctc gtttactgcc tcaagtgctc 840
gacagcgctc ttgatgcaca ggttttacga gctgataata gtagcttggc aggagacatt 900
cgcaaggaaa tgaaggtgct caatagcaaa ttgctgaagg ctaaagatag gaacactaaa 960
cgggacatca ggaaagagct caaaacgctt gcaaaagagg agagaaaacg acagcagctt 1020
gcagtcactg atgtactgaa aaatgcagat gttgtgctga ccactctgac tggtgcatct 1080
tcgaaaaagt taaacggaat tacatttgat ttggttgtta ttgatgaagc tgcccaggca 1140
cttgaggtgg catgctggat agccttgttg aaagggccga gatgtattct tgctggagac 1200
catcttcaac ttcctccaac aattcaaagt gttgaggctg aaaagaaggg gatgggaaag 1260
acactctttg aacgccttac tgaagcttat ggagaggaaa tcacatccat gctcactgtg 1320
cagtacagaa tgcacgagca cattatgagc tggtcatcta aagaacttta caataataag 1380
atcaaagcac attctagtgt tgctgggcat atgctctatg atctagaaga agtcactaga 1440
tcttcttcaa cagaaccaac tattgtactc attgacacta cagggtgtga tatggaagaa 1500
gtaaaagatg aagaggagag cmccatgaat gagggcgagg cagcagtatc cattgctcat 1560
gccaagttgc ttgttgagag tggcgttaat gcttctgata ttggaataat tacgccttac 1620
gctgcacagg taacctgctt gaagatgatg agaaacaaag atgccaagtt gaaagattta 1680
gagatatcta cagttgatgg gtttcaaggc cgggagaaag aagccatcat catttctatg 1740
gtccggtcta actcaaagaa agaggggctt gttcggttat tttcaatcca tatggattgg 1800
aggggattga tatggattgg aggagatttt gacttattag ggattgaaac cctctcaatc 1860
cccctcaatc catatggatt ggggtagaac cgaacaagcc ctaggtgggg ttcttgagcg 1920
atcacaggcg gatgaacgtg gcggtgacgc gagccaggag gcagtgctgc ctggtgtgcg 1980
acgtggagac cgtgagcagc gacaggttcc tgaaacgctt ggtcgaatac ttcgaggaga 2040
acggggagta cttgagtgct tcagaatacc agagcagctg a 2081
<210> 3
<211> 646
<212> PRT
<213> ZmUPF1
<400> 3
Met Ala Gly Arg Gly Gly Gly Gly Lys Gly Ala Ala Gly Arg Met Met
1 5 10 15
Ser Leu Gln Glu Phe Val Ser Cys Met Gln Pro Leu Ile Asp Leu Glu
20 25 30
Lys Ala Ala Glu Ile Ser Ala Glu Ser Glu Thr Ser Ala Lys Ser Leu
35 40 45
Glu Arg Arg Gly Cys Val Ile Ala Asn Leu Lys Cys Thr Asp Ala Gln
50 55 60
Thr Gly Leu Met Gly Lys Thr Leu Leu Glu Phe Gln Pro Asn Lys Gly
65 70 75 80
Asp Val Leu Pro Ser His Lys Phe Gly Thr His Asp Val Val Ala Leu
85 90 95
Lys Pro Asn Lys Ala Asp Ala Gly Ser Ala Ser Leu Gly Gln Gly Val
100 105 110
Val Tyr Arg Leu Lys Asp Ser Ser Ile Thr Val Ala Phe Asp Asp Ile
115 120 125
Pro Glu Asp Gly Leu Asn Ser Pro Leu Arg Leu Glu Lys Leu Ala Asn
130 135 140
Glu Val Thr Tyr Arg Arg Met Lys Asp Ala Leu Ile Glu Leu Ser Lys
145 150 155 160
Ala Val Gln Thr Gly Pro Cys Ala Asn Leu Val Pro Val Leu Phe Gly
165 170 175
Glu Lys Ala Pro Met Arg Ser Lys Asp Ala Met Lys Phe Ser Pro Phe
180 185 190
Asn Lys Asn Leu Asp Asp Ser Gln Lys Glu Ala Ile Ser Lys Ala Leu
195 200 205
Gly Ser Arg Asp Val Phe Leu Leu His Gly Pro Pro Gly Thr Gly Lys
210 215 220
Thr Thr Thr Ile Ile Glu Ile Ile Leu Gln Glu Val Lys Arg Gly Ser
225 230 235 240
Lys Ile Leu Ala Cys Ala Ala Ser Asn Ile Ala Val Asp Asn Ile Val
245 250 255
Glu Arg Leu Ala Arg Tyr Arg Thr Lys Leu Val Arg Leu Gly His Pro
260 265 270
Ala Arg Leu Leu Pro Gln Val Leu Gly Ser Ala Leu Asp Ala Gln Val
275 280 285
Leu Arg Ala Asp Asn Ser Ser Leu Ala Gly Asp Ile Arg Lys Glu Met
290 295 300
Lys Val Leu Asn Ser Lys Leu Leu Lys Ala Lys Asp Arg Asn Thr Lys
305 310 315 320
Arg Asp Ile Arg Lys Glu Leu Lys Thr Leu Ala Lys Glu Glu Arg Lys
325 330 335
Arg Gln Gln Leu Ala Val Thr Asp Val Leu Lys Asn Ala Asp Val Val
340 345 350
Leu Thr Thr Leu Thr Gly Ala Ser Ser Lys Lys Leu Asn Gly Ile Thr
355 360 365
Phe Asp Leu Val Val Ile Asp Glu Ala Ala Gln Ala Leu Glu Val Ala
370 375 380
Cys Trp Ile Ala Leu Leu Lys Gly Pro Arg Cys Ile Leu Ala Gly Asp
385 390 395 400
His Leu Gln Leu Pro Pro Thr Ile Gln Ser Val Glu Ala Glu Lys Lys
405 410 415
Gly Met Gly Lys Thr Leu Phe Glu Arg Leu Thr Glu Ala Tyr Gly Glu
420 425 430
Glu Ile Thr Ser Met Leu Thr Val Gln Tyr Arg Met His Glu His Ile
435 440 445
Met Ser Trp Ser Ser Lys Glu Leu Tyr Asn Asn Lys Ile Lys Ala His
450 455 460
Ser Ser Val Ala Gly His Met Leu Tyr Asp Leu Glu Glu Val Thr Arg
465 470 475 480
Ser Ser Ser Thr Glu Pro Thr Ile Val Leu Ile Asp Thr Thr Gly Cys
485 490 495
Asp Met Glu Glu Val Lys Asp Glu Glu Glu Ser Thr Met Asn Glu Gly
500 505 510
Glu Ala Ala Val Ser Ile Ala His Ala Lys Leu Leu Val Glu Ser Gly
515 520 525
Val Asn Ala Ser Asp Ile Gly Ile Ile Thr Pro Tyr Ala Ala Gln Val
530 535 540
Thr Cys Leu Lys Met Met Arg Asn Lys Asp Ala Lys Leu Lys Asp Leu
545 550 555 560
Glu Ile Ser Thr Val Asp Gly Phe Gln Gly Arg Glu Lys Glu Ala Ile
565 570 575
Ile Ile Ser Met Val Arg Ser Asn Ser Lys Lys Glu Val Gly Phe Leu
580 585 590
Ser Asp His Arg Arg Met Asn Val Ala Val Thr Arg Ala Arg Arg Gln
595 600 605
Cys Cys Leu Val Cys Asp Val Glu Thr Val Ser Ser Asp Arg Phe Leu
610 615 620
Lys Arg Leu Val Glu Tyr Phe Glu Glu Asn Gly Glu Tyr Leu Ser Ala
625 630 635 640
Ser Glu Tyr Gln Ser Ser
645
<210> 4
<211> 628
<212> PRT
<213> Zmupf1
<400> 4
Met Ala Gly Arg Gly Gly Gly Gly Lys Gly Ala Ala Gly Arg Met Met
1 5 10 15
Ser Leu Gln Glu Phe Val Ser Cys Met Gln Pro Leu Ile Asp Leu Glu
20 25 30
Lys Ala Ala Glu Ile Ser Ala Glu Ser Glu Thr Ser Ala Lys Ser Leu
35 40 45
Glu Arg Arg Gly Cys Val Ile Ala Asn Leu Lys Cys Thr Asp Ala Gln
50 55 60
Thr Gly Leu Met Gly Lys Thr Leu Leu Glu Phe Gln Pro Asn Lys Gly
65 70 75 80
Asp Val Leu Pro Ser His Lys Phe Gly Thr His Asp Val Val Ala Leu
85 90 95
Lys Pro Asn Lys Ala Asp Ala Gly Ser Ala Ser Leu Gly Gln Gly Val
100 105 110
Val Tyr Arg Leu Lys Asp Ser Ser Ile Thr Val Ala Phe Asp Asp Ile
115 120 125
Pro Glu Asp Gly Leu Asn Ser Pro Leu Arg Leu Glu Lys Leu Ala Asn
130 135 140
Glu Val Thr Tyr Arg Arg Met Lys Asp Ala Leu Ile Glu Leu Ser Lys
145 150 155 160
Ala Val Gln Thr Gly Pro Cys Ala Asn Leu Val Pro Val Leu Phe Gly
165 170 175
Glu Lys Ala Pro Met Arg Ser Lys Asp Ala Met Lys Phe Ser Pro Phe
180 185 190
Asn Lys Asn Leu Asp Asp Ser Gln Lys Glu Ala Ile Ser Lys Ala Leu
195 200 205
Gly Ser Arg Asp Val Phe Leu Leu His Gly Pro Pro Gly Thr Gly Lys
210 215 220
Thr Thr Thr Ile Ile Glu Ile Ile Leu Gln Glu Val Lys Arg Gly Ser
225 230 235 240
Lys Ile Leu Ala Cys Ala Ala Ser Asn Ile Ala Val Asp Asn Ile Val
245 250 255
Glu Arg Leu Ala Arg Tyr Arg Thr Lys Leu Val Arg Leu Gly His Pro
260 265 270
Ala Arg Leu Leu Pro Gln Val Leu Asp Ser Ala Leu Asp Ala Gln Val
275 280 285
Leu Arg Ala Asp Asn Ser Ser Leu Ala Gly Asp Ile Arg Lys Glu Met
290 295 300
Lys Val Leu Asn Ser Lys Leu Leu Lys Ala Lys Asp Arg Asn Thr Lys
305 310 315 320
Arg Asp Ile Arg Lys Glu Leu Lys Thr Leu Ala Lys Glu Glu Arg Lys
325 330 335
Arg Gln Gln Leu Ala Val Thr Asp Val Leu Lys Asn Ala Asp Val Val
340 345 350
Leu Thr Thr Leu Thr Gly Ala Ser Ser Lys Lys Leu Asn Gly Ile Thr
355 360 365
Phe Asp Leu Val Val Ile Asp Glu Ala Ala Gln Ala Leu Glu Val Ala
370 375 380
Cys Trp Ile Ala Leu Leu Lys Gly Pro Arg Cys Ile Leu Ala Gly Asp
385 390 395 400
His Leu Gln Leu Pro Pro Thr Ile Gln Ser Val Glu Ala Glu Lys Lys
405 410 415
Gly Met Gly Lys Thr Leu Phe Glu Arg Leu Thr Glu Ala Tyr Gly Glu
420 425 430
Glu Ile Thr Ser Met Leu Thr Val Gln Tyr Arg Met His Glu His Ile
435 440 445
Met Ser Trp Ser Ser Lys Glu Leu Tyr Asn Asn Lys Ile Lys Ala His
450 455 460
Ser Ser Val Ala Gly His Met Leu Tyr Asp Leu Glu Glu Val Thr Arg
465 470 475 480
Ser Ser Ser Thr Glu Pro Thr Ile Val Leu Ile Asp Thr Thr Gly Cys
485 490 495
Asp Met Glu Glu Val Lys Asp Glu Glu Glu Ser Thr Met Asn Glu Gly
500 505 510
Glu Ala Ala Val Ser Ile Ala His Ala Lys Leu Leu Val Glu Ser Gly
515 520 525
Val Asn Ala Ser Asp Ile Gly Ile Ile Thr Pro Tyr Ala Ala Gln Val
530 535 540
Thr Cys Leu Lys Met Met Arg Asn Lys Asp Ala Lys Leu Lys Asp Leu
545 550 555 560
Glu Ile Ser Thr Val Asp Gly Phe Gln Gly Arg Glu Lys Glu Ala Ile
565 570 575
Ile Ile Ser Met Val Arg Ser Asn Ser Lys Lys Glu Gly Leu Val Arg
580 585 590
Leu Phe Ser Ile His Met Asp Trp Arg Gly Leu Ile Trp Ile Gly Gly
595 600 605
Asp Phe Asp Leu Leu Gly Ile Glu Thr Leu Ser Ile Pro Leu Asn Pro
610 615 620
Tyr Gly Leu Gly
625
<210> 5
<211> 140
<212> DNA
<213> els2 insertion sequence in mutant
<400> 5
gggcttgttc ggttattttc aatccatatg gattggaggg gattgatatg gattggagga 60
gattttgact tattagggat tgaaaccctc tcaatccccc tcaatccata tggattgggg 120
tagaaccgaa caagccctag 140
<210> 6
<211> 31
<212> DNA
<213> InDel primer upstream
<400> 6
cttcagctgt actataccct gatgcacata c 31
<210> 7
<211> 31
<212> DNA
<213> InDel primer downstream
<400> 7
ggcaacgtca caacaataca tcatttatgc g 31

