CN113846110B - Cryptomeria fortunei transcription factor CfMYB5 gene and application thereof - Google Patents
Cryptomeria fortunei transcription factor CfMYB5 gene and application thereof Download PDFInfo
- Publication number
- CN113846110B CN113846110B CN202111383846.4A CN202111383846A CN113846110B CN 113846110 B CN113846110 B CN 113846110B CN 202111383846 A CN202111383846 A CN 202111383846A CN 113846110 B CN113846110 B CN 113846110B
- Authority
- CN
- China
- Prior art keywords
- gene
- cfmyb5
- cryptomeria fortunei
- transcription factor
- fortunei
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
- C12N15/8202—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by biological means, e.g. cell mediated or natural vector
- C12N15/8205—Agrobacterium mediated transformation
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
- C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
- C12N15/8255—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine involving lignin biosynthesis
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
- Y02A40/10—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in agriculture
- Y02A40/146—Genetically Modified [GMO] plants, e.g. transgenic plants
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Biomedical Technology (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Wood Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Cell Biology (AREA)
- Botany (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Nutrition Science (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a cryptomeria fortunei CfMYB5 gene and application thereof, belonging to the technical field of plant genetic engineering. The cloned CfMYB5 gene belongs to R2R3-MYB transcription factors. The nucleotide sequence of the gene cloned by the invention is shown as SEQ ID NO.1, and the amino acid sequence is shown as SEQ ID NO. 2. The invention discloses the function of the CfMYB5 gene in negative control lignin synthesis and secondary wall formation through sequence comparison, evolution analysis and functional verification. Also provided is a method of using the gene, over-expression of which results in transgenic plant plants with reduced height, leaf size or cell wall thickness. The cloned gene plays an important role in molecular biology research related to the timber property of the cryptomeria fortunei.
Description
Technical Field
The invention belongs to the technical field of plant genetic engineering, and particularly relates to a Cryptomeria fortunei (Cryptomeria fortunei) transcription factor CfMYB5 gene and application thereof.
Background
Transcription Factors (TF), also known as trans-acting factors, are binding proteins that specifically interact with cis-acting elements in the promoter region of eukaryotic genes, and activate or inhibit Transcription through interactions between Transcription factors and other related proteins.
A common feature of MYB-like transcription factors in plants is a MYB domain of about 50 amino groups at its N-terminus. Most MYB proteins contain 1-3 tandem, incompletely repeated MYB domains (R1, R2 and R3). MYB domains usually fold into helix-turn-helix (HTH) binding to the DNA major groove. The C-terminus of the protein usually contains a transcriptional activation domain rich in acidic amino acids, which tend to fold into an amphipathic α -helix to function. The MYB gene family is involved in a range of biological processes including exogenous hormone response, auxin signalling, secondary wall formation etc.
Cryptomeria fortunei (Cryptomeria fortunei) is a unique tree species in China and is produced in zones with elevation lower than 1100 m, such as Tianmu mountain in Zhejiang, nanfang in Fujian, thirty-eight hundred Kam and Lu mountain in Jiangxi. The cultivation is carried out in south China of Jiangsu, zhejiang, anhui, henan, hubei, hunan, sichuan, guizhou, yunnan, guangxi and Guangdong, etc., and the growth is good. The young cedar can resist shade slightly, and can grow faster in warm and humid climate and mountainous areas with acid and thick soil and good drainage; the material has the advantages of yellow-white edge material, light red brown core material, light and soft material, straight texture, thin structure, strong corrosion resistance and easy processing, and is a good material for industrial buildings.
At present, the research on the MYB transcription factor of the cedar is less, and a reliable theoretical basis is lacked, so that the research on the MYB transcription factor of the cedar is developed, and the genetic improvement of the cedar material and the breeding of good varieties are facilitated.
Disclosure of Invention
Aiming at the current situation that research on a cryptomeria fortunei transcription factor CfMYB5 gene is almost blank, one of the technical problems to be solved by the invention is to clone the cryptomeria fortunei transcription factor CfMYB5 gene. The invention also aims to provide a specific application of the cryptomeria fortunei transcription factor CfMYB5 gene.
In order to solve the technical problems, the technical scheme adopted by the invention is as follows:
a Cryptomeria fortunei transcription factor CfMYB5 gene has a nucleotide sequence shown in SEQ ID NO. 1.
The amino acid sequence of the coding protein of the cryptomeria fortunei transcription factor CfMYB5 gene is shown in SEQ ID NO. 2.
A carrier containing the cryptomeria fortunei transcription factor CfMYB5 gene.
Further, the vector is a plant recombinant expression vector.
The cryptomeria fortunei transcription factor CfMYB5 gene is applied to reduction of plant height, leaf size or cell wall thickness.
Further, the application specifically comprises:
1) Constructing a plant recombinant expression vector of the cryptomeria fortunei transcription factor CfMYB5 gene;
2) Transforming the constructed plant recombinant expression vector of the cryptomeria fortunei transcription factor CfMYB5 gene into plant tissues or plant cells;
3) And culturing and screening to obtain transgenic plant with reduced height, leaf size or cell wall thickness.
Compared with the prior art, the invention has the beneficial effects that:
the Cryptomeria fortunei CfMYB5 gene is successfully cloned, the nucleotide sequence of the Cryptomeria fortunei CfMYB5 gene is shown as SEQ ID No.1, and the coding protein sequence of the Cryptomeria fortunei CfMYB5 gene is shown as SEQ ID No. 2. Multiple sequence comparison, genetic evolution analysis and transgenic function verification reveal the phylogenetic relationship and potential biological function of the Cryptomeria fortunei CfMYB5 gene, and provide a method for applying the gene in changing lignin content and secondary wall thickness, and transgenic plant with reduced height, leaf size or cell wall thickness can be obtained by over-expressing the gene. The gene cloned by the invention plays an important role in the molecular biology research related to the wood property of the cryptomeria fortunei wood.
Drawings
FIG. 1 is an electrophoretogram of Cryptomeria fortunei CfMYB5 gene;
FIG. 2 is an alignment chart of amino acid sequence of Cryptomeria fortunei transcription factor CfMYB5 gene;
FIG. 3 is a phylogenetic tree analysis of the Cryptomeria fortunei CfMYB5 gene;
FIG. 4 is a diagram of a PBI121 overexpression vector;
FIG. 5 is a comparison of plant height of Cryptomeria fortunei transcription factor CfMYB5 transgenic plant, the left of the figure shows wild type, and the right of the figure shows transgenic plant CfMYB5;
FIG. 6 is a comparative picture of leaves of a Cryptomeria fortunei transcription factor CfMYB5 transgenic plant, the left of the picture showing wild type and the right of the picture showing transgenic plant CfMYB5;
FIG. 7 is a graph of the lignin content of wild type and cryptomeria fortunei transcription factor CfMYB5 transgenic plants, WT shows the wild type lignin content, and CfMYB5 shows the lignin content of plants transformed with CfMYB5 gene;
FIG. 8 is a plot of secondary wall thickness, with wild type on the left and transgenic CfMYB5 plants on the right (50 μm scale in the figure).
Detailed Description
The methods used in the present invention are further described below in connection with specific embodiments of the methods. The molecular biological test methods, which are not specifically described in the examples below, are performed according to the methods specifically described in molecular cloning, a laboratory manual (third edition) j. Sambrook, or according to the reagents and product instructions.
Example 1: cloning of Cryptomeria fortunei transcription factor CfMYB5 gene
1. RNA extraction
The experimental material used in the invention is a layer tissue formed by cryptomeria fortunei: a plant with good growth vigor is collected from the late mountains of the campus of the university of Nanjing forestry in 2019, 5 and 13, RNA is extracted by using a centrifugal column type RNA extraction kit of the Baitach Biotechnology company, and then quality and concentration detection is carried out.
2. First Strand cDNA Synthesis and reverse transcription PCR
3. Cloning of Cryptomeria fortunei CfMYB5 gene
Upstream and downstream primers for the CfMYB5 gene, cfMYB5-F (ATGGGAAGCTCCATGTTGTGTGAC) and CfMYB5-R (AGATTGGAGTACTCGTCGACTGTCT), were designed as primers for the amplification reaction (5 '-3').
After the reaction, the PCR product was separated by 1% agarose gel electrophoresis to obtain a product of about 781bp in length, as shown in FIG. 1. And (5) sequencing after purification and recovery. The sequencing result is shown as SEQ ID NO.1, the nucleotide sequence is 781bp in length, the coding protein sequence is shown as SEQ ID NO.2, and the protein is composed of 259 amino acids.
Example 2: biogenic analysis and functional verification of Cryptomeria fortunei CfMYB5 gene
1. Sequence alignment analysis of Cryptomeria fortunei CfMYB5 gene
The cloned gene is subjected to sequence alignment with MYB transcription factors known in other species by using DNAMAN, and the result is shown in FIG. 2, and the result shows that the cloned gene belongs to the MYB transcription factor family, and one tryptophan (W) is separated from every 18-20 amino acids, and the first tryptophan of the R3 structural domain is usually replaced by I/F/L.
2. Cryptomeria fortunei CfMYB5 gene evolution analysis
Phylogenetic analysis was performed using MEGA5.0 and other transcription factors whose function has been verified and studied in other species, and as a result, as shown in fig. 3, it was preliminarily presumed that it may have an effect of inhibiting lignin synthesis and secondary wall formation.
3. Cryptomeria fortunei CfMYB5 gene function verification
3.1 overexpression vector construction
The overexpression vector used in the invention is PBI121, and the map of the vector is shown in FIG. 4. The two endonucleases used in the present invention are BamH I enzyme, xba I enzyme. Designing a homologous recombination primer (5 '-3'):
CfMYB5-F：gagaacacgggggactctagaATGGGAAGAGCTCCATGTTGTG
CfMYB5-R：ggactgaccacccggggatccCTATCTTAACAAGAGCATTGTACGGG
the double digestion reaction is as follows:
the recombination reaction system is as follows:
and transforming the obtained ligation product PBI121-CfMYB5 into escherichia coli to obtain a positive strain, and extracting the positive strain to obtain a PBI121-CfMYB5 plasmid for later use.
3.2 transformation of Agrobacterium GV3101
Transforming agrobacterium GV3101 with plasmid DNA (PBI 121-CfMYB 5) obtained from positive clone bacterial liquid with correct bacterial detection, and comprises the following steps:
(1) Taking agrobacterium tumefaciens strain preserved at the temperature of minus 80 ℃ to be in a room temperature or melting palm of a hand to be in an ice-water mixed state and then inserting the agrobacterium tumefaciens strain into ice;
(2) Adding 0.01-1 μ g plasmid DNA (PBI 121-CfMYB 5) into 100 μ L competent cells, and blending by flicking with hand;
(3) Placing on ice in ice bath for 5min, quick freezing with liquid nitrogen for 5min, water bath at 37 deg.C for 5min, and ice bath for 5min;
(4) Adding 700 μ L LB liquid medium (without any antibiotics), shaking at 28 deg.C and 200rpm for 3h;
(5) Centrifuging at 6000rpm for 1min;
(6) Discarding part of supernatant, reserving about 100-120 μ L of bacterial liquid, gently blowing and uniformly mixing the bacterial liquid and the resuspended bacterial block, coating the bacterial block on an LB (Kan +) solid plate containing corresponding antibiotics, standing for 15min, and airing the surface bacterial liquid;
(7) Placing upside down in 28 deg.C incubator for dark culture for 42-48h;
(8) And detecting the positive bacterial colony by PCR, storing at 4 ℃ and using for subsequent transgenic infection of the tobacco.
3.3 Agrobacterium activation and infection
(1) Activating and propagating the correctly detected agrobacterium liquid, putting the agrobacterium liquid into a 100mL sterile conical flask, and performing amplification according to the ratio of 1: diluting 50 to 50mL LB liquid culture medium (Kan + Rif), culturing at 28 deg.C and 200rpm for 36-48h until the color of bacterial liquid is turbid, and OD value A600 is about 1.0;
(2) Transferring the bacterial liquid into a sterile centrifuge tube, centrifuging at 5000rpm for 10min at room temperature, discarding the supernatant, resuspending the bacterial liquid with 1/2MS or MS liquid culture medium, and diluting to A600=0.6 for transformation;
(3) And (3) putting the diluted bacterial liquid into a constant-temperature shaking table, and culturing for 30min at 28 ℃ and 200rpm for infection.
3.4 tobacco leaf disc-mediated infection
(1) Pre-culturing: cutting wild type tobacco leaf without resistance into leaf disc of about 1cm × 1cm in a super clean bench, culturing in dark for 2-3d, and allowing leaf edge to curl;
(2) Co-culturing: and (3) putting the leaf disc into the diluted bacterial liquid, soaking, oscillating and infecting for 10-15min, taking out the leaf disc, and putting the leaf disc on sterile filter paper to suck away the redundant bacterial liquid. Placing the infected leaf disc on an MS solid culture medium (a layer of sterile filter paper is paved on the culture medium) without any antibiotics, and performing dark culture at 28 ℃ for 2-3d;
(3) Differentiation culture: transferring the leaf disc co-cultured in the dark to a differentiation medium for differentiation culture (MS medium, 2.0mg/L6-BA,0.05mg/LNAA,50mg/Lkan,100 mg/LTMT);
(4) Screening and culturing: inoculating the callus differentiated for about 20-25 days into a screening culture medium again, and continuously differentiating adventitious buds (MS culture medium, 2.0mg/L6-BA,0.05mg/L NAA,50mg/L Kan and 150mg/L TMT);
(5) Strong seedling culture: after about 2-3 weeks, when the adventitious bud grows to about 1cm, cutting off, and transferring to strong seedling culture medium for strong seedling culture (MS culture medium, 1.0 mg/L6-BA, 0.1mg/LNAA,50mg/L Kan,200mg/L TMT);
(6) Rooting culture: placing the adventitious bud into a rooting culture medium (1/2 MS culture medium, 200mg/L TMT) when the adventitious bud grows to 1-2cm for about 10-15 days to grow adventitious root, and transferring the sterile seedling with good root system growth into soil for culture after hardening the seedling for 4-5 days;
(7) Meanwhile, setting a wild type tobacco leaf disc which is not infected by agrobacterium as a negative control.
3.5 phenotype observation and index determination of transgenic plants
Observing the plant height and the leaf size of the positive clone plant, simultaneously determining the lignin content by using an ultraviolet spectrophotometry, and observing the cell wall thickness by using an environmental scanning electron microscope.
The results are shown in FIGS. 5-8, where the plants transformed with CfMYB5 had reduced plant height and smaller leaves compared to the wild type; the lignin content detection result shows that: the lignin content of the transgenic CfMYB5 plants is obviously reduced compared with that of wild plants; in addition, secondary wall thickness observations indicate that: the secondary wall thickness of the transgenic CfMYB5 plants was significantly reduced compared to the wild type. The results of phenotype observation, lignin content determination and secondary wall thickness observation show that the cedar CfMYB5 has the effects of inhibiting secondary wall synthesis and reducing the lignin content.
Sequence listing
<110> Nanjing university of forestry
<120> Cryptomeria fortunei transcription factor CfMYB5 gene and application thereof
<130> 100
<160> 2
<170> SIPOSequenceListing 1.0
<210> 1
<211> 780
<212> DNA
<213> Cryptomeria fortunei
<400> 1
atgggaagag ctccatgttg tgacaatggt gacaggaaca aaggagcctg gactacagaa 60
gaagatgaaa ggcttatcca atacattcaa gcccacggag aaggctgctg gaggtcactt 120
cctaaggctg caggtctgct tcgttgtggc aagagttgca ggctaagatg gataaattat 180
ctgcgccctg acctcaagcg gggtaatttc tctgaagatg aagaggatct catcttcaaa 240
ttacacgccc ttcttggaaa caagtggtct ctgatagccg gtcgactacc cggacgaacc 300
gacaacgaga taaaaaacta ctggaactca catctgaaaa gaaaactgct tagtaggggc 360
gtcgacccga agacccatcg accattttac aaaaccatca cccacaatca gaaatcggac 420
attcttacac aggccaaatc agaaatcgac catgaaaaat gctcaggaga gacagtcgac 480
gaggtactcc aatcttcgga aggcgaccat tgtgagcaag caattacaag cgattcccac 540
acccacaccc acaatcagac tcaaactcaa actcaagctc agaatcacag agagcttctg 600
aatctgaatc tggaattgtc gataacttct ccatcgattt gttcaacggc tcgcgacgaa 660
acagtccatt ctcaccaagg ctgtcatggc cggctttcgt ctggcaagga tgaaataaac 720
ggcctaaatt ctgtcggctg ctacgtagat ttcccccgta caatgctctt gttaagatag 780
<210> 2
<211> 259
<212> PRT
<213> Cryptomeria fortunei
<400> 2
Met Gly Arg Ala Pro Cys Cys Asp Asn Gly Asp Arg Asn Lys Gly Ala
1 5 10 15
Trp Thr Thr Glu Glu Asp Glu Arg Leu Ile Gln Tyr Ile Gln Ala His
20 25 30
Gly Glu Gly Cys Trp Arg Ser Leu Pro Lys Ala Ala Gly Leu Leu Arg
35 40 45
Cys Gly Lys Ser Cys Arg Leu Arg Trp Ile Asn Tyr Leu Arg Pro Asp
50 55 60
Leu Lys Arg Gly Asn Phe Ser Glu Asp Glu Glu Asp Leu Ile Phe Lys
65 70 75 80
Leu His Ala Leu Leu Gly Asn Lys Trp Ser Leu Ile Ala Gly Arg Leu
85 90 95
Pro Gly Arg Thr Asp Asn Glu Ile Lys Asn Tyr Trp Asn Ser His Leu
100 105 110
Lys Arg Lys Leu Leu Ser Arg Gly Val Asp Pro Lys Thr His Arg Pro
115 120 125
Phe Tyr Lys Thr Ile Thr His Asn Gln Lys Ser Asp Ile Leu Thr Gln
130 135 140
Ala Lys Ser Glu Ile Asp His Glu Lys Cys Ser Gly Glu Thr Val Asp
145 150 155 160
Glu Val Leu Gln Ser Ser Glu Gly Asp His Cys Glu Gln Ala Ile Thr
165 170 175
Ser Asp Ser His Thr His Thr His Asn Gln Thr Gln Thr Gln Thr Gln
180 185 190
Ala Gln Asn His Arg Glu Leu Leu Asn Leu Asn Leu Glu Leu Ser Ile
195 200 205
Thr Ser Pro Ser Ile Cys Ser Thr Ala Arg Asp Glu Thr Val His Ser
210 215 220
His Gln Gly Cys His Gly Arg Leu Ser Ser Gly Lys Asp Glu Ile Asn
225 230 235 240
Gly Leu Asn Ser Val Gly Cys Tyr Val Asp Phe Pro Arg Thr Met Leu
245 250 255
Leu Leu Arg
Claims (1)
1. Cryptomeria fortunei transcription factorCfMYB5Use of a gene for reducing the lignin content of a transgenic plant, characterized in thatCfMYB5The gene nucleotide sequence is shown in SEQ ID NO.1, and the plant is tobacco.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111383846.4A CN113846110B (en) | 2021-11-19 | 2021-11-19 | Cryptomeria fortunei transcription factor CfMYB5 gene and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111383846.4A CN113846110B (en) | 2021-11-19 | 2021-11-19 | Cryptomeria fortunei transcription factor CfMYB5 gene and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113846110A CN113846110A (en) | 2021-12-28 |
| CN113846110B true CN113846110B (en) | 2023-03-24 |
Family
ID=78982164
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111383846.4A Active CN113846110B (en) | 2021-11-19 | 2021-11-19 | Cryptomeria fortunei transcription factor CfMYB5 gene and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113846110B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114395023B (en) * | 2022-01-27 | 2022-12-13 | 广东省农业科学院果树研究所 | Jatropha curcas early flowering gene JcRR1B and application thereof |
-
2021
- 2021-11-19 CN CN202111383846.4A patent/CN113846110B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN113846110A (en) | 2021-12-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109081865B (en) | Phyllostachys pubescens PeVQ28 protein and coding gene and application thereof | |
| CN113846110B (en) | Cryptomeria fortunei transcription factor CfMYB5 gene and application thereof | |
| CN114369603B (en) | OfMYB1R gene related to inhibition of synthesis of sweet osmanthus fragrance substances, encoding protein and application thereof | |
| CN109293757B (en) | Phyllostachys pubescens PeTCP10 protein with function of controlling blade curling and application thereof | |
| CN109486831B (en) | Carmine radish anthocyanin biosynthesis regulatory gene RsAN1 and application thereof | |
| CN113073103B (en) | Betula platyphylla BpYAB1 gene and application thereof in creation of white birch with curled leaves | |
| CN111909249B (en) | Anthocyanin synthesis regulation transcription factor and application thereof | |
| CN110106171B (en) | Long-chain non-coding RNA and application thereof in regulating and controlling low temperature resistance of plants | |
| CN113234739B (en) | Tobacco cytochrome P450 subfamily CYP710A gene and application thereof | |
| CN112725355B (en) | A dragon fruit HuNIP6 for promoting plant blooming in advance; 1 gene and application thereof | |
| CN113897374B (en) | Cryptomeria fortunei transcription factor CfMYB4 gene and application thereof | |
| CN111662368B (en) | Rubber grass drought-enduring gene TkMYC2, protein, primer, vector, host bacterium and application thereof | |
| CN114106122B (en) | Cryptomeria fortunei transcription factor CfMYB1 gene and application thereof | |
| CN114657186A (en) | Phyllostachys pubescens leaf shape regulating gene PheLBD29 and application thereof | |
| CN113151317A (en) | Tobacco delta (24) -sterol reductase gene and application thereof | |
| CN110106172B (en) | Long-chain non-coding RNA and application thereof in regulating and controlling low temperature resistance of plants | |
| CN114525298A (en) | Application of soybean protein GmFVE in plant salt tolerance regulation | |
| CN111778258A (en) | MYB140 gene, constructed vector and expressed transgenic tobacco plant | |
| CN116445503A (en) | Cryptomeria fortunei CfNAC1 gene and expression protein and application thereof | |
| CN114875043B (en) | Betula alba BpPIF4 gene participating in adventitious root development and application thereof | |
| CN113278639B (en) | Tobacco NUDIX hydrolase gene and application thereof | |
| CN117051014B (en) | Cloning and application of cold-resistant gene MYB97 of swallow flower | |
| CN110903371B (en) | Tobacco cellobiose-related protein NtCRP1 and application thereof | |
| CN114457093B (en) | LrWRKY-R1 gene of lily of Minjian river and application thereof | |
| CN113151322B (en) | Tobacco starch synthase gene and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |