CN113832154A - Method for detecting sweet potato fading spot virus based on CRISPR technology - Google Patents

Abstract

The invention provides a method for detecting sweet potato fading spot virus based on CRISPR technology, in particular to a method for detecting sweet potato fading spot virus or sweet potato disease based on CRISPR technology, which comprises the steps of detecting by utilizing gRNA, Cas protein and a single-chain nucleic acid detector; by screening and optimizing the gRNA, the detection efficiency is improved, and the method has a wide application prospect.

Description

Method for detecting sweet potato fading spot virus based on CRISPR technology

Technical Field

The invention relates to the field of nucleic acid detection, relates to a method for detecting sweet potato fading spot virus based on a CRISPR (clustered regularly interspaced short palindromic repeats) technology, and particularly relates to a method, a system and a kit for detecting sweet potato fading spot virus based on the CRISPR technology.

Background

Sweet potato fading spot virus (SPCFV), which belongs to the genus Carlavus of the family of Linear viruses (Flexiviridae) carnation latent virus (Carlavus), is one of the major diseases infecting Sweet potatoes, although the symptoms of Sweet potato fading spot virus alone infecting Sweet potatoes are slight, the virus and Sweet potato fading dwarf virus can form synergistic diseases when infecting Sweet potatoes together, resulting in serious symptoms of Sweet potatoes.

The detection method of the sweet potato fading spot virus mainly comprises the following steps: enzyme linked immunosorbent assay and RT-PCR method.

The invention provides a novel method for detecting sweet potato fading-green spot virus, which is a rapid detection method with high specificity and high detection sensitivity based on CRISPR technology, in particular based on trans activity of V-type Cas enzyme.

Disclosure of Invention

The invention provides a method, a system and a kit for detecting sweet potato fading spot virus based on a CRISPR technology.

In one aspect, the present invention provides a gRNA for detecting sweet potato melatonin spot virus, the gRNA including a region binding to a Cas protein and a guide sequence hybridizing to a target nucleic acid, which is a nucleic acid derived from sweet potato melatonin spot virus.

In the present invention, the region that binds to the CRISPR/CAS effector protein, also known as the direct repeat, backbone region or spacer sequence, interacts with the CAS protein, thereby binding to the CAS protein.

In one embodiment, the gRNA comprises, in order from 5 'to 3', a region that binds to a Cas protein and a guide sequence that hybridizes to a target nucleic acid.

In one embodiment, the guide sequence which hybridizes to the target nucleic acid comprises 17 to 30 bases and hybridizes to the sequence shown in SEQ ID No.1 or the reverse complement thereof and comprises the sequence shown in any one of SEQ ID nos. 3 to 5; preferably, the targeting sequence comprises a sequence as shown in any one of SEQ ID Nos. 3, 4 and 5.

In preferred embodiments, the targeting sequence that hybridizes to the target nucleic acid contains 17-30 bases, e.g., 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 bases.

In one embodiment, the targeting sequence that hybridizes to the target nucleic acid comprises the sequence set forth in any one of SEQ ID nos. 3 to 5 and further comprises 1 to 13 bases (preferably, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 bases) at the 3' end of the sequence set forth in any one of SEQ ID nos. 3 to 5, and the targeting sequence that hybridizes to the target nucleic acid hybridizes to the sequence set forth in SEQ ID No.1 or the reverse complement thereof; preferably, the targeting sequence comprises a sequence as shown in any one of SEQ ID Nos. 3, 4 and 5.

In one embodiment, the targeting sequence that hybridizes to the target nucleic acid lacks 1-5 bases (e.g., 1, 2, 3, 4, 5 bases) consecutively at the 3' end of the sequence shown in any of SEQ ID Nos. 3-5 as compared to the sequence shown in any of SEQ ID Nos. 3-5.

The hybridization with the sequence shown in SEQ ID No.1 or the reverse complementary sequence thereof means that the guide sequence and a continuous section of the reverse complementary sequence of SEQ ID No.1 or SEQ ID No.1 can be continuously complementarily paired. For example, if the targeting sequence that hybridizes to the target nucleic acid contains 30 bases, then 30 bases of the targeting sequence need to be complementarily paired with the consecutive 30 bases of SEQ ID No.1 or the complement of SEQ ID No. 1.

In a more preferred embodiment, the targeting sequence for hybridization to the target nucleic acid is as set forth in any one of SEQ ID Nos. 3-5.

In one embodiment, the Cas protein is selected from a V-type Cas protein, e.g., Cas12, a Cas14 family protein, or a mutant thereof.

In one embodiment, the Cas protein is preferably a Cas12 family, including but not limited to one or any several of Cas12a, Cas12b, Cas12d, Cas12e, Cas12f, Cas12g, Cas12h, Cas12i, Cas12 j.

Preferably, the sequence of the region binding to the Cas protein is shown as SEQ ID No. 6.

On the other hand, the invention provides a method for detecting/diagnosing sweet potato fading spot virus or sweet potato diseases, which comprises the steps of contacting nucleic acid to be detected with a V-shaped Cas protein, the gRNA and a single-chain nucleic acid detector; and detecting a detectable signal generated by the Cas protein cutting single-stranded nucleic acid detector, thereby detecting/diagnosing the sweet potato fading spot virus or the sweet potato disease.

Further, the method further comprises the step of obtaining a test nucleic acid from a test sample; preferably, the nucleic acid to be detected is obtained from a sample to be detected by amplification.

Further, the method also comprises a step of obtaining the nucleic acid to be detected by adopting the primer pair for amplification.

The upstream primer of the primer pair is shown as SEQ ID NO: 7-10, wherein the downstream primer of the primer pair is shown as SEQ ID NO: 11-14.

In one embodiment, the primer pair is selected from any one or a combination of the following groups:

i. the upstream primer of the primer pair is shown as SEQ ID No.7, and the downstream primer of the primer pair is shown as SEQ ID No. 11;

ii. The upstream primer of the primer pair is shown as SEQ ID No.8, and the downstream primer of the primer pair is shown as SEQ ID No. 12;

iii, the upstream primer of the primer pair is shown as SEQ ID No.8, and the downstream primer of the primer pair is shown as SEQ ID No. 13;

iv, an upstream primer of the primer pair is shown as SEQ ID No.9, and a downstream primer of the primer pair is shown as SEQ ID No. 13;

v, the upstream primer of the primer pair is shown as SEQ ID No.9, and the downstream primer of the primer pair is shown as SEQ ID No. 14;

vi, an upstream primer of the primer pair is shown as SEQ ID No.10, and a downstream primer of the primer pair is shown as SEQ ID No. 13;

vii, the upstream primer of the primer pair is shown as SEQ ID No.10, and the downstream primer of the primer pair is shown as SEQ ID No. 14;

preferably, the upstream primer of the primer pair is shown as SEQ ID NO: 10, and the downstream primer of the primer pair is shown as SEQ ID NO: shown at 13.

In the present invention, the nucleic acid to be detected may be a double-stranded nucleic acid or a single-stranded nucleic acid.

The amplification of the invention is selected from one or more of PCR, Nucleic Acid Sequencing Based Amplification (NASBA), Recombinase Polymerase Amplification (RPA), loop-mediated isothermal amplification (LAMP), Strand Displacement Amplification (SDA), Helicase Dependent Amplification (HDA), or Nicking Enzyme Amplification Reaction (NEAR), Multiple Displacement Amplification (MDA), Rolling Circle Amplification (RCA), Ligase Chain Reaction (LCR), or derivative amplification method (RAM).

In the present invention, the sample may be a sample from a plant, for example, sweet potato, brazil morning glory, japanese morning glory, common morning glory; in other embodiments, the sample may also be from other plants, for example, tobacco, amaranth, beet, canola, quinoa, cucumber, bottle gourd, stramonium, globe amaranth, tomato, petunia, kidney bean, radish, cowpea.

In one embodiment, the sample may be a virus-transmitting medium of a plant, for example, a potato seedling, a potato block, bemisia tabaci, aphis gossypii, aphis lentinus, aphis brassicae, aphis persicae, mechanical inoculants, grafts, seeds, pollen sample.

In other embodiments, the sample may also be derived from an environmental sample, e.g., air, water, soil, etc.

In another aspect, the invention provides a composition for detecting/diagnosing sweet potato melatonin spot virus, which comprises the gRNA, a Cas protein and a single-stranded nucleic acid detector; preferably, the primer set is further included.

On the other hand, the invention also provides a system, a composition or a kit for detecting or diagnosing whether a plant to be detected is infected with the sweet potato disease, wherein the system, the composition or the kit comprises the V-type Cas protein, the gRNA and the single-stranded nucleic acid detector. Further, the system, composition or kit further comprises an amplification primer; preferably, the amplification primers comprise the primer pairs described above.

On the other hand, the invention also provides the application of the composition for detecting or diagnosing whether the plant to be detected is infected with the sweet potato disease in diagnosing or detecting the sweet potato disease, or the application in preparing a reagent or a kit for diagnosing or detecting the sweet potato disease.

In another aspect, the present invention also provides a system, composition or kit for detecting/diagnosing sweet potato melatonin spot virus, which includes a V-type Cas protein, the above gRNA (guide RNA), and a single-stranded nucleic acid detector; preferably, the primer set is further included.

On the other hand, the invention also provides application of the system, the composition or the kit in detecting/diagnosing the sweet potato fading spot virus.

On the other hand, the invention also provides application of the composition in preparing a reagent or a kit for detecting/diagnosing sweet potato melatonin spot virus.

Further, the V-type Cas protein is selected from Cas12, a Cas14 family protein, or a mutant thereof.

In one embodiment, the Cas protein is preferably a Cas12 family, including but not limited to one or any several of Cas12a, Cas12b, Cas12d, Cas12e, Cas12f, Cas12g, Cas12h, Cas12i, Cas12 j.

In one embodiment, the Cas12a is selected from one or any of FnCas12a, assas 12a, LbCas12a, Lb5Cas12a, HkCas12a, OsCas12a, TsCas12a, BbCas12a, BoCas12a or Lb4Cas12 a.

In preferred embodiments, the amino acid sequence of the Cas12i protein is selected from the group consisting of:

(1) SEQ ID NO: 2;

(2) converting SEQ ID NO: 2 or an active fragment thereof by substitution, deletion or addition of one or more (such as 2, 3, 4, 5, 6, 7, 8, 9 or 10) amino acid residues, and has basically the same function;

(3) and SEQ ID NO: 2, and having trans activity, has at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% sequence identity.

In one embodiment, the Cas protein mutant comprises amino acid substitutions, deletions or substitutions, and the mutant retains at least its trans cleavage activity. Preferably, the mutant has Cis and trans cleavage activity.

In the present invention, the single-stranded nucleic acid detector includes a single-stranded DNA, a single-stranded RNA, or a single-stranded DNA-RNA hybrid. In other embodiments, the single-stranded nucleic acid detector comprises a mixture of any two or three of single-stranded DNA, single-stranded RNA, or single-stranded DNA-RNA hybrids, e.g., a combination of single-stranded DNA and single-stranded RNA, a combination of single-stranded DNA and single-stranded DNA-RNA hybrids, and a combination of single-stranded RNA and single-stranded DNA-RNA. In other embodiments, the single stranded nucleic acid detector further comprises modifications to the bases.

In a preferred embodiment, the single stranded nucleic acid detector is a single stranded oligonucleotide detector.

The single-stranded nucleic acid detector does not hybridize to the gRNA.

In the present invention, the detectable signal is realized by: vision-based detection, sensor-based detection, color detection, gold nanoparticle-based detection, fluorescence polarization, fluorescence signal, colloidal phase transition/dispersion, electrochemical detection, and semiconductor-based detection.

In some embodiments, the methods of the invention further comprise the step of measuring a detectable signal produced by the CRISPR/CAS effector protein (CAS protein). The Cas protein, upon recognition or hybridization to the target nucleic acid, can stimulate the cleavage activity of any single-stranded nucleic acid, thereby cleaving the single-stranded nucleic acid detector and thereby generating a detectable signal.

In the present invention, the detectable signal may be any signal generated when the single-stranded nucleic acid detector is cleaved. For example, detection based on gold nanoparticles, fluorescence polarization, fluorescence signal, colloidal phase transition/dispersion, electrochemical detection, semiconductor-based sensing. The detectable signal may be read by any suitable means, including but not limited to: measurement of a detectable fluorescent signal, gel electrophoresis detection (by detecting a change in a band on the gel), detection of the presence or absence of a color based on vision or a sensor, or a difference in the presence of a color (e.g., based on gold nanoparticles) and a difference in an electrical signal.

In a preferred embodiment, the detectable signal is achieved by: the 5 'end and the 3' end of the single-stranded nucleic acid detector are respectively provided with different reporter groups, and when the single-stranded nucleic acid detector is cut, a detectable reporter signal can be shown; for example, a single-stranded nucleic acid detector having a fluorophore and a quencher disposed at opposite ends thereof, when cleaved, can exhibit a detectable fluorescent signal.

In one embodiment, the fluorescent group is selected from one or any of FAM, FITC, VIC, JOE, TET, CY3, CY5, ROX, Texas Red or LC Red 460; the quenching group is selected from one or more of BHQ1, BHQ2, BHQ3, Dabcy1 or Tamra.

In other embodiments, the detectable signal may also be achieved by: the 5 'end and the 3' end of the single-stranded nucleic acid detector are respectively provided with different marker molecules, and a reaction signal is detected in a colloidal gold detection mode.

In some embodiments, the measurement of the detectable signal may be quantitative, and in other embodiments, the measurement of the detectable signal may be qualitative.

Preferably, the single stranded nucleic acid detector produces a first detectable signal prior to cleavage by the Cas protein and produces a second detectable signal different from the first detectable signal after cleavage.

In other embodiments, the single-stranded nucleic acid detector comprises one or more modifications, such as base modifications, backbone modifications, sugar modifications, and the like, to provide new or enhanced features (e.g., improved stability) to the nucleic acid. Examples of suitable modifications include modified nucleic acid backbones and non-natural internucleoside linkages, and nucleic acids having modified backbones include those that retain a phosphorus atom in the backbone and those that do not have a phosphorus atom in the backbone. Suitable modified oligonucleotide backbones containing phosphorus atoms therein include phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkyl phosphotriesters, methyl and other alkyl phosphonates. In some embodiments, the single stranded nucleic acid detector comprises one or more phosphorothioate and/or heteroatomic nucleotide linkages. In other embodiments, the single stranded nucleic acid detector can be a nucleic acid mimetic; in certain embodiments, the nucleic acid mimetics are Peptide Nucleic Acids (PNAs), another class of nucleic acid mimetics is based on linked morpholino units having a heterocyclic base attached to a morpholino ring (morpholino nucleic acids), and other nucleic acid mimetics further include cyclohexenyl nucleic acids (CENAs), further including ribose or deoxyribose chains.

In one embodiment, the Cas protein and gRNA are used in a molar ratio of (0.8-1.2): 1.

in one embodiment, the Cas protein is used in a final concentration of 20-200nM, preferably, 30-100nM, more preferably, 40-80nM, more preferably, 50 nM.

In one embodiment, the gRNA is used in a final concentration of 20-200nM, preferably, 30-100nM, more preferably, 40-80nM, and more preferably, 50 nM.

In one embodiment, the test nucleic acid is used in a final concentration of 5-100nM, preferably 10-50 nM.

In one embodiment, the single stranded nucleic acid detector is used at a final concentration of 100-.

In one embodiment, the single stranded nucleic acid detector has 2 to 300 nucleotides, preferably, 3 to 200 nucleotides, preferably, 3 to 100 nucleotides, preferably, 3 to 30 nucleotides, preferably, 4 to 20 nucleotides, more preferably, 5 to 15 nucleotides.

The terms "hybridize" or "complementary" or "substantially complementary" refer to a nucleic acid (e.g., RNA, DNA) that comprises a nucleotide sequence that enables it to bind non-covalently, i.e., to form base pairs and/or G/U base pairs with another nucleic acid in a sequence-specific, antiparallel manner (i.e., the nucleic acid binds specifically to the complementary nucleic acid), "anneal" or "hybridize". Hybridization requires that the two nucleic acids contain complementary sequences, although mismatches between bases are possible. Suitable conditions for hybridization between two nucleic acids depend on the length and degree of complementarity of the nucleic acids, variables well known in the art. Typically, the length of the hybridizable nucleic acid is 8 nucleotides or more (e.g., 10 nucleotides or more, 12 nucleotides or more, 15 nucleotides or more, 20 nucleotides or more, 22 nucleotides or more, 25 nucleotides or more, or 30 nucleotides or more).

It is understood that the sequence of a polynucleotide need not be 100% complementary to the sequence of its target nucleic acid to specifically hybridize. A polynucleotide may comprise 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 98% or more, 99% or more, 99.5% or more, or a target region that hybridizes thereto has 100% sequence complementarity of the target region.

General definition:

unless defined otherwise, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art.

The term "amino acid" refers to a carboxylic acid containing an amino group. Each protein in an organism is composed of 20 basic amino acids.

The terms "polynucleotide", "nucleotide sequence", "nucleic acid molecule" and "nucleic acid" are used interchangeably and include DNA, RNA or hybrids thereof, whether double-stranded or single-stranded.

The term "oligonucleotide" refers to a sequence of 3 to 100 nucleotides, preferably 3 to 30 nucleotides, preferably 4 to 20 nucleotides, more preferably 5 to 15 nucleotides.

The term "homology" or "identity" is used to refer to the match of sequences between two polypeptides or between two nucleic acids. When a position in both of the sequences being compared is occupied by the same base or amino acid monomer subunit (e.g., a position in each of two DNA molecules is occupied by adenine, or a position in each of two polypeptides is occupied by lysine), then the molecules are identical at that position. Between the two sequences. Typically, the comparison is made when the two sequences are aligned to yield maximum identity. Such an alignment can be determined by using, for example, the identity of the amino acid sequences by conventional methods, by computerized algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics package), with reference to, for example, the teachings of Smith and Waterman,1981, adv.Appl.Math.2:482Pearson & Lipman,1988, Proc.Natl Acad.Sci.USA 85:2444, Thompson et al, 1994, Nucleic Acids Res 22:467380, etc. The BLAST algorithm, available from the national center for Biotechnology information (NCBI www.ncbi.nlm.nih.gov /), can also be used, determined using default parameters.

As used herein, the "CRISPR" refers to Clustered, regularly interspaced short palindromic repeats (Clustered regular interspersed short palindromic repeats) derived from the immune system of a microorganism.

As used herein, "biotin", also known as vitamin H, is a small molecule vitamin with a molecular weight of 244 Da. "avidin", also called avidin, is a basic glycoprotein having 4 binding sites with a very high affinity to biotin, and streptavidin is a commonly used avidin. The very strong affinity of biotin to avidin can be used to amplify or enhance the detection signal in the detection system. For example, biotin is easily bonded to a protein (such as an antibody) by a covalent bond, and an avidin molecule bonded to an enzyme reacts with a biotin molecule bonded to a specific antibody, so that not only is a multi-stage amplification effect achieved, but also color is developed due to the catalytic effect of the enzyme when the enzyme meets a corresponding substrate, and the purpose of detecting an unknown antigen (or antibody) molecule is achieved.

Cas protein

As used herein, "Cas protein" refers to a CRISPR-associated protein, preferably from type V or type VI CRISPR/Cas protein, which upon binding to a signature sequence (target sequence) to be detected (i.e., forming a ternary complex of Cas protein-gRNA-target sequence) can induce its trans activity, i.e., random cleavage of non-targeted single-stranded nucleotides (i.e., the single-stranded nucleic acid detector described herein, preferably single-stranded DNA (ssdna), single-stranded DNA-RNA hybrids, single-stranded RNA). When the Cas protein is combined with the characteristic sequence, the protein can induce the trans activity by cutting or not cutting the characteristic sequence; preferably, it induces its trans activity by cleaving the signature sequence; more preferably, it induces its trans activity by cleaving the single-stranded signature sequence.

The Cas protein is a protein at least having trans cleavage activity, and preferably, the Cas protein is a protein having Cis and trans cleavage activity. The Cis activity refers to the activity that the Cas protein can recognize a PAM site and specifically cut a target sequence under the action of the gRNA.

The Cas protein provided by the invention comprises V-type and VI-type CRISPR/CAS effector proteins, and comprises protein families such as Cas12, Cas13 and Cas 14. Preferably, e.g., Cas12 proteins, e.g., Cas12a, Cas12b, Cas12d, Cas12e, Cas12f, Cas12g, Cas12h, Cas12i, Cas12 j; preferably, the Cas protein is Cas12a, Cas12b, Cas12i, Cas12 j. The Cas13 protein family includes Cas13a, Cas13b, and the like.

In embodiments, a Cas protein, as referred to herein, such as Cas12, also encompasses a functional variant of Cas or a homolog or ortholog thereof. As used herein, a "functional variant" of a protein refers to a variant of such a protein that at least partially retains the activity of the protein. Functional variants may include mutants (which may be insertion, deletion or substitution mutants), including polymorphs and the like. Also included in functional variants are fusion products of such proteins with another, usually unrelated, nucleic acid, protein, polypeptide or peptide. Functional variants may be naturally occurring or may be artificial. Advantageous embodiments may relate to engineered or non-naturally occurring V-type DNA targeting effector proteins.

In one embodiment, one or more nucleic acid molecules encoding a Cas protein, such as Cas12, or orthologs or homologs thereof, may be codon optimized for expression in a eukaryotic cell. Eukaryotes can be as described herein. One or more nucleic acid molecules may be engineered or non-naturally occurring.

In one embodiment, the Cas12 protein or ortholog or homolog thereof may comprise one or more mutations (and thus the nucleic acid molecule encoding it may have one or more mutations.

In one embodiment, the Cas protein may be from: cilium, listeria, corynebacterium, satrapia, legionella, treponema, Proteus, eubacterium, Streptococcus, Lactobacillus, Mycoplasma, Bacteroides, Flavivivola, Flavobacterium, Azospirillum, Sphaerochaeta, gluconacetobacter, Neisseria, Rochelia, Parvibaculum, Staphylococcus, Nitrarefactor, Mycoplasma, Campylobacter, and Muspirillum.

The Cas protein can be obtained by recombinant expression vector technology, namely, a nucleic acid molecule encoding the protein is constructed on a proper vector and then is transformed into a host cell, so that the encoding nucleic acid molecule is expressed in the cell, and the corresponding protein is obtained. The protein can be secreted by cells, or the protein can be obtained by breaking cells through a conventional extraction technology. The encoding nucleic acid molecule may or may not be integrated into the genome of the host cell for expression. The vector may further comprise regulatory elements which facilitate sequence integration, or self-replication. The vector may be of the type of plasmid, virus, cosmid, phage, etc., which are well known to those skilled in the art, and preferably, the expression vector of the present invention is a plasmid. The vector further comprises one or more regulatory elements selected from the group consisting of promoters, enhancers, ribosome binding sites for translation initiation, terminators, polyadenylation sequences, and selectable marker genes.

The host cell may be a prokaryotic cell, such as E.coli, Streptomyces, Agrobacterium: or lower eukaryotic cells, such as yeast cells; or higher eukaryotic cells, such as plant cells. It will be clear to one of ordinary skill in the art how to select an appropriate vector and host cell.

gRNA

As used herein, the "gRNA" is also referred to as guide RNA or guide RNA and has a meaning commonly understood by those skilled in the art. In general, the guide RNA may comprise, or consist essentially of, a direct repeat and a guide sequence (guide sequence). grnas may include crRNA and tracrRNA or only crRNA depending on Cas protein on which they depend in different CRISPR systems. The crRNA and tracrRNA may be artificially engineered to fuse to form single guide RNA (sgRNA). In certain instances, the guide sequence is any polynucleotide sequence that is sufficiently complementary to the target sequence (the signature sequence described in the present invention) to hybridize to the target sequence and direct specific binding of the CRISPR/Cas complex to the target sequence, typically having a sequence length of 12-25 nt. The direct repeat sequence can fold to form a specific structure (such as a stem-loop structure) for recognition by the Cas protein to form a complex. The targeting sequence need not be 100% complementary to the signature sequence (target sequence). The targeting sequence is not complementary to the single stranded nucleic acid detector.

In certain embodiments, the degree of complementarity (degree of match) between a targeting sequence and its corresponding target sequence is at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 99%, when optimally aligned. Determining the optimal alignment is within the ability of one of ordinary skill in the art. For example, there are published and commercially available alignment algorithms and programs such as, but not limited to, ClustalW, the Smith-Waterman algorithm in matlab (Smith-Waterman), Bowtie, Geneius, Biopython, and SeqMan.

The gRNA of the invention can be natural, and can also be artificially modified or designed and synthesized.

Single-stranded nucleic acid detector

The single-stranded nucleic acid detector of the present invention refers to a sequence containing 2 to 200 nucleotides, preferably, 2 to 150 nucleotides, preferably, 3 to 100 nucleotides, preferably, 3 to 30 nucleotides, preferably, 4 to 20 nucleotides, and more preferably, 5 to 15 nucleotides. Preferably a single-stranded DNA molecule, a single-stranded RNA molecule or a single-stranded DNA-RNA hybrid.

The single stranded nucleic acid detector is used in a detection method or system to report the presence or absence of a target nucleic acid in a sample. The single-stranded nucleic acid detector comprises different reporter groups or marker molecules at both ends, and does not present a reporter signal when in an initial state (i.e., an uncleaved state), and presents a detectable signal when the single-stranded nucleic acid detector is cleaved, i.e., presents a detectable difference after cleavage from before cleavage. In the present invention, if a detectable difference can be detected, it is reflected that the target nucleic acid can be detected; alternatively, if the detectable difference is not detectable, it is a reflection that the target nucleic acid is not detectable.

In one embodiment, the reporter group or the marker molecule comprises a fluorescent group and a quenching group, wherein the fluorescent group is selected from one or any several of FAM, FITC, VIC, JOE, TET, CY3, CY5, ROX, Texas Red or LC RED 460; the quenching group is selected from one or more of BHQ1, BHQ2, BHQ3, Dabcy1 or Tamra.

In other embodiments, the single stranded nucleic acid detector has a first molecule (e.g., FAM or FITC) attached to one end and a second molecule (e.g., biotin) attached to the other end. The reaction system containing the single-stranded nucleic acid detector is used in combination with a flow strip to detect the target nucleic acid (preferably, in a colloidal gold detection manner). The flow strip is designed with two capture lines, with an antibody that binds to a first molecule (i.e. a first molecular antibody) at the sample contacting end (colloidal gold), an antibody that binds to the first molecular antibody at the first line (control line), and an antibody that binds to a second molecule (i.e. a second molecular antibody, such as avidin) at the second line (test line). As the reaction flows along the strip, the first molecular antibody binds to the first molecule carrying the cleaved or uncleaved oligonucleotide to the capture line, the cleaved reporter will bind to the antibody of the first molecular antibody at the first capture line, and the uncleaved reporter will bind to the second molecular antibody at the second capture line. Binding of the reporter group at each line will result in a strong readout/signal (e.g. color). As more reporters are cut, more signal will accumulate at the first capture line and less signal will appear at the second line. In certain aspects, the invention relates to the use of a flow strip as described herein for detecting nucleic acids. In certain aspects, the invention relates to a method of detecting nucleic acids using a flow strip as defined herein, e.g. a (side) flow test or a (side) flow immunochromatographic assay. In some aspects, the molecules in the single-stranded nucleic acid detector may be replaced with each other, or the positions of the molecules may be changed, and the modified form is also included in the present invention as long as the reporting principle is the same as or similar to that of the present invention.

The detection method of the present invention can be used for quantitative detection of a target nucleic acid. The quantitative detection index can be quantified according to the signal intensity of the reporter group, such as the luminous intensity of a fluorescent group, or the width of a color development strip.

Sequence information

The partial sequence information related to the present invention is provided as follows:

serial number	Description of the invention
		SEQ ID NO：1	SPCFV amplification products
SEQ ID NO：2	Cas12i
		SEQ ID NO：3	Targeting region of gRNA-1
SEQ ID NO：4	Targeting region of gRNA-2
		SEQ ID NO：5	Targeting region for gRNA-3
SEQ ID NO：6	DR region of gRNA
		SEQ ID NO：7	Primer F1
SEQ ID NO：8	Primer F2
		SEQ ID NO：9	Primer F3
SEQ ID NO：10	Primer F4
		SEQ ID NO：11	Primer R1
SEQ ID NO：12	Primer R2
		SEQ ID NO：13	Primer R3
SEQ ID NO：14	Primer R4

Drawings

FIG. 1 shows the amplification sequence of sweet potato melatonin spot virus, and the position of each primer on the amplification sequence.

FIG. 2 is a graph showing the amplification results of different primer pairs (F1-R1, F2-R2, F2-R3, F3-R3, F3-R4, F4-R3, F4-R4). Wherein line 1 is the experimental group and line 2 is the control group without template. Each amplification primer pair corresponds to the amplification curve and the dissolution curve of PCR respectively. According to the amplification curve, CT values of F1-R1, F2-R2, F2-R3, F3-R3, F3-R4, F4-R3 and F4-R4 are 32.8, 33.7, 34.2, 34.3, 33.2, 33.0 and 33.9 respectively. As can be seen from the dissolution curves, the control groups of F2-R2, F2-R3, F3-R3 and F4-R3 have no peaks, so that F2-R2, F2-R3, F3-R3 and F4-R3 have no primer dimer; the control groups of F1-R1, F3-R4, and F4-R4 had peaks and primer dimers.

FIG. 3 shows the amplification sequence of sweet potato melatonin spot virus, and the position of each gRNA on the amplification sequence.

FIG. 4 is a graph showing the results of detection of ssDNA target nucleic acids by different gRNAs (gRNA-1, gRNA-2, and gRNA-3). Wherein line 1 is an experimental group and line 2 is a control group to which no target nucleic acid is added; the time for the fluorescent signals to reach the peak value (reach the plateau phase) when the gRNA-1, the gRNA-2 and the gRNA-3 react with the ssDNA target nucleic acid is respectively about 17min, 7min and 6 min.

FIG. 5 is a graph showing the results of detection of dsDNA target nucleic acids by different gRNAs (gRNA-1, gRNA-2, and gRNA-3). Wherein line 1 is an experimental group and line 2 is a control group to which no target nucleic acid is added; the time for the fluorescent signals to reach the peak value (reach the plateau phase) when the gRNA-1, the gRNA-2 and the gRNA-3 react with the dsDNA target nucleic acid is respectively about 30min, 17min and 17 min.

Detailed Description

The present invention will be further described with reference to the following examples, which are intended to be illustrative only and not to be limiting of the invention in any way, and any person skilled in the art can modify the present invention by applying the teachings disclosed above and applying them to equivalent embodiments with equivalent modifications. Any simple modification or equivalent changes made to the following embodiments according to the technical essence of the present invention, without departing from the technical spirit of the present invention, fall within the scope of the present invention.

The technical scheme of the invention is based on the following principle, combines PCR amplification with CRISPR technology, and has the characteristics of rapidness, sensitivity, specificity and high efficiency. Under the premise that specific nucleic acid of target pathogenic bacteria exists in a sample, a specific primer is combined with a target sequence, the target sequence is enriched through PCR amplification, Cas enzyme (Cas protein) is combined with an amplification product under the guidance of gRNA, the trans-cleavage (trans) activity of the Cas protein is activated, a Reporter (one end of the Reporter is connected with a fluorescent group, and the other end of the Reporter is connected with a quenching group) in a cleavage system can release fluorescence after being cleaved by the Cas protein, so that a detection result is presented. In other embodiments, both ends of the single-stranded nucleic acid detector (Reporter) may be provided with a label capable of being detected by colloidal gold.

Example 1 amplification of sweet Potato Graptosphaera Acuminata specific nucleic acid

In this embodiment, the design of primers and the amplification of target nucleic acids are performed for specific nucleic acids of Sweet potato melatonin virus (SPCFV).

Specific sequences were selected for PCR amplification based on the SPCFV genome:

tacttttcgctctcctgctgaagaggcactatcctccttctcatccgtcgaacaatcccaaat tacgcgcaaagctcttgccacgttcataagcattgaagagagggaacacactttctttaattatgct gtcaagatacatgccaaggaacgtttgacgaatgcagggatatacctctc(SEQ ID No.1)

based on the specific sequence of the SPCFV genome (SEQ ID No.1), amplification primers were designed as follows:

F1:ctctcctgctgaagaggca；

F2:tcRtccgtcgaacaRtccca；

F3:acttttcgctctcctgctgaa；

F4:ctcctgctgaagaggcacta；

R1:gaggtatatccctgcattcgt；

R2:tcgtcaaacgttccttRgca；

R3:atccctgcattcgtcaaacg；

R4:cctgcattcgtcaaacgttcc；

FIG. 1 shows the position of each primer on the amplified sequence.

The following PCR amplification primer pair combinations were selected: F1-R1, F2-R2, F2-R3, F3-R3, F3-R4, F4-R3 and F4-R4.

The PCR amplification system is as follows:

the PCR reaction procedure was as follows:

two step amplification
			Step
1	50℃	10min
			Step
2	95℃	5min
			Step
3	95℃	15sec
					60℃	30sec
45cycles

And each amplification primer pair is subjected to PCR amplification under the same PCR amplification system and the same template amount.

FIG. 2 shows the amplification results of the primer pairs F1-R1, F2-R2, F2-R3, F3-R3, F3-R4, F4-R3, and F4-R4. As shown in FIGS. 2A-2N, each amplification primer pair corresponds to the amplification curve and the lysis curve of PCR, respectively. According to the amplification curve, CT values of F1-R1, F2-R2, F2-R3, F3-R3, F3-R4, F4-R3 and F4-R4 are 32.8, 33.7, 34.2, 34.3, 33.2, 33.0 and 33.9 respectively. As can be seen from the dissolution curves, the control groups of F2-R2, F2-R3, F3-R3 and F4-R3 have no peaks, so that F2-R2, F2-R3, F3-R3 and F4-R3 have no primer dimer; the control groups of F1-R1, F3-R4, and F4-R4 had peaks and primer dimers. Wherein line 1 is the experimental group and line 2 is the control group without template.

The primer pair F4-R3 with no primer dimer and smaller CT value was selected for subsequent experiments.

Example 2 design of gRNA of sweet Potato Graptosphaera-specific nucleic acid

3 gRNAs (gRNA1, gRNA2, gRNA3) were designed within the segment or its complement to the target sequence SEQ ID No. 1. The grnas designed based on Cas12i (SEQ ID No.2) and capable of binding Cas12i in this embodiment, the first 3 bases at the 5' end of each gRNA are TTN (PAM sequence).

The sequences of the designed grnas were as follows:

fig. 3 shows the position of each gRNA on the amplified sequence.

Example 3 application of gRNA to nucleic acid detection

In order to verify the detection efficiency of the different grnas designed in example 2 when applied to Cas12i protein, the activity of the different grnas was verified in this embodiment.

First, a single-stranded target sequence (ssDNA, SEQ ID No.1) or its reverse complement is used as the target nucleic acid.

The single-stranded nucleic acid detector sequence is FAM-TTATT-BHQ 1;

the following reaction system is adopted: cas12i was 25nM final concentration, gRNA 25nM final concentration, target nucleic acid 25nM final concentration, single stranded nucleic acid detector 200nM final concentration. Incubation at 37 ℃ and reading FAM fluorescence/20 sec. The control group had no target nucleic acid added.

FIG. 4 shows the results of reactions with a target nucleic acid of ssDNA using gRNA-1, gRNA-2, and gRNA-3. As shown in FIGS. 4A to 4C, the time for the fluorescence signal to reach the peak (plateau) when the gRNA-1, gRNA-2, and gRNA-3 react with the ssDNA target nucleic acid was about 17min, 7min, and 6min, respectively. Compared with a control group, the gRNA-1, the gRNA-2 and the gRNA-3 can rapidly report fluorescence, and reflect better sensitivity when the sweet potato chlorotic alternaria virus specific nucleic acid is detected. Wherein line 1 is the experimental group and line 2 is the control group without template.

The efficiency of detecting double-stranded target sequences (dsDNA) by gRNA-1, gRNA-2 and gRNA-3 for detecting single-stranded target sequences is further verified.

Double-stranded target sequences (dsDNA, SEQ ID No.1) were used as double-stranded target nucleic acids.

The double-stranded target nucleic acid was obtained from the PCR reaction of example 1, wherein the template was a plasmid containing the target nucleic acid fragment, the amount of template added for the PCR reaction was 1000 copies, the PCR amplification was performed for 45 cycles, and after the PCR reaction was completed, 45ul of Cas reaction system was added to 15ul of PCR system.

The single-stranded nucleic acid detector sequence is FAM-TTATT-BHQ 1;

the following detection system was used: cas12i was at a final concentration of 50nM, gRNA was at a final concentration of 50nM, target nucleic acid (dsDNA amplified by PCR in example 1) 15. mu.l, and single-stranded nucleic acid detector was at a final concentration of 200 nM. Incubation at 37 ℃ and reading FAM fluorescence/20 sec. The control group had no target nucleic acid added.

FIG. 5 shows the results of gRNA-1, gRNA-2, and gRNA-3 when reacted with a target nucleic acid of dsDNA. As shown in FIGS. 5A to 5C, the time for the fluorescence signal to reach the peak (plateau) when gRNA-1, gRNA-2, and gRNA-3 react with the dsDNA target nucleic acid was about 30min, 17min, and 17min, respectively. Compared with a control group, the gRNA-1, the gRNA-2 and the gRNA-3 can show obvious fluorescent signals in a shorter time, so that the sensitivity of detecting dsDNA is better; particularly gRNA-2 and gRNA-3, can reach the peak value of the fluorescence signal within about 17 min. In fig. 5, 1 is an experimental group and 2 is a control group.

The length of the guide sequence of the gRNA (gRNA-1, 2 and 3) with better effect screened in the application is 17-20bp, namely, the hybridization region of the guide sequence and the target nucleic acid is 17-20 bp; in practice, one skilled in the art can also add or subtract any base to the 3' end of the guide sequence (and certainly ensure that it hybridizes to the target nucleic acid); the 5' end of the leader sequence is adjacent to the PAM sequence and is not suitable for readjustment; however, these length changes do not substantially affect the activity of gRNA, as long as the 3' end is guaranteed to have a 15bp-30bp hybridizing region with the target sequence, i.e., to achieve the function of binding Cas enzyme to the target sequence. For example, a guide sequence for gRNA-1, 2, 3, can be reduced by 1-5 bases (e.g., 1, 2, 3, 4, or 5 bases) or increased by 1-13 bases (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13 bases) at the 3' end, while ensuring its pairing with the target sequence, which does not substantially affect the efficiency of the gRNA and Cas protein in detecting the target nucleic acid.

While specific embodiments of the invention have been described in detail, those skilled in the art will understand that: various modifications and changes in detail can be made in light of the overall teachings of the disclosure, and such changes are intended to be within the scope of the present invention. A full appreciation of the invention is gained by taking the entire specification as a whole in the light of the appended claims and any equivalents thereof.

SEQUENCE LISTING

<110> Shunheng Biotechnology (Hainan) Ltd

Shandong Shunfeng Biotechnology Co.,Ltd.

<120> method for detecting sweet potato fading spot virus based on CRISPR technology

<130> P2021-2755

<160> 14

<170> PatentIn version 3.5

<210> 1

<211> 180

<212> DNA

<213> Artificial sequence (artificial sequence)

<220>

<223> SPCFV amplification product

<400> 1

tacttttcgc tctcctgctg aagaggcact atcctccttc tcatccgtcg aacaatccca 60

aattacgcgc aaagctcttg ccacgttcat aagcattgaa gagagggaac acactttctt 120

taattatgct gtcaagatac atgccaagga acgtttgacg aatgcaggga tatacctctc 180

<210> 2

<211> 1045

<212> PRT

<213> Artificial sequence (artificial sequence)

<220>

<223> Cas12i

<400> 2

Met Lys Lys Val Glu Val Ser Arg Pro Tyr Gln Ser Leu Leu Leu Pro

1 5 10 15

Asn His Arg Lys Phe Lys Tyr Leu Asp Glu Thr Trp Asn Ala Tyr Lys

20 25 30

Ser Val Lys Ser Leu Leu His Arg Phe Leu Val Cys Ala Tyr Gly Ala

35 40 45

Val Pro Phe Asn Lys Phe Val Glu Val Val Glu Lys Val Asp Asn Asp

50 55 60

Gln Leu Val Leu Ala Phe Ala Val Arg Leu Phe Arg Leu Val Pro Val

65 70 75 80

Glu Ser Thr Ser Phe Ala Lys Val Asp Lys Ala Asn Leu Ala Lys Ser

85 90 95

Leu Ala Asn His Leu Pro Val Gly Thr Ala Ile Pro Ala Asn Val Gln

100 105 110

Ser Tyr Phe Asp Ser Asn Phe Asp Pro Lys Lys Tyr Met Trp Ile Asp

115 120 125

Cys Ala Trp Glu Ala Asp Arg Leu Ala Arg Glu Met Gly Leu Ser Ala

130 135 140

Ser Gln Phe Ser Glu Tyr Ala Thr Thr Met Leu Trp Glu Asp Trp Leu

145 150 155 160

Pro Leu Asn Lys Asp Asp Val Asn Gly Trp Gly Ser Val Ser Gly Leu

165 170 175

Phe Gly Glu Gly Lys Lys Glu Asp Arg Gln Gln Lys Val Lys Met Leu

180 185 190

Asn Asn Leu Leu Asn Gly Ile Lys Lys Asn Pro Pro Lys Asp Tyr Thr

195 200 205

Gln Tyr Leu Lys Ile Leu Leu Asn Ala Phe Asp Ala Lys Ser His Lys

210 215 220

Glu Ala Val Lys Asn Tyr Lys Gly Asp Ser Thr Gly Arg Thr Ala Ser

225 230 235 240

Tyr Leu Ser Glu Lys Ser Gly Glu Ile Thr Glu Leu Met Leu Glu Gln

245 250 255

Leu Met Ser Asn Ile Gln Arg Asp Ile Gly Asp Lys Gln Lys Glu Ile

260 265 270

Ser Leu Pro Lys Lys Asp Val Val Lys Lys Tyr Leu Glu Ser Glu Ser

275 280 285

Gly Val Pro Tyr Asp Gln Asn Leu Trp Ser Gln Ala Tyr Arg Asn Ala

290 295 300

Ala Ser Ser Ile Lys Lys Thr Asp Thr Arg Asn Phe Asn Ser Thr Leu

305 310 315 320

Glu Lys Phe Lys Asn Glu Val Glu Leu Arg Gly Leu Leu Ser Glu Gly

325 330 335

Asp Asp Val Glu Ile Leu Arg Ser Lys Phe Phe Ser Ser Glu Phe His

340 345 350

Lys Thr Pro Asp Lys Phe Val Ile Lys Pro Glu His Ile Gly Phe Asn

355 360 365

Asn Lys Tyr Asn Val Val Ala Glu Leu Tyr Lys Leu Lys Ala Glu Ala

370 375 380

Thr Asp Phe Glu Ser Ala Phe Ala Thr Val Lys Asp Glu Phe Glu Glu

385 390 395 400

Lys Gly Ile Lys His Pro Ile Lys Asn Ile Leu Glu Tyr Ile Trp Asn

405 410 415

Asn Glu Val Pro Val Glu Lys Trp Gly Arg Val Ala Arg Phe Asn Gln

420 425 430

Ser Glu Glu Lys Leu Leu Arg Ile Lys Ala Asn Pro Thr Val Glu Cys

435 440 445

Asn Gln Gly Met Thr Phe Gly Asn Ser Ala Met Val Gly Glu Val Leu

450 455 460

Arg Ser Asn Tyr Val Ser Lys Lys Gly Ala Leu Val Ser Gly Glu His

465 470 475 480

Gly Gly Arg Leu Ile Gly Gln Asn Asn Met Ile Trp Leu Glu Met Arg

485 490 495

Leu Leu Asn Lys Gly Lys Trp Glu Thr His His Val Pro Thr His Asn

500 505 510

Met Lys Phe Phe Glu Glu Val His Ala Tyr Asn Pro Ser Leu Ala Asp

515 520 525

Ser Val Asn Val Arg Asn Arg Leu Tyr Arg Ser Glu Asp Tyr Thr Gln

530 535 540

Leu Pro Ser Ser Ile Thr Asp Gly Leu Lys Gly Asn Pro Lys Ala Lys

545 550 555 560

Leu Leu Lys Arg Gln His Cys Ala Leu Asn Asn Met Thr Ala Asn Val

565 570 575

Leu Asn Pro Lys Leu Ser Phe Thr Ile Asn Lys Lys Asn Asp Asp Tyr

580 585 590

Thr Val Ile Ile Val His Ser Val Glu Val Ser Lys Pro Arg Arg Glu

595 600 605

Val Leu Val Gly Asp Tyr Leu Val Gly Met Asp Gln Asn Gln Thr Ala

610 615 620

Ser Asn Thr Tyr Ala Val Met Gln Val Val Lys Pro Lys Ser Thr Asp

625 630 635 640

Ala Ile Pro Phe Arg Asn Met Trp Val Arg Phe Val Glu Ser Gly Ser

645 650 655

Ile Glu Ser Arg Thr Leu Asn Ser Arg Gly Glu Tyr Val Asp Gln Leu

660 665 670

Asn His Asp Gly Val Asp Leu Phe Glu Ile Gly Asp Thr Glu Trp Val

675 680 685

Asp Ser Ala Arg Lys Phe Phe Asn Lys Leu Gly Val Lys His Lys Asp

690 695 700

Gly Thr Leu Val Asp Leu Ser Thr Ala Pro Arg Lys Ala Tyr Ala Phe

705 710 715 720

Asn Asn Phe Tyr Phe Lys Thr Met Leu Asn His Leu Arg Ser Asn Glu

725 730 735

Val Asp Leu Thr Leu Leu Arg Asn Glu Ile Leu Arg Val Ala Asn Gly

740 745 750

Arg Phe Ser Pro Met Arg Leu Gly Ser Leu Ser Trp Thr Thr Leu Lys

755 760 765

Ala Leu Gly Ser Phe Lys Ser Leu Val Leu Ser Tyr Phe Asp Arg Leu

770 775 780

Gly Ala Lys Glu Met Val Asp Lys Glu Ala Lys Asp Lys Ser Leu Phe

785 790 795 800

Asp Leu Leu Val Ala Ile Asn Asn Lys Arg Ser Asn Lys Arg Glu Glu

805 810 815

Arg Thr Ser Arg Ile Ala Ser Ser Leu Met Thr Val Ala Gln Lys Tyr

820 825 830

Lys Val Asp Asn Ala Val Val His Val Val Val Glu Gly Asn Leu Ser

835 840 845

Ser Thr Asp Arg Ser Ala Ser Lys Ala His Asn Arg Asn Thr Met Asp

850 855 860

Trp Cys Ser Arg Ala Val Val Lys Lys Leu Glu Asp Met Cys Asn Leu

865 870 875 880

Tyr Gly Phe Asn Ile Lys Gly Val Pro Ala Phe Tyr Thr Ser His Gln

885 890 895

Asp Pro Leu Val His Arg Ala Asp Tyr Asp Asp Pro Lys Pro Ala Leu

900 905 910

Arg Cys Arg Tyr Ser Ser Tyr Ser Arg Ala Asp Phe Ser Lys Trp Gly

915 920 925

Gln Asn Ala Leu Ala Ala Val Val Arg Trp Ala Ser Asn Lys Lys Ser

930 935 940

Asn Thr Cys Tyr Lys Val Gly Ala Val Glu Phe Leu Lys Gln His Gly

945 950 955 960

Leu Phe Ala Asp Lys Lys Leu Thr Val Glu Gln Phe Leu Ser Lys Val

965 970 975

Lys Asp Glu Glu Ile Leu Ile Pro Arg Arg Gly Gly Arg Val Phe Leu

980 985 990

Thr Thr His Arg Leu Leu Ala Glu Ser Thr Phe Val Tyr Leu Asn Gly

995 1000 1005

Val Lys Tyr His Ser Cys Asn Ala Asp Glu Val Ala Ala Val Asn

1010 1015 1020

Ile Cys Leu Asn Asp Trp Val Ile Pro Cys Lys Lys Lys Met Lys

1025 1030 1035

Glu Glu Ser Ser Ala Ser Gly

1040 1045

<210> 3

<211> 20

<212> RNA

<213> Artificial sequence (artificial sequence)

<220>

<223> gRNA-1

<400> 3

aauuaugcug ucaagauaca 20

<210> 4

<211> 18

<212> RNA

<213> Artificial sequence (artificial sequence)

<220>

<223> gRNA-2

<400> 4

ugcugucaag auacaugc 18

<210> 5

<211> 17

<212> RNA

<213> Artificial sequence (artificial sequence)

<220>

<223> gRNA-3

<400> 5

aagaaagugu guucccu 17

<210> 6

<211> 23

<212> RNA

<213> Artificial sequence (artificial sequence)

<220>

<223> DR region of gRNA

<400> 6

agagaaugug ugcauaguca cac 23

<210> 7

<211> 19

<212> DNA

<213> Artificial sequence (artificial sequence)

<220>

<223> F1

<400> 7

ctctcctgct gaagaggca 19

<210> 8

<211> 20

<212> DNA

<213> Artificial sequence (artificial sequence)

<220>

<223> F2

<400> 8

tcrtccgtcg aacartccca 20

<210> 9

<211> 21

<212> DNA

<213> Artificial sequence (artificial sequence)

<220>

<223> F3

<400> 9

acttttcgct ctcctgctga a 21

<210> 10

<211> 20

<212> DNA

<213> Artificial sequence (artificial sequence)

<220>

<223> F4

<400> 10

ctcctgctga agaggcacta 20

<210> 11

<211> 21

<212> DNA

<213> Artificial sequence (artificial sequence)

<220>

<223> R1

<400> 11

gaggtatatc cctgcattcg t 21

<210> 12

<211> 20

<212> DNA

<213> Artificial sequence (artificial sequence)

<220>

<223> R2

<400> 12

tcgtcaaacg ttccttrgca 20

<210> 13

<211> 20

<212> DNA

<213> Artificial sequence (artificial sequence)

<220>

<223> R3

<400> 13

atccctgcat tcgtcaaacg 20

<210> 14

<211> 21

<212> DNA

<213> Artificial sequence (artificial sequence)

<220>

<223> R4

<400> 14

cctgcattcg tcaaacgttc c 21

Claims (12)

1. A gRNA for detecting sweet potato melatonin spot virus, the gRNA comprising a region binding to a V-type Cas protein and a guide sequence hybridizing to a target nucleic acid, which is a nucleic acid derived from sweet potato melatonin spot virus; wherein the guide sequence hybridized with the target nucleic acid is selected from any one or the combination of the following groups:

(1) the guide sequence hybridized with the target nucleic acid contains 17-30 bases and is hybridized with the sequence shown in SEQ ID No.1 or the reverse complementary sequence thereof, and the guide sequence comprises the sequence shown in any one of SEQ ID Nos. 3-5;

(2) the guide sequence hybridized with the target nucleic acid comprises a sequence shown in any one of SEQ ID No.3-5, and further comprises 1-13 bases at the 3' end of the sequence shown in any one of SEQ ID No.3-5, and the guide sequence hybridized with the target nucleic acid is hybridized with the sequence shown in SEQ ID No.1 or the reverse complementary sequence thereof;

(3) compared with the sequence shown in any one of SEQ ID No.3-5, the guide sequence hybridized with the target nucleic acid continuously deletes 1-5 bases from the 3' end of the sequence shown in any one of SEQ ID No. 3-5;

(4) the guide sequence hybridized with the target nucleic acid is shown as any one of SEQ ID No. 3-5.

2. A method for detecting/diagnosing sweet potato melatonin spot virus or sweet potato disease, which comprises contacting a nucleic acid to be detected with a V-type Cas protein, the gRNA of claim 1 and a single-stranded nucleic acid detector; and detecting a detectable signal generated by the Cas protein cutting single-stranded nucleic acid detector, thereby detecting/diagnosing the sweet potato fading spot virus or the sweet potato disease.

3. The method of claim 2, further comprising the step of obtaining the test nucleic acid from the test sample.

4. The method of claim 2 or 3, further comprising the step of amplifying the test nucleic acid using a primer pair.

5. The method of claim 4, wherein the upstream primer of the primer pair is as set forth in SEQ ID NO: 7-10, wherein the downstream primer of the primer pair is shown as SEQ ID NO: 11-14.

6. The method of claim 3, wherein the sample is a sample of a plant or a plant-derived toxic medium.

7. The method of claim 2, wherein the detectable signal is achieved by any one of: vision-based detection, sensor-based detection, color detection, gold nanoparticle-based detection, fluorescence polarization, fluorescence signal, colloidal phase transition, electrochemical detection, or semiconductor-based detection.

8. A system, composition or kit for detecting or diagnosing whether a plant to be tested is infected with sweet potato melatonin spot virus, the system, composition or kit comprising a V-type Cas protein, the gRNA of claim 1, and a single-stranded nucleic acid detector.

9. A system, composition or kit for detecting/diagnosing sweet potato melatonin spot virus or sweet potato disease, the system, composition or kit comprising the gRNA of claim 1, the system, composition or kit further comprising a V-type Cas protein and a single-stranded nucleic acid detector.

10. The system, composition or kit of any of claims 8-9, wherein the system, composition or kit comprises the primer pair of claim 5.

11. Use of the composition of any one of claims 8 to 10 for diagnosing or detecting sweet potato diseases, or for preparing a reagent or a kit for diagnosing or detecting sweet potato diseases.

12. Use of the composition of any one of claims 8-10 for detecting or diagnosing sweet potato melatonin spot virus, or for preparing a reagent or a kit for detecting or diagnosing sweet potato melatonin spot virus.

Images