Claims (8)

1. Maize leaf senescence regulating geneZmUPF1The cDNA sequence is shown in SEQ ID NO. 2.
2. The maize leaf senescence control gene of claim 1ZmUPF1The amino acid sequence of the expression product of (1) is shown in SEQ ID NO. 4.
3. A method for identifying the maize leaf senescence-regulating gene of claim 1ZmUPF1The InDel primer is designed based on the following sequence differences:
an insertion of 140bp is present in the region of the 250359942-250359943 locus of the fourth version of the maize reference genome B73, and the inserted sequence is shown as SEQ ID NO. 5.
4. The InDel primer of claim 3, wherein the primer sequence is as follows:
F: 5’ CTTCAGCTGTACTATACCCTGATGCACATAC3’，
R: 5’ GGCAACGTCACAACAATACATCATTTATGCG3’ 。
5. a kit for identifying a maize leaf senescence genotype comprising the InDel primer of claim 3.
6. Use of the molecular marker primer of claim 3 or the kit of claim 4 for screening corn inbred lines resistant to premature senility or suitable for grain machine harvesting.
7. A method for identifying the senescence genotype of corn leaves comprises the following steps:
(1) taking a tissue sample of corn to be identified and extracting genome DNA;
(2) performing PCR amplification by using the obtained corn genomic DNA as a template and using the InDel primer of claim 3 or the kit of claim 4;
(3) detecting the length of the amplification product of the primer pair:
890bp corresponds toZmUPF1The progeria genotype of (a); 750bp corresponds toZmUPF1The general senescence genotype of (1).
8. A method for breeding corn strains suitable for grain machine harvesting is characterized by comprising the following steps:
(1) B73V 4: the genotypes of the sites chr1. s-250348609, chr1. s-250359798, chr1. s-250360272, chr1. s-250346896, chr1. s-250347702 and chr1. s-250349740;
(2) selection B73V 4: and (3) maize line materials with loci of Cchr 1.s _250348609, Cchr 1.s _250359798, Cchr 1.s _250360272, Cchr 1.s _250346896, Cchr 1.s _250347702 and Cchr 1.s _250349740 in sequence of GG, AA, CC or TT, CC, TT, AA or GG genotypes are selfed or hybridized to select favorable haplotype lines.
CN202111065183.1A 2021-09-11 2021-09-11 Corn leaf senescence regulation gene ZmUPF1, and identification primer and application thereof Active CN113862291B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202111065183.1A CN113862291B (en) 2021-09-11 2021-09-11 Corn leaf senescence regulation gene ZmUPF1, and identification primer and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202111065183.1A CN113862291B (en) 2021-09-11 2021-09-11 Corn leaf senescence regulation gene ZmUPF1, and identification primer and application thereof

Publications (2)

Publication Number Publication Date
CN113862291A true CN113862291A (en) 2021-12-31
CN113862291B CN113862291B (en) 2022-06-10

Family

ID=78995328

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202111065183.1A Active CN113862291B (en) 2021-09-11 2021-09-11 Corn leaf senescence regulation gene ZmUPF1, and identification primer and application thereof

Country Status (1)

Country Link
CN (1) CN113862291B (en)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101831450A (en) * 2009-03-12 2010-09-15 复旦大学 Key gene for regulating and controlling chlorophyll degradation in the senescence process of plant and application thereof
CN104805100A (en) * 2015-04-03 2015-07-29 浙江大学 Application of paddy rice gene OsS[mu]BP-2 in delaying plant leaf senescence
CN107188938A (en) * 2016-03-14 2017-09-22 中国农业大学 Paddy rice resists leaf senile albumen RLS3 and its encoding gene and application
CN112301039A (en) * 2020-11-05 2021-02-02 四川农业大学 Corn leaf spot horse stripe color gene zb9, InDel molecular marker linked with same and application

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101831450A (en) * 2009-03-12 2010-09-15 复旦大学 Key gene for regulating and controlling chlorophyll degradation in the senescence process of plant and application thereof
CN104805100A (en) * 2015-04-03 2015-07-29 浙江大学 Application of paddy rice gene OsS[mu]BP-2 in delaying plant leaf senescence
CN107188938A (en) * 2016-03-14 2017-09-22 中国农业大学 Paddy rice resists leaf senile albumen RLS3 and its encoding gene and application
CN112301039A (en) * 2020-11-05 2021-02-02 四川农业大学 Corn leaf spot horse stripe color gene zb9, InDel molecular marker linked with same and application

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
SCHNABLE PS, ET AL: ""Zea mays uncharacterized LOC100280381 (LOC100280381), mRNA，NM_001361066.1"", 《NCBI BLAST》 *
WENQIANG LI, ET AL: ""The genetic architecture of the dynamic changes in grain moisture in maize"", 《PLANT BIOTECHNOL J》 *

Also Published As

Publication number Publication date
CN113862291B (en) 2022-06-10

Similar Documents

Publication Publication Date Title
Hori et al. Detection of quantitative trait loci controlling pre-harvest sprouting resistance by using backcrossed populations of japonica rice cultivars
Zhang et al. Fine mapping of fw3. 2 controlling fruit weight in tomato
Liu et al. Quantitative trait locus analysis for deep-sowing germination ability in the maize IBM Syn10 DH population
CA3175033A1 (en) Autoflowering markers
Kim et al. Loss-of-function alleles of heading date 1 (Hd1) are associated with adaptation of temperate japonica rice plants to the tropical region
WO2013060136A1 (en) Cloning and application of semi-dominant gene qgl3 capable of controlling grain length and grain weight of rice kernel
Hussin et al. SiMADS34, an E-class MADS-box transcription factor, regulates inflorescence architecture and grain yield in Setaria italica
Hu et al. Identification of loci and candidate genes responsible for pod dehiscence in soybean via genome-wide association analysis across multiple environments
CN112375130B (en) Corn ear length gene and molecular marker and application thereof
CN111153974A (en) Corn disease-resistant gene and molecular marker and application thereof
Xu et al. An overexpressed Q allele leads to increased spike density and improved processing quality in common wheat (Triticum aestivum)
Martinez et al. Exome sequencing of bulked segregants identified a novel TaMKK3-A allele linked to the wheat ERA8 ABA-hypersensitive germination phenotype
CN112301039A (en) Corn leaf spot horse stripe color gene zb9, InDel molecular marker linked with same and application
US20100319083A1 (en) Method of producing plants having enhanced transpiration efficiency and plants produced therefrom
Takanashi et al. DOMINANT AWN INHIBITOR encodes the ALOG protein originating from gene duplication and inhibits awn elongation by suppressing cell proliferation and elongation in sorghum
CN114763375B (en) Gene for regulating quality of rice grains and application thereof
BR102014032982B1 (en) METHODS FOR RESTORING FERTILITY, CHANGING MORPHOLOGY, DETECTING A PLANT, AND DETECTING AN EXPRESSION LEVEL OF A CYTOPLASMIC MALE-STERILE RESTORING TRAIT
Zheng et al. Identification of candidate genes for panicle length in Oryza sativa L. ssp. japonica via genome-wide association study and linkage mapping
Wu et al. Characterization of a single recessive yield trait mutant with elevated endogenous ABA concentration and deformed grains, spikelets and leaves
Zhou et al. The G protein-coupled receptor COLD1 promotes chilling tolerance in maize during germination
CN113862291B (en) Corn leaf senescence regulation gene ZmUPF1, and identification primer and application thereof
CN109121420B (en) Cold-resistant plant
Guo et al. Genetic analysis and gene mapping of a dwarf and liguleless mutation in barley
Ogrodowicz et al. Genome-wide association study of agronomical and root-related traits in spring barley collection grown under field conditions
CN114787388A (en) Molecular markers for reduced pyruvate level traits in onions

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant