CN113832184A

CN113832184A - Application of methioninase gene therapy in treating malignant tumor

Info

Publication number: CN113832184A
Application number: CN202010591468.8A
Authority: CN
Inventors: 赵子建; 李芳红; 李玉玉; 周素瑾; 赵正刚
Original assignee: Guangzhou Huajin Pharmaceutical Technology Co ltd
Current assignee: Guangzhou Huajin Pharmaceutical Technology Co ltd
Priority date: 2020-06-24
Filing date: 2020-06-24
Publication date: 2021-12-24
Also published as: KR20230057336A; JP2023531092A; AU2020455277A1; EP4170035A1; US20230250451A1; EP4170035A4; WO2021258492A1

Abstract

The invention discloses application of a methionine enzyme gene therapy in treating malignant tumors. The gene therapy uses virus as a vector, inserts exogenous methionine enzyme gene, forms a methionine enzyme expression system in the tumor, and provides an endogenous mechanism for further consuming methionine. In vitro cytology experiments show that the methionine enzyme gene therapy obviously reduces the level of intracellular methionine, effectively inhibits the proliferation of tumor cells, and can be used for preparing the medicine for targeted therapy of malignant tumors.

Description

Application of methioninase gene therapy in treating malignant tumor

Technical Field

The invention relates to the fields of tumor treatment and gene therapy in the technical field of medicines, in particular to application of methioninase gene therapy to a medicine for targeted therapy of malignant tumors.

Background

Malignant tumor is a common disease seriously threatening human life and health, and according to the latest statistical data in 2015, the death rate of the malignant tumor accounts for 23.91 percent of all the causes of death of people. At present, a plurality of means and methods for treating malignant tumors, such as surgical operation, chemical drug therapy, radiotherapy and the like, have certain curative effect on the malignant tumors, but have serious adverse reaction, limited curative effect, easy generation of drug resistance and the like, so that the search for a new targeted and accurate treatment means, such as gene therapy, is the key point of the treatment of the malignant tumors. Because of the rapid growth of tumor cells, the nutrient requirements and metabolism are not in the same pattern as normal undifferentiated cells, and in order to maintain continued proliferation, tumor cells must adjust their metabolic and nutrient acquisition patterns. A large number of basic and clinical test researches show that the metabolism of targeted tumor-dependent amino acids and derivatives thereof, such as methionine, glutamine, glutamic acid, arginine, tryptophan and the like, is utilized to develop a novel medicament, so that the growth of tumors can be effectively inhibited. Therefore, targeted metabolic regulation therapy is a new direction for tumor therapy.

Methionine dependence is a common feature of most tumor cells, such as breast cancer, prostate cancer, lung cancer, colon cancer, kidney cancer, bladder cancer, melanoma, glioma, etc., whereas normal cells do not have methionine dependence, and tumors with high malignancy have higher methionine dependence. Several in vivo and in vitro experiments have successively demonstrated that the direct consumption of methionine-deficient diets can delay the proliferation of tumor cells. However, the long-term deficiency or insufficiency of methionine in the diet can cause malnutrition and metabolic disturbance of the body, and can also aggravate canceration due to the fact that DNA is in a hypomethylated state for a long time. Thus, a reduction in methionine in vivo by specifically decomposing methionine by methioninase MEGL is more effective in inhibiting tumor cell growth or causing regression. However, because mammals do not express methioninase per se, and have certain side effects in an exogenous administration mode, the mammals often cause immune response of organisms, and therefore, the search for endogenously expressed methioninase is a better choice. The goal of cancer gene therapy is to introduce therapeutic genes into tumor cells. These therapeutic genes introduced into the target cells can correct mutated genes, suppress active oncogenes, or produce other properties to the cell, etc. Suitable exogenous therapeutic genes include, but are not limited to, immunotherapeutic, anti-angiogenic, chemoprotective and "suicide" genes, and they can be introduced into cells using modified viral vectors or non-viral methods, including electroporation, gene guns and lipid or polymer coatings. The requirements for an optimal viral vector include the efficient ability to find a particular target cell and express the viral genome in the target cell. All these properties of viral vectors have been exploited in the last decades and, for example, retroviral, adenoviral, adeno-associated viral and oncolytic viral vectors and the like have been extensively studied in biomedicine.

Methionine is an essential amino acid, and S-adenosylmethionine (SAM) is produced by methionine adenosyltransferase. SAM is also called active methionine, is the most important methyl direct donor in vivo, and participates in the methyl transfer catalytic reaction of various substances such as DNA, protein and the like in vivo. Histone methyltransferase EZH2 is an active ingredient having histone methyltransferase in polycomb inhibitory complex 2(PRC2), and mainly inhibits transcription of a relevant gene (e.g., cancer suppressor gene) by adding an active methyl group of SAM to lysine 27 (H3K27) of histone 3 to participate in chromatin condensation. The study finds that EZH2 and histone H3K27 methylation are closely related to cancer. EZH2 was first found to be highly expressed in lymphomas, metastatic prostate and breast cancers, and associated with the infiltration of breast cancer. In addition, EZH2 is overexpressed in many human malignancies, such as lung cancer, lymphoma, leukemia, pancreatic cancer, cervical cancer, intestinal cancer, liver cancer, stomach cancer, melanoma, renal cancer, bladder cancer, and the like, and its expression level is significantly elevated in metastatic tumors, and is closely related to poor prognosis of cancer patients. Preclinical models of the drug targeting EZH2 show that it is able to inhibit the progression of brain and prostate cancer. Therefore, the EZH2 can be used as a potential drug target for treating cancer metastasis, and tumors can be treated by reducing the expression and activity of EZH2, thereby reducing the methylation of histone and enhancing the expression of cancer suppressor genes.

Disclosure of Invention

The applicant constructed a viral vector that inserts a foreign megal gene to express methioninase, which inhibits the growth and metastasis of malignant tumors by inhibiting the expression and activity of methyltransferase EZH 2.

In one aspect, the present application provides a viral vector, wherein a foreign MEGL gene is inserted.

Further, the exogenous MEGL gene is methionine gamma-lyase gene (Genbank access No. L43133.1).

Further, the vector uses EF1A as a promoter.

Further, the vector carries a mcherry fluorescent protein.

Further, the sequence of the exogenous MEGL gene is SEQ ID NO. 1.

The construction method of the virus vector comprises the following steps: subcloning MEGL gene into plasmid to obtain MEGL expression plasmid; transfecting 293T cells with MEGL expression plasmids and helper plasmids; collecting supernatant, concentrating and purifying to obtain the virus vector.

Further, the MEGL expression plasmid is a MEGL expression plasmid co-transfected 293T cells, and the helper plasmid is a virus-packaged helper plasmid.

Further, wherein the MEGL expression plasmid carries mCherry red fluorescent protein.

The construction method specifically comprises the following steps:

(a) constructing an entry vector by BP reaction: mixing a Gateway expression vector containing a target gene attB 1-MEGL-attB 2 sequence with a donor vector with an attP1-ccdB-attP2 sequence; adding BP close enzyme mixture containing Int and IHF, keeping the temperature at 25 deg.C for 1h, and treating with proteinase K at 37 deg.C for 10min to generate entry vector with target gene MEGL and expression vector with suicide gene; transforming the entry vector to escherichia coli Stbl3, and screening positive clones for sequencing verification;

(b) constructing a target vector, wherein two recombination sites attR1 and attR2 are arranged at the downstream of an expression control element, the sizes of the recombination sites attR1 and attR2 are both 125bp, and ccdB suicide genes are arranged between attR1 and attR 2;

(c) LR reaction construction of final expression vector: mixing two plasmids of the entry vector and the target vector, adding LR clone enzyme mixture containing recombination factors such as Int, IHF, Xis, etc., preserving heat at 25 ℃ overnight for storage, treating with protease K at 37 ℃ for 10min, and converting; generating a fusion plasmid, recombining an attL1 sequence and an attR1 sequence, and decomposing the fusion plasmid into two new plasmids to obtain a final expression vector of a target vector with a target gene; the target product is transformed into Escherichia coli Stbl3, and positive clone plasmids are screened for sequencing verification.

Further, the viral vector is a lentiviral vector.

In another aspect, the present application provides the use of the above viral vector in the preparation of a medicament for the treatment of a malignant tumor.

Further, the medicine is a medicine for directly killing tumor cells.

Further, the malignant tumor is glioma.

In another aspect, the present application provides the use of the above viral vector for the preparation of an inhibitor of histone methyltransferase EZH 2.

The viral vector may be a lentiviral vector, a retroviral vector, an adenoviral vector, or the like known in the art or under development, preferably a lentiviral vector.

The malignant tumor includes, but is not limited to, glioma, breast cancer, prostate cancer, pancreatic cancer, liver cancer, colon cancer, rectal cancer, esophageal cancer, laryngeal cancer, leukemia, lymphoma, melanoma, uterine cancer, ovarian cancer, skin cancer, bronchial cancer, bronchiolar cancer, urethral cancer, kidney cancer, oral cancer, vaginal cancer, bile duct cancer, bladder cancer, or nasopharyngeal cancer. The above-described modes of administration of the drug or inhibitor may be by a variety of routes including, but not limited to: oral administration, topical administration, injection (including but not limited to intravenous, intraperitoneal, subcutaneous, intramuscular, intratumoral, spinal administration), and the like.

Compared with the prior art, the invention has the advantages that:

the invention provides a virus system for expressing methioninase, which inhibits the growth and metastasis of malignant tumors by inhibiting the expression and activity of methyltransferase EZH 2.

Compared with retrovirus and recombinant adenovirus, the virus expression system has the advantages of large capacity of accommodating exogenous gene fragments, stable and long-term gene expression, high transfection efficiency, no generation of any cellular immune response and the like. Meanwhile, the mCherry fluorescent protein has less cytotoxicity, and is favorable for observing the cell infection condition.

Brief Description of Drawings

FIG. 1 is a diagram of construction of a viral vector overexpressing MEGL.

FIG. 2 is a photograph of glioma cells infected by over-expressed MEGL virus under fluorescent microscope.

FIG. 3 is a graph showing the results of PCR and Western Blot to identify tumor cells infected with MEGL-overexpressing virus. The upper is the al time PCR result and the lower is the sternBlot result. Wherein, group V: no-load control virus group; and M groups: a group of viruses overexpressing MEGL.

FIG. 4 is a graph showing LC-MS identification of a decrease in intracellular methionine levels following infection with an overexpressed MEGL virus. Wherein, group V: no-load control virus group; and M groups: a group of viruses overexpressing MEGL.

FIG. 5 shows that over-expression of MEGL virus inhibits glioma cell proliferation. Wherein, group V: no-load control virus group; and M groups: a group of viruses overexpressing MEGL. All data are expressed as mean ± standard deviation. (n-3), P <0.05, P <0.01, P <0.001 all compared to group V.

FIG. 6 shows that the over-expressing MEGL virus inhibits the expression of EZH2 in tumor cells. The above is l timePCR detection EZH2 gene expression down-regulation; the expression of EZH2 protein was down-regulated for the test of sternBlot. Group V: no-load control virus group; and M groups: a group of viruses overexpressing MEGL. All data are expressed as mean ± standard deviation. (n-3), P <0.05, P <0.01, P <0.001 all compared to group V.

Detailed Description

The invention will be better understood from the following examples. However, those skilled in the art will readily appreciate that the description of the embodiments is only for illustrating the present invention and should not be taken as limiting the invention as detailed in the claims.

Example 1: construction of expression vector containing MEGL

The MEGL/3xFLAG sequence used was as follows (SEQ ID NO. 1):

viral vectors are from the genus of Setarian organisms and are constructed primarily by Gateway cloning techniques. The Gateway technique involves both BP and LR reactions, the BP reaction being the creation of an entry clone using a recombination reaction between an attB DNA fragment or expression clone and an attP donor vector. The LR reaction is a recombination reaction between one attL entry clone and one attR destination vector. The method comprises the following specific steps:

1) BP reaction construction Entry Vector (Entry Vector): the Gateway expression Vector (attB 1-MEGL-attB 2 sequence) containing the target gene was mixed with the donor Vector (pDONR) having attP1-ccdB (suicide gene) -attP2 sequence, a BP clone enzyme mixture containing Int, IHF was added, and the mixture was incubated at 25 ℃ for 1h, treated with proteinase K at 37 ℃ for 10min, at which time the attP and attB sequences recombined to produce an Entry Vector (Entry Vector) having the target gene (MEGL) and an expression Vector having the suicide gene. The entry vector was transformed into E.coli Stbl3 and positive clones were screened for sequencing validation.

2) The target Vector (Destination Vector) is also matched with a Gateway system, namely two recombination sites attR1 and attR2 are arranged at the downstream of an expression control element of the target Vector, the sizes of the recombination sites attR1 and attR2 are both 125bp, and a ccdB suicide gene is also clamped.

3) LR reaction construction of final expression vector: the Entry Vector (Entry Vector) and the objective Vector (Destination Vector) were mixed, and the LR clone enzyme mixture containing recombination factors such as Int, IHF, Xis, etc. was added thereto, and the mixture was stored overnight at 25 ℃ and treated with proteinase K at 37 ℃ for 10min, followed by transformation. At this point, the attR2 sequence and attL2 sequence recombined to produce a fusion plasmid. The attL1 sequence is recombined with the attR1 sequence, and the fusion plasmid is decomposed into two new plasmids, thus obtaining the final expression vector of the target vector with the target gene. The target product is transformed into Escherichia coli Stbl3, and positive clone plasmids are screened for sequencing verification.

Example 2: preparation of over-expressed MEGL virus (Lentiviral example)

1) And (3) packaging the virus: the day before transfection, 293T cells are inoculated into a culture dish, and the number of the inoculated cells is preferably that the cells on the day of transfection grow to be fused by 90-95%; on the day of transfection, the culture medium was removed from 293T cells, and 10mL (10cm dish) of virus packaging medium was added. Calcium phosphate-DNA precipitate was prepared as follows: A. calcium-DNA mixture: CaCl was added first to a 5mL sterile EP tube₂Then adding the auxiliary plasmid and the target gene plasmid respectively and mixing uniformly. B. The tube containing the calcium-DNA mixture was vortexed on a vortexer, then 2 × HBS was added dropwise, followed by vortexing for a few seconds and standing for 5 minutes after dropping. Pouring the calcium phosphate-DNA suspension into the cell culture medium of the cells, gently mixing the culture medium uniformly, and placing the mixture in a 37-pour and 5% CO2 saturated humidity incubator for culture; after 4-6h of transfection, the original culture solution was aspirated, 10mL of culture solution for virus packaging was added, and the mixture was placed in an incubator with 37 bags and 5% CO2 saturated humidity for further culture.

2) Collecting and concentrating the virus: collecting culture solution containing virus to a 50mL centrifuge tube 48h after transfection; centrifuging the virus supernatant at a low speed, removing cell debris, and recovering the supernatant; filtering with 0.45 μm small filter, and collecting filtrate; according to the volume of the filtrate, the corresponding amount of PEG6000 and NaCl solution is added. Mixing thoroughly, standing, and standing at 4 deg.C for overnight precipitation; centrifuging at 1500 Xg for 30 min at 4 deg.C the next day, and removing supernatant; dissolving the virus precipitate by HBSS, fully blowing the precipitate to a single virus suspension, and then subpackaging the virus into a freezing storage tube.

3) Real time PCR to identify viral titers: 1 day before viral infection, 293T was plated in 6-well plates, 5 plates per well, 5X 10 plates per well⁵Per well; after 24h of cell inoculation, two wells were takenThe cells were counted on a haemocytometer and the actual number of cells at infection was determined and recorded as N. The medium in the other plates was discarded and replaced with fresh medium containing 5. mu.g/ml polybrene at the final concentration. The concentrated virus was diluted 200-fold with medium, i.e., 1. mu.L, and the virus was also added to 199. mu.L of medium. Adding 0.5. mu.L, 5. mu.L and 5. mu.L of diluted virus into 3 culture wells, respectively; 20h after the start of infection, the culture supernatant was removed and replaced with 500. mu.L of fresh DNaseI-containing medium. Digestion was carried out at 37 ℃ for 15 minutes, this step being to remove residual plasmid DNA. Then changing to 2mL of normal culture medium, and continuing culturing for 48 h; the cells were digested with 0.5mL of 0.25% pancreatin-EDTA solution and collected by centrifugation. Genomic DNA was extracted and real-time fluorescent PCR amplified as described in DNeasy kit. The titer (integration units per mL, IU/mL) was calculated as follows:

IU/mL＝(C×N×D×1000)/V

wherein: c-the average number of integrated viral copies per genome; n-the number of cells at the time of infection (approximately 1 × 10)⁶) D ═ dilution factor of viral vector; v ═ the number of volumes of added diluted virus.

Example 3: anti-tumor effect of over-expressed MEGL virus.

1. Taking glioma cells U87 and snb19 in a logarithmic growth phase, inoculating the glioma cells U87 and snb19 in a 6-well plate, adding a control unloaded virus vector (hereinafter, both defined as a group V) and an overexpressed MEGL lentivirus (hereinafter, both defined as a group M) according to the MOI of 10 when the cell density is about 30-50%, adding a Polybrene reagent with the final concentration of 5 mu g/mL for dyeing assistance, culturing for 24 hours, replacing the Polybrene reagent with a normal culture medium, continuously culturing for 48 hours, screening by using Puromycin with the final concentration of 2 mu g/mL, observing the fluorescence intensity and proportion of the cells by a fluorescence microscope every 24 hours, and judging that the screening is successful when the cell amount of red fluorescence exceeds 95%. The results of the cell screening are shown in FIG. 2.

2. Real time PCR and Western Blot were used to identify the expression of methioninase in cells infected with the over-expressed MEGL virus.

Taking cells with good growth after virus infection, extracting total RNA of the cells according to a Trizol method, and taking 1 mu g of total RNA template to carry out reverse transcription in vitro to obtain cDNA. Using cDNA as template, and performing cycle of pre-denaturation (94 change, 2min), denaturation (94 change, 30s), annealing (55 retreat, 30s) and extension (72 extension, 1min) for 30 times, and final extension (72 extension, 10min) to complete amplification. And (5) running the amplification product through agarose gel electrophoresis, and taking pictures under a gel imaging system by exposure.

Wherein, the MEGL primer sequence is as follows:

MEGL-F：CACTTCTACAGCCGCATCTCCAAC

MEGL-R：GACCACCACAAGCACATCACTCC

the results are shown in FIG. 3, and the PCR results show that the M group detects specific MEGL target gene segment (387bp) at 300-400bp, which shows that the glioma infection by the over-expressed MEGL virus is successful. Well-growing cells after viral infection were taken, 200. mu.l RIPA lysate and 2. mu.l PMSF were added, the cells were scraped off with a clean cell scraper and transferred to a new 1.5ml EP tube. Cracking on ice for 10min, carrying out ultrasonic disruption, and carrying out ultrasonic treatment for 3s and 3s at intervals for 30 s. Centrifuge at 12000rpm for 15min at 4 ℃ and take the supernatant to another clean EP tube, and store-20. The BCA method measures total protein concentration. And detecting MEGL by Western Blot, and selecting Tubulin as an internal reference. The results are shown in fig. 3, and specific bands (indicating methioninase protein bands) were detected around 43KD in group M, further indicating the success of infection with the over-expressed megal virus.

3. Identifying the methioninase activity of the cells after infection with the overexpressed MEGL virus. Intracellular methionine levels were identified following infection of malignant cells with over-expressed MEGL virus using liquid chromatography-mass spectrometry (LC-MS).

Taking glioma cells U87-V, U87-M, snb19-V, snb19-M in logarithmic growth phase after virus infection, and respectively preparing 1.5 × 10⁶Taking 1ml of single cell suspension, putting the single cell suspension in a 150mm culture dish, culturing for 3d, carrying out trypsinization to collect cells, and washing twice with precooled PBS. 2mL of pre-cooled 60% methanol water was added for extraction, and the cells were disrupted by sonication for 3s with 3s pauses for 5 times, taking care of the ice bath. The supernatant was centrifuged and taken out from the sample bottle, and 1mL of 60% methanol was added to the precipitate, and the extraction was repeated. The supernatants were combined, freeze-dried, overnight. Adding 300ul of precooled 60% methanol water for redissolving, ultrasonically whirling, filtering by a 0.22 mu m membrane, and detecting on a machine. The results are shown in FIG. 4:intracellular methionine levels were 19.9-fold reduced in the M group compared to the V group in snb19 cells; in U87 cells, the M group was reduced 3.15-fold compared to the V group. This result indicates that the over-expressed MEGL virus successfully infected cells and exerted the effect of reducing intracellular methionine content.

4. The CCK8 method measures the effect of over-expressing MEGL virus on inhibition of glioma cell proliferation.

Taking glioma cells U87-V, U87-M, snb19-V, snb19-M in the logarithmic growth phase infected by the virus to prepare single cell suspension. 100. mu.L of cell suspension (containing 1.5X 10 cells) per well³Individual cells) were seeded in 96-well plates with 5 secondary wells per group; detecting the proliferation status of cells at 1 st, 3 rd, 4 th, 5 th and 7 th days respectively, namely adding 10ul of CCK-8 solution into each empty space to avoid generating bubbles; cells were incubated at 37 ℃ in an incubator with 5% CO₂And (4) continuing incubation for 1h, taking out the culture plate, and measuring the absorbance of the cells at 450nm by using a microplate reader. The results are shown in fig. 5, where the over-expression of the megal virus significantly inhibited the proliferation of glioma cells.

5. Real time PCR detection of over-expressed MEGL virus reduced the expression of EZH2 gene in tumor cells.

Taking cells with good growth after virus infection, extracting total RNA of the cells according to a Trizol method, and taking 1 mu g of RNA template to carry out reverse transcription in vitro to obtain cDNA. Using cDNA as a template, and Real time PCR reaction conditions are as follows: 2min at 50 ℃; 10min at 95 ℃; 95 ℃ for 15sec, 60 ℃ for 1 min; 72 ℃ for 1min (total 40 cycles), and finally the product dissolution profile was checked, using 2^-△△CtAnd (4) calculating by using the method. As a result, as shown in FIG. 6, the overexpression of MEGL virus reduced the expression of EZH2 gene in cells. As shown in fig. 6, Western Blot results further confirmed that overexpression of the MEGL virus reduced the expression of EZH2 protein in cells.

The in vitro experiments further show that the virus-mediated methioninase system adopted by the invention inhibits the proliferation of tumors by inhibiting EZH2, and has good anti-tumor effect.

SEQUENCE LISTING

<110> Guangzhou Huajin medicine science and technology Co., Ltd

<120> application of methioninase gene therapy in treating malignant tumor

<160> 1

<170> PatentIn version 3.5

<210> 1

<211> 1263

<212> DNA

<213> Artificial sequence

<400> 1

atgcgcgact cccataacaa caccggtttt tccacacggg ccattcacca cggctacgac 60

ccgctttccc acggtggtgc cttggtgcca ccggtgtacc agaccgcgac ctatgccttc 120

ccgactgtcg aatacggcgc tgcgtgcttc gccggggagg aggcggggca cttctacagc 180

cgcatctcca accccaccct ggccttgctc gagcaacgca tggcctcgtt ggagggtggt 240

gaggcgggat tggcgctggc gtcggggatg ggagccatta cttcgaccct ctggaccctg 300

ctgcggcctg gtgatgagct gatcgtgggg cgcaccttgt atggctgcac ctttgcgttc 360

ctgcaccatg gcattggcga gttcggggtc aagatccacc atgtcgacct taacgatgcc 420

aaggccctga aagcggcgat caacagcaaa acgcggatga tctacttcga aacaccggcc 480

aaccccaaca tgcaactggt ggatatagcg gcggtcgtcg aggcagtgcg ggggagtgat 540

gtgcttgtgg tggtcgacaa cacctactgc acgccctacc tgcagcggcc actggaactg 600

ggggcagacc tggtggtgca ttcggcaacc aagtacctca gtggccatgg cgacatcact 660

gcgggcctgg tggtggggcg caaggctttg gtcgaccgca ttcggctgga agggctgaaa 720

gacatgaccg gggcagcctt gtcaccgcat gacgctgcgt tgttgatgcg cggcatcaag 780

accctggcgc tgcgcatgga ccggcattgc gccaacgccc tggaggtcgc gcagttcctg 840

gccgggcagc cccaggtgga gctgatccac tacccgggct tgccgtcgtt tgcccagtac 900

gaactggcac agcggcagat gcgtttgccg ggcgggatga ttgcctttga gctcaagggc 960

ggtatcgagg ccgggcgcgg cttcatgaat gccctgcagc tttttgcccg tgcggtgagc 1020

ctgggggatg ccgagtcgct ggcacagcac ccggcgagca tgacgcactc cagttacacg 1080

ccacaagagc gggcgcatca cgggatatca gaggggctgg tgaggttgtc agtggggctg 1140

gaggatgtgg aggacctgct ggcagatatc gagttggcgt tggaggcgtg tgcagactac 1200

aaagaccatg acggtgatta taaagatcat gatatcgatt acaaggatga cgatgacaag 1260

tga 1263

Claims

1. A viral vector having an exogenous MEGL gene inserted therein.

2. The viral vector according to claim 1, wherein the exogenous MEGL gene is a methionine γ -lyase gene.

3. The viral vector according to claim 1 or 2, said vector having EF1A as promoter.

4. A viral vector according to any one of claims 1 to 3, said vector carrying a mcherry fluorescent protein.

5. The viral vector according to any one of claims 1 to 4, wherein the foreign MEGL gene sequence is SEQ ID No. 1.

6. A viral vector according to any one of claims 1 to 5, which is constructed according to the following method: subcloning MEGL gene into plasmid to obtain MEGL expression plasmid; transfecting 293T cells with MEGL expression plasmids and helper plasmids; collecting supernatant, concentrating and purifying to obtain the virus vector.

7. A viral vector according to claim 6, wherein the MEGL expression plasmid is a MEGL expression plasmid co-transfected into 293T cells and the helper plasmid is a virally packaged helper plasmid.

8. A viral vector according to claim 6 or 7, wherein the MEGL expression plasmid carries the mCherry red fluorescent protein.

9. A viral vector according to any one of claims 6 to 8, which is constructed according to the following method:

10. A viral vector according to any one of claims 1 to 9 which is a lentiviral vector.

11. A method of constructing a viral vector according to any one of claims 1 to 10, comprising: subcloning MEGL gene into plasmid to obtain MEGL expression plasmid, transfecting 293T cell with MEGL expression plasmid and auxiliary plasmid, collecting supernatant, concentrating and purifying to obtain target virus.

12. The method of claim 11, wherein the MEGL expression plasmid is a MEGL expression plasmid co-transfected into 293T cells and the helper plasmid is a viral-packaged helper plasmid.

13. Construction process according to claim 11 or 12, wherein the MEGL expression plasmid carries the mCherry red fluorescent protein.

14. A construction method according to any one of claims 11-13, comprising:

15. Use of a viral vector according to any one of claims 1 to 10, or a viral vector constructed according to the construction method of any one of claims 11 to 14, for the manufacture of a medicament for the treatment of a malignant tumor.

16. Use according to claim 15, wherein the medicament is a medicament for direct killing of tumor cells.

17. Use according to claim 15 or 16, wherein the malignant tumour is a glioma.

18. Use of a viral vector according to any one of claims 1 to 10, or a viral vector constructed according to the method of construction of any one of claims 11 to 14, in the preparation of an inhibitor of histone methyltransferase EZH 2.