CN113827707B - Use of a-lactalbumin for inhibiting coronaviruses - Google Patents

Use of a-lactalbumin for inhibiting coronaviruses Download PDF

Info

Publication number
CN113827707B
CN113827707B CN202111168041.8A CN202111168041A CN113827707B CN 113827707 B CN113827707 B CN 113827707B CN 202111168041 A CN202111168041 A CN 202111168041A CN 113827707 B CN113827707 B CN 113827707B
Authority
CN
China
Prior art keywords
lactalbumin
cells
cov
sars
caco
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202111168041.8A
Other languages
Chinese (zh)
Other versions
CN113827707A (en
Inventor
向宽辉
庄辉
李彤
赖鑫源
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Peking University
Original Assignee
Peking University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Peking University filed Critical Peking University
Priority to CN202111168041.8A priority Critical patent/CN113827707B/en
Publication of CN113827707A publication Critical patent/CN113827707A/en
Application granted granted Critical
Publication of CN113827707B publication Critical patent/CN113827707B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/38—Albumins
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/14—Antivirals for RNA viruses
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Virology (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Medicinal Chemistry (AREA)
  • Epidemiology (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Oncology (AREA)
  • Organic Chemistry (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Immunology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Communicable Diseases (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The application discloses application of a-lactalbumin. The application is the application of a-lactalbumin in any one of the following: (A1) Preparing a product for inhibiting coronavirus, or inhibiting coronavirus; (A2) Preparing a product for treating and/or preventing a disease caused by coronavirus infection, or treating and/or preventing a disease caused by coronavirus infection; (A3) Preparing a product that ameliorates symptoms caused by a coronavirus infection, or ameliorates symptoms caused by a coronavirus infection; (A4) Preparing a product for treating and/or preventing a disease caused by the replication of said coronavirus, or treating and/or preventing a disease caused by the replication of said coronavirus. The examples of the present application demonstrate that a-lactalbumin can inhibit the adhesion and entry of coronaviruses while also inhibiting replication following coronavirus infection.

Description

Use of a-lactalbumin for inhibiting coronaviruses
Technical Field
The application belongs to the field of medicines, and particularly relates to application of a-lactalbumin in inhibiting coronaviruses.
Background
2019 novel coronavirus (2019-nCoV or SARS-CoV-2, eliciting novel coronavirus pneumonia COVID-19), HCoV-229E, HCoV-OC43, HCoV-NL63, HCoV-HKU1, SARS-CoV and MERS-CoV are currently known coronaviruses that can infect humans. Among them, HCoV-229E, HCoV-OC43, HCoV-NL63 and HCoV-HKU1 are less pathogenic and generally cause respiratory symptoms like common cold or pneumonia. While the other three coronaviruses are very pathogenic and infectious, the diseases they cause include severe acute respiratory syndrome (SARS, 2002-2004), middle east respiratory syndrome (MERS, 2012-to-date) and novel coronavirus disease (covd-19). Therefore, how to block the transmission of coronaviruses, prevent infection and develop new effective drugs is a technical problem to be solved.
Disclosure of Invention
It is an object of the present application to provide the use of a-lactalbumin.
The application provides the use of a-lactalbumin in any of the following:
(A1) Preparing a product for inhibiting coronavirus, or inhibiting coronavirus;
(A2) Preparing a product for treating and/or preventing a disease caused by coronavirus infection, or treating and/or preventing a disease caused by coronavirus infection;
(A3) Preparing a product that ameliorates symptoms caused by a coronavirus infection, or ameliorates symptoms caused by a coronavirus infection;
(A4) Preparing a product for treating and/or preventing a disease caused by the replication of said coronavirus, or treating and/or preventing a disease caused by the replication of said coronavirus.
Herein, a-lactalbumin may be of human or animal or plant origin, or may be a recombinant protein, such as a product of Sigma, cat# L7269.
Alternatively, according to the above-mentioned application, said coronavirus is selected from at least one of HCoV-229E, HCoV-OC43, HCoV-NL63, HCoV-HKU1, SARS-CoV, MERS-CoV and SARS-CoV-2.
Optionally, according to the above application, the disease caused by coronavirus infection is selected from at least one of pneumonia, respiratory tract infection, common cold, severe Acute Respiratory Syndrome (SARS), middle East Respiratory Syndrome (MERS) and 2019 novel coronavirus pneumonia (covd-19).
Optionally, according to the above-mentioned use, the respiratory tract infection is selected from at least one of the acute and chronic phases of upper respiratory tract infection, lower respiratory tract infection, tracheitis and bronchitis.
Alternatively, according to the above-mentioned application, the disease caused by the replication of the coronavirus is a disease caused by the adsorption of the coronavirus into cells, a disease caused by the entry of the coronavirus into cells, and/or a disease caused by the replication of the coronavirus in cells.
Optionally, according to the above application, the product is a pharmaceutical product.
Alternatively, the pharmaceutical product may be a liquid formulation or a solid formulation, depending on the application described above.
The application provides a product, the active ingredient comprises a-lactalbumin; the product has any one of the following uses:
(a1) Inhibition of coronavirus;
(a2) Treating and/or preventing diseases caused by coronavirus infection;
(a3) Improving symptoms caused by coronavirus infection;
(a4) Treating and/or preventing diseases caused by replication of said coronavirus.
Optionally, according to the above product, the product is a pharmaceutical product. The pharmaceutical product may be formulated in various suitable pharmaceutical formulations, for example, in liquid or solid form. For example, a-lactalbumin may be used alone or in combination with pharmaceutical excipients (e.g., excipients, diluents, etc.), and formulated into tablets, capsules, granules, syrups, etc. for oral administration or powder for injection, solutions, etc. for injection.
The embodiment of the application shows that the a-lactalbumin can inhibit the adhesion and the entry of coronaviruses and can also inhibit the replication of coronaviruses after infection. Taking a-lactalbumin as an example, SARS-CoV-2 Luc pseudovirus was used to test for EC at the cellular level 50 0.1635mg/ml, tested simultaneously with SARS-CoV-2 infection replication System (trVLP), which is EC at cellular level 50 = 0.6809mg/ml. SARS-CoV-2 enters cells by spike protein spike to recognize receptor angiotensin converting enzyme ACE2 and other auxiliary receptors, so spike is a key factor in virus replication process, and as a-lactalbumin concentration increases, spike mediated infection entering efficiency decreases, and relative expression amount decreases. Therefore, a-lactalbumin, which is a key factor for spike and viral replication, is applicable to treatment for covd-19.
Drawings
FIG. 1 shows the experimental results of inhibition of adsorption, entry and replication after infection of SARS-CoV-2 pseudovirus and trVLP replicon by a-lactalbumin.
FIG. 2 shows the inhibition ratio of a-lactalbumin to SARS-CoV-2 pseudovirus infection.
FIG. 3 shows the inhibition ratio of a-lactalbumin to SARS-CoV-2 replicon trVLP.
FIG. 4 shows the inhibition of SARS-CoV-2 pseudovirus and trVLP replicon infection by a-lactalbumin as a function of dose.
Detailed Description
The following detailed description of the application is provided in connection with the accompanying drawings that are presented to illustrate the application and not to limit the scope thereof. The examples provided below are intended as guidelines for further modifications by one of ordinary skill in the art and are not to be construed as limiting the application in any way.
The experimental methods in the following examples, unless otherwise specified, are conventional methods, and are carried out according to techniques or conditions described in the literature in the field or according to the product specifications. Materials, reagents and the like used in the examples described below are commercially available unless otherwise specified.
Data were processed using GraphPad 8 statistical software and experimental results were expressed as mean ± standard deviation using asymmetric T-test.
The detection principle of the following embodiment:
the new coronavirus replicon model is characterized in that part of genes of a new coronavirus genome are replaced by expressed green fluorescent protein genes, and the replaced viral genes are stably expressed in a specific cell line, so that the replication of viruses is tested.
The SARS-CoV-2 replicon virus model (trVLP) was used to avoid the risks and complications of the P3 laboratory procedures. the trVLP can be cultured in a common P2 laboratory, can be used as an ideal substitution model for resisting SARS-CoV-2 virus, and a large number of basic experiments can be verified by the SARS-CoV-2 virus after being explored on the virus model.
Experimental materials and instruments:
and (3) cells: vero E6, purchased from ATCC.
Huh7.5, professor Charles M Rice, university of Rockfield, described in Luna JM, scheel TK, danino T, et al Hepatis C virus RNA functionally sequesters miR-122.Cell.2015;160 (6): 1099-1110.Doi:10.1016/j.cell.2015.02.025.
Caco-2-N, professor Ding Jiang, incorporated by reference in Ju X, zhu Y, wang Y, et al A novel cell culture system modeling the SARS-CoV-2 life cycle.PLoS Pathog.2021;17 (3): e1009439.Doi: 10.1371/journ.
The above cells are prepared from high sugar DMEM+10% foetal calf serum at 37deg.C and 5% CO 2 In the incubatorCulturing.
Virus: SARS-CoV-2 Luc pseudovirus, a benefit of the Chinese food and drug institute Wang Youchun researchers. Is described in Nie J, li Q, wu J, et al, identification of SARS-CoV-2 neutralizing antibody by a pseudotyped virus-based assay.Nat Protoc.2020;15 (11): 3699-3715.Doi:10.1038/s41596-020-0394-5.
SARS-CoV-2 GFP pseudovirus is a benefit taught by Xiamen university Xia Ningshao. Described in Xiong HL, wu YT, cao JL, et al Robust neutralization assay based on SARS-CoV-2S-protein-bearing Vesicular Stomatitis Virus (VSV) pseudovirus and ACE2-overexpressing BHK cells Emerg Microbes Infect.2020;9 (1): 2105-2113.Doi:10.1080/22221751.2020.1815589.
trVLP SARS-CoV-2 replicon (hereinafter referred to as trVLP replicon) as taught by university of Qinghai Ding Jiang, described in Ju X, zhu Y, wang Y, et al A novel cell culture system modeling the SARS-CoV-2 life cycle.PLoS Pathog.2021;17 (3): e1009439.Doi: 10.1371/journ.
Sample: a-lactalbumin, purchased from Sigma, cat: l7269, storage condition-20 ℃. The a-lactalbumin is isolated from human milk.
Detection reagent: as shown in table 1.
TABLE 1 sources of reagents
The detection method is specifically as follows.
qRT-PCR (real-time RT-PCR): RNA extraction was performed using an RNAprep pure culture cell/bacterial total RNA extraction kit according to the manufacturer's instructions. Reverse transcription using RevertAid First Strand cDNA Synthesis Kit, the amplification system of qPCR is as follows, primers:
bjmu-00737-SARS-CoV-2 RNA-F：CGAAAGGTAAGATGGAGAGCC，
bjmu-00738-SARS-CoV-2 RNA-R：TGTTGACGTGCCTCTGATAAG，
bjmu-00061-RPS11-F：GCCGAGACTATCTGCACTAC，
bjmu-00062-RPS11-R：ATGTCCAGCCTCAGAACTTC，
1 μl each, 10 μM;
POWRUP SYBR MASTER MIX (2X) 5 μl (vendor: thermo Scientific cat# A25742);
cDNA 3μl；
a total of 10. Mu.l of amplification system.
Amplification procedure for qPCR table 2.
TABLE 2 qPCR amplification procedure
Stage(s) Repeating Temperature (temperature) Time (min)
1 1 50℃ 2:00
95℃ 0:20
2 40 95℃ 0:03
60℃ 0:35
3 (melting) 1 95℃ 0:15
60℃ 0:20
95℃ 0:15
60℃ 0:15
qRT-PCR was performed using Quantum studio 1 Real-Time PCR detection system (Applied biosystems, foster City, calif., USA).
Detection of luciferase expression levels: using Luciferase Cell Culture Lysis Reagent,5X (using ddH 2 Dilution of O to 1X) lysates cells were lysed to obtain cell lysates according to Luciferase AsThe instructions of the manufacturer of the SAY System reagent, 20. Mu.l of cell lysate was mixed with 100. Mu.l of reaction solution, and then added to the corresponding 96-well plate chemiluminescent detection plate, which was placed in a chemiluminescent detector to read the luminescence value.
Example 1, a-lactalbumin inhibition of viral adhesion, entry and replication experiments
In order to investigate the inhibitory effect of a-lactalbumin on various stages of infection of SARS-CoV-2 pseudovirus and trVLP replicon-infected cells, different treatments were performed. Vero E6, huh7.5 and Caco-2-N cells were seeded on 24-well plates or 96-well plates and a-lactalbumin was added at various stages of viral infection to explore the inhibition of a-lactalbumin on viral infection throughout the cycle, cell entry and replication following cell entry.
1) The experimental method is as follows:
Caco-2-N cells were seeded in 24-well plates at 100 000 inoculum size; huh7.5 and Vero E6 cells were seeded in 96-well plates at 20,000 cells, respectively.
(1) Adsorption experiment:
Caco-2-N experimental group: the drug a-lactalbumin and viral trVLP replicon were premixed at 4℃for 1h to obtain a drug virus mixture, while Caco-2-N cells were pre-chilled for 1h, then the drug virus mixture was added to the cells in an amount of 500. Mu.l per well, wherein the trVLP replicon was 0.05MOI, the concentration of a-lactalbumin after addition was 1mg/ml, treated at 4℃for 2h, and PBS washed 3 times.
Caco-2-N negative control group: caco-2-N cells were pre-chilled for 1 hour before trVLP replicons were added to the cells at 0.05MOI per well, 500 μl, treated at 4deg.C for 2 hours, and washed 3 times with PBS.
Caco-2-N positive control group: 1mg/ml of whey protein mixture A17 (described in Fan H, hong B, luo Y, et al effect of whey protein on viral infection and replication of SARS-CoV-2 and pangolin coronavirus in vitro.Signal Transduct Target Ther.2020;5 (1): 275.Published 2020 Nov 24.doi:10.1038/s 41392-020-00408-z) and viral 0.05MOI trVLP replicon were premixed at 4℃for 1 hour to obtain a mixture, while Caco-2-N cells were pre-chilled for 1 hour, and the mixture was then added to the cells in an amount of 500. Mu.l per well, wherein the trVLP replicon was 0.05MOI, the whey protein mixture A17 was 1mg/ml in concentration after the addition, treated 2 hours at 4℃and washed 3 times with PBS.
GFP expression was observed with a fluorescence microscope in the Caco-2-N experimental group, caco-2-N negative control group and Caco-2-N positive control group, and was observed with Luciferase Cell Culture Lysis Reagent,5X (with ddH 2 O diluted to 1X for use) lysate to collect cells (which contain viruses adhering to the cell surface), followed by RNA extraction and qRT-PCR for detection of SARS-CoV-2-RNA.
Vero E6 or huh7.5 experimental group: premixing medicine a-lactalbumin and SARS-CoV-2 Luc pseudovirus at 4deg.C for 1 hr to obtain medicine virus mixture, pre-cooling Vero E6 or Huh7.5 cells for 1 hr, adding medicine virus mixture to the cells in an amount of 100 μl per well, wherein SARS-CoV-2 Luc pseudovirus 650TCID 50 The concentration of the alpha-lactalbumin after the addition is 1mg/ml, the treatment is carried out for 2 hours at 4 ℃, PBS is washed for 3 times, a new high-sugar DMEM culture medium of 10 percent FBS is replaced, and the culture medium is put into an incubator for culturing for 24 hours.
Vero E6 or huh7.5 negative control: vero E6 or huh7.5 cells were pre-chilled for 1 hour before 650TCID 50 The SARS-CoV-2 Luc pseudovirus was added to the cells in an amount of 100. Mu.l per well, treated at 4℃for 2 hours, washed 3 times with PBS, and replaced with a new 10% FBS-rich DMEM medium, and cultured in an incubator for 24 hours.
Vero E6 or huh7.5 positive control group: premixing whey protein mixture A17 and SARS-CoV-2 Luc pseudovirus at 4deg.C for 1 hr to obtain a mixture, pre-cooling Vero E6 or Huh7.5 cells for 1 hr, adding the mixture to the cells at an amount of 100 μl per well, wherein SARS-CoV-2 Luc pseudovirus 650TCID 50 Whey protein mixture A17 was added at a concentration of 1mg/ml, treated at 4℃for 2 hours, washed 3 times with PBS, and replaced with a new 10% FBS-rich DMEM medium, and incubated in an incubator for 24 hours.
Vero E6 or huh7.5 experimental groups, vero E6 or huh7.5 negative control groups and Vero E6 or huh7.5 positive control groups were tested using Luciferase Assay System.
Each group was repeated 3 times.
(2) Cell entry experiment:
Caco-2-N experimental group: the trpVLP replicon was added to Caco-2-N cells at 0.05MOI per well, pretreated at 4℃for 2 hours to achieve consistent adsorption, washed 3 times with PBS, the drug a-lactalbumin was added to the medium in which the cells were cultured and mixed, recombinant protein 1 was 1mg/ml in the medium, then reacted at 37℃for 1 hour (drug blocking in the stage of cell entry), washed 3 times with PBS, and then cultured in a high-sugar DMEM medium without virus and drug and 10% FBS.
Caco-2-N negative control group: the trpVLP replicon was added to Caco-2-N cells at 0.05MOI per well, pretreated at 4℃for 2 hours to achieve consistent adsorption, washed 3 times with PBS, and then cultured in 10% FBS-free high-sugar DMEM medium.
Caco-2-N positive control group: the trplp replicon was added to Caco-2-N cells at 0.05moi per well, pretreated at 4 ℃ for 2h to achieve consistent adsorption, washed 3 times with PBS, the drug whey protein mixture a17 was added to the medium in which the cells were cultured and mixed, whey protein mixture a17 was 1mg/ml in the medium, then reacted at 37 ℃ for 1h (drug blocking in the stage of cell entry), washed 3 times with PBS, and then replaced with virus-free, drug-free, 10% fbs high-sugar DMEM medium for culture.
Caco-2-N experimental group, caco-2-N negative control group and Caco-2-N positive control group were cultured for 48 hours with Luciferase Cell Culture Lysis Reagent,5X (with ddH 2 O diluted to 1X for use) lysate was used to harvest cells (containing virus attached to the cell surface), followed by RNA extraction and qRT-PCR detection, while GFP expression was observed under fluorescent microscopy.
Vero E6 or huh7.5 experimental group: SARS-CoV-2 Luc pseudovirus was added to Vero E6 or Huh7.5 cells, 650TCID 50 And (3) pre-treating at 4 ℃ for 2 hours to achieve consistent adsorption degree, washing 3 times by PBS, adding 1mg/ml of a-lactalbumin to a culture medium for culturing the cells, mixing, reacting at 37 ℃ for 1 hour (blocking the medicine in the stage of entering the cells), washing 3 times by PBS, and then replacing a 10% FBS high-sugar DMEM culture medium without virus and medicine for culturing.
Vero E6 or huh7.5 negative control: SARS-CoV-2 Luc pseudovirus was added to Vero E6 or650TCID on Huh7.5 cells 50 And (3) pre-treating at 4 ℃ for 2 hours to achieve consistent adsorption degree, washing 3 times by PBS, and then culturing by replacing a virus-free 10% FBS high-sugar DMEM medium.
Vero E6 or huh7.5 positive control group: SARS-CoV-2 Luc pseudovirus was added to Vero E6 or Huh7.5 cells, 650TCID 50 The wells were pretreated for 2h at 4℃to achieve consistent adsorption, washed 3 times with PBS, 1mg/ml whey protein mixture A17 was added to the medium in which the cells were cultured and mixed, reacted for 1h at 37℃ (drug blocking at the stage of cell entry), washed 3 times with PBS, and then incubated with virus-free and drug-free high-sugar DMEM medium with 10% FBS.
The test was performed with Luciferase Assay System when Vero E6 or huh7.5 experimental group, vero E6 or huh7.5 negative control group and Vero E6 or huh7.5 positive control group were cultured for 24 hours.
Each group was repeated 3 times.
(3) Post-entry experiments:
Caco-2-N experimental group: viral trVLP replicons were added to Caco-2-N cells at 0.05MOI per well, reacted at 37℃for 1 hour, the virus was fully entered into the cells, washed 3 times with PBS, and then the drug a-lactalbumin was added to the medium in which the cells were cultured and mixed, the concentration of a-lactalbumin in the medium was 1mg/ml, and placed in an incubator for culture at 37 ℃.
Caco-2-N negative control group: viral trVLP replicons were added to Caco-2-N cells at 0.05MOI per well, reacted at 37℃for 1h, and the virus was fully entered into the cells, washed 3 times with PBS, and incubated in an incubator at 37 ℃.
Caco-2-N positive control group: viral trVLP replicons were added to Caco-2-N cells at 0.05MOI per well, reacted at 37℃for 1 hour, the virus was fully entered into the cells, washed 3 times with PBS, and then the drug whey protein mixture A17 was added to the medium in which the cells were cultured and mixed, the concentration of whey protein mixture A17 in the medium was 1mg/ml, and placed in an incubator for culture at 37 ℃.
Caco-2-N experimental group, caco-2-N negative control group and Caco-2-N positive control group were cultured for three periods of 48h, 72h and 96h with Luciferase Cell Culture Lysis Reagent,5X (with ddH) 2 Diluting to1X used), followed by RNA extraction, qRT-PCR detection, and DAPI staining of the nuclei for collection of trplp replicon GFP expression results under fluorescent microscopy.
Vero E6 or huh7.5 experimental group: the SARS-CoV-2 Luc pseudovirus was added to Vero E6 or Huh7.5 cells, 650TCID 50 The cells were then washed 3 times with PBS, and then the drug a-lactalbumin was added to the medium in which the cells were cultured and mixed, the concentration of a-lactalbumin in the medium was 1mg/ml, and then placed in an incubator for culture at 37 ℃.
Vero E6 or huh7.5 negative control: the SARS-CoV-2 Luc pseudovirus was added to Vero E6 or Huh7.5 cells, 650TCID 50 And/or hole, reacting at 37 ℃ for 1h, fully entering the cells, washing 3 times by PBS, and then placing into an incubator for culturing at 37 ℃.
Vero E6 or huh7.5 positive control group: the SARS-CoV-2 Luc pseudovirus was added to Vero E6 or Huh7.5 cells, 650TCID 50 The cells were then washed 3 times with PBS, and then the drug whey protein mixture A17 was added to the medium in which the cells were cultured and mixed, the concentration of whey protein mixture A17 in the medium was 1mg/ml, and then placed in an incubator and cultured at 37 ℃.
Values were detected using Luciferase Assay System for Vero E6 or huh7.5 experimental groups, vero E6 or huh7.5 negative control groups and Vero E6 or huh7.5 positive control groups at 24h incubation.
Each group was repeated 3 times.
The experimental data processing method is as follows.
The relative expression amount calculating method of SARS-CoV-2 RNA comprises the following steps:
Caco-2-N experimental group, caco-2-N negative control group and Caco-2-N positive control group: SARS-CoV-2 and RPS11 (reference) RNA expression levels were detected by qRT-PCR, and the detection result of the negative control group was normalized to 1.
The inhibition rate calculation method comprises the following steps:
vero E6 or huh7.5 experimental group, vero E6 or huh7.5 negative control group and Vero E6 or huh7.5 positive control group: the values obtained by Luciferase Assay System detection are divided by the values of the Vero E6 or Huh7.5 experimental group or the Vero E6 or Huh7.5 positive control group and multiplied by 100%, so that the infection rate of the corresponding treatment group is obtained, and the inhibition rate (%) =100% -infection rate (%) of the corresponding treatment group.
2) Analysis of results
The results are shown in FIG. 1.
FIGS. 1A and 1B show experimental results of a Caco-2-N experimental group, a Caco-2-N negative control group and a Caco-2-N positive control group, wherein a-lactalbumin (1 mg/ml) is the result of the Caco-2-N experimental group, the negative control is the result of the Caco-2-N negative control group, and the positive control is the result of the Caco-2-N positive control group. In the adsorption experiment, specific data are shown in Table 3, and the average value of the relative expression quantity of RNA in the Caco-2-N positive control group is 0.07; the average value of the relative expression amount of the RNA in the Caco-2-N experimental group is 0.05, and the average value of the relative expression amount of the RNA in the Caco-2-N negative control group is 0.98. In the cell-entering experiment, specific data are shown in Table 4, and the average value of the relative expression quantity of RNA of the Caco-2-N positive control group is 0.004; the average value of the relative expression amount of the RNA in the Caco-2-N experimental group is 0.36, and the average value of the relative expression amount of the RNA in the Caco-2-N negative control group is 0.96. In the post-entry experiment, specific data are shown in Table 5, and the average value of the relative expression amounts of RNA in three time periods of 48h, 72h and 96h of the Caco-2-N positive control group is 0.001,0.002,0.0001 in sequence; the average value of the relative expression amounts of RNA in the three time periods of 48h, 72h and 96h of the Caco-2-N experimental group is 0.06,2.68 and 19.23 in sequence, and the average value of the relative expression amounts of RNA in the three time periods of 48h, 72h and 96h of the Caco-2-N negative control group is 0.99,5.36 and 21.62 in sequence.
In the adsorption experiment and the cell entry experiment, compared with the negative control group, the relative expression quantity of the virus SARS-CoV-2 RNA in the experimental group is obviously reduced, and in the post-entry experiment, GFP expression in the experimental group is less than that in the negative control group in three time periods of 48h, 72h and 96h, but GFP is gradually increased, so that the inhibition effect after entry is obvious but not obvious, and especially, the expression quantity of the virus RNA is not obviously different in 96 h. It was demonstrated that a-lactalbumin inhibits adsorption and entry of trVLP SARS-CoV-2 replicon-infected cells, but the inhibition effect after entry was poor.
TABLE 3 adsorption experiment RNA relative expression level
Repeating Caco-2-N positive control group Caco-2-N experimental group Caco-2-N negative control group
1 0.05 0.12 0.84
2 0.08 0.08 1.17
3 0.09 0.02 0.98
TABLE 4 intracellular experimental RNA relative expression levels
Repeating Caco-2-N positive control group Caco-2-N experimental group Caco-2-N negative control group
1 0.005 0.30 1.17
2 0.004 0.31 0.94
3 0.005 0.38 0.88
TABLE 5 post-cytopenia experimental RNA relative expression levels (Caco-2-N cell results)
FIG. 1C shows the results of the Vero E6 or Huh7.5 test group, the Vero E6 or Huh7.5 negative control group and the Vero E6 or Huh7.5 positive control group, wherein, the a-lactalbumin (1 mg/ml) is the result of the Vero E6 or Huh7.5 test group, the negative control (SARS-CoV-2 Luc pseudovirus) is the result of the Vero E6 or Huh7.5 negative control group, the positive control is the result of the Vero E6 or Huh7.5 positive control group, and the experimental result 24h after entry. Specific data of the adsorption experiments are shown in Table 6, wherein the average inhibition rate of the Huh7.5 experimental group is 69.47%, the average inhibition rate of the Vero E6 experimental group is 69.79%, the average inhibition rate of the Huh7.5 negative control group is-3%, the average inhibition rate of the Vero E6 negative control group is 0%, the average inhibition rate of the Huh7.5 positive control group is 96%, and the average inhibition rate of the Vero E6 positive control group is 99%. Specific data of the cell entry test are shown in Table 7, wherein the average inhibition rate of the Huh7.5 test group is 69.52%, the average inhibition rate of the Vero E6 test group is 69.63%, the average inhibition rate of the Huh7.5 negative control group is 0%, the average inhibition rate of the Vero E6 negative control group is 0%, the average inhibition rate of the Huh7.5 positive control group is 100%, and the average inhibition rate of the Vero E6 positive control group is 100%. Specific data of the post-entry experiments are shown in Table 8, wherein the average inhibition rate of the Huh7.5 experimental group is 70.9%, the average inhibition rate of the Vero E6 experimental group is 66.84%, the average inhibition rate of the Huh7.5 negative control group is 0%, the average inhibition rate of the Vero E6 negative control group is 0%, the average inhibition rate of the Huh7.5 positive control group is 99%, and the average inhibition rate of the Vero E6 positive control group is 99%. It is shown that a-lactalbumin can inhibit adsorption and entry of SARS-CoV-2 pseudovirus infected cells.
TABLE 6 adsorption experiment inhibition ratio (%)
TABLE 7 inhibition of cell entry assay (%)
TABLE 8 inhibition of post-entry experiments (%)
EXAMPLE 2 inhibition of SARS-CoV-2 infection by a-lactalbumin
1) Inhibition of infection and replication of SARS-CoV-2 pseudovirus by a-lactalbumin
Vero E6 cells were seeded in 96-well plates with 20000 Vero E6 cells per well, and the cells were infected with SARS-CoV-2 Luc pseudovirus the next day, 650TCID 50 Well (pseudovirus preparation and TCID) 50 Determination, see reference: nie J, li Q, wu J, et al, identification of SARS-CoV-2 neutralizing antibody by a pseudotyped virus-based assay.Nat Protoc.2020;15 (11): 3699-3715.
doi:10.1038/s 41596-020-0394-5) and different concentrations of a-lactalbumin (a-lactalbumin concentration in the system is 2mg/ml, 1mg/ml, 0.5mg/ml, 0.25mg/ml, 0.125mg/ml, 0.0625 mg/ml) were added, respectively, and the negative control was PBS.37 ℃,5% CO 2 The incubator was incubated for 24 hours. The expression level of the fluorescent protease in the cell lysate was measured by Luciferase Assay System, and the inhibition rate was counted. The inhibition rate calculation method comprises the following steps: in the experiment, only equivalent pseudovirus is added, no a-lactalbumin is added, and equivalent PBS is added, and the group is a negative control group; each group was tested using Luciferase Assay System to obtain the number, and the number of the added a-lactalbumin group was divided by the number of the negative control group, and multiplied by 100%, to obtain the infection rate of the corresponding added a-lactalbumin group, and the inhibition rate (%) =100% of the corresponding added a-lactalbumin group. Each group was repeated 3 times.
Vero E6 and huh7.5 cells were individually inoculated into 96-well plates, the amount of cells in each well was 20000, the next day, cells were infected with SARS-CoV-2 GFP pseudovirus, the amount added per well was moi=0.05, and different concentrations of a-lactalbumin (a-lactalbumin concentration in the system was 2mg/ml, 0.25mg/ml, 0 ug/ml) were added, respectively. 37 ℃,5% CO 2 The incubator was incubated for 48 hours. GFP expression was observed using a fluorescence microscope. Each group was repeated 3 times.
2) Inhibition of infectious entry of trVLP by a-lactalbumin
Caco-2-N cells were seeded into 24-well plates, the cells were 100 000 per well, the next day, infected with trVLP virus, and MOI=0.05 per well, and different concentrations of a-lactalbumin (a-milk were added separatelyThe concentration of albumin in the system was 2mg/ml, 0.2mg/ml, 0.02 mg/ml). 37 ℃,5% CO 2 The incubator was incubated for 96 hours. GFP expression was observed using a fluorescence microscope. Each group was repeated 3 times.
Caco-2-N cells were seeded into 6-well plates at 400000 cells per well, and the next day, cells were infected with trVLP virus, MOI=0.05, and different concentrations of a-lactalbumin (a-lactalbumin concentration in the system was 2mg/ml, 0.4mg/ml, 0.08 mg/ml) were added, respectively. 37 ℃,5% CO 2 The incubator was incubated for 96 hours. The negative control was a treatment group with equal amounts of trVLP virus, no a-lactalbumin but equal amounts of PBS.
The expression level of Spike protein was detected by western blot using the following antibodies:
spike primary antibody: SARS-CoV-2/2019-nCoV Spike Antibody, rabbit PAb,40589-T62, sino Biological;
spike secondary antibody: goat anti-Rabbit IgG (H+L) -HRP, BE0101-100, EASYBIO;
action primary antibody: beta Actin Monoclonal antibody,60008-1-Ig, proteintech;
an action secondary antibody: goat anti-Mouse IgG (H+L) -HRP, BE0102-100, EASYBIO.
The amount of viral RNA expression was detected by qRT-PCR.
Each group was repeated 3 times.
3) Results
The results are shown in FIGS. 2 and 3.
FIG. 2A shows the statistical results of inhibition ratios of the SARS-CoV-2 Luc pseudovirus infection by a-lactalbumin, wherein the concentrations of a-lactalbumin in the system are 2mg/ml, 1mg/ml, 0.5mg/ml, 0.25mg/ml, 0.125mg/ml, 0.0625mg/ml, and the average inhibition ratios of the experimental groups are 78.54%, 52.28%, 38.39%, 75.57%, 60.64% and 45.60%, respectively. In FIG. 2, B is the GFP expression condition of alpha-lactalbumin on SARS-CoV-2 GFP pseudovirus infection, and in the experimental group without adding alpha-lactalbumin, it can be seen that GFP is uniformly and obviously expressed, under the action of 0.25mg/ml alpha-lactalbumin, GFP is reduced, and under the action of 2mg/ml alpha-lactalbumin, almost no GFP expression is produced, and the infection of virus is obviously blocked, so that the alpha-lactalbumin has obvious inhibition effect on SARS-CoV-2 Luc pseudovirus and SARS-CoV-2 GFP pseudovirus.
In FIG. 3A is the GFP expression in step 2), under the action of 2mg/ml of a-lactalbumin, GFP expression is hardly generated, the protein concentration is reduced to 0.2mg/ml, GFP expression is obviously increased, and the GFP expression is distributed in a sheet shape; the protein concentration was reduced to 0.02mg/ml and GFP expression was further increased, also in a sheet-like distribution, indicating that cell fusion occurred. B in fig. 3 is step 2) viral nucleic acid RNA relative expression statistics (relative expression=2) -ΔCt (Experimental group RNA expression level)/2 -ΔCt (control RNA expression level)), when the amount of a-lactalbumin used reaches 2mg/ml, the expression level of viral RNA is low, and as the concentration of a-lactalbumin decreases, the expression level of viral RNA increases. In FIG. 3, C is a photograph of electrophoresis in a-lactalbumin step 2) Spike protein (Spike protein) western blot. SARS-CoV-2 enters cells and recognizes the receptor angiotensin converting enzyme ACE2 and other accessory receptors by spike proteins, and is therefore a key factor in the viral replication process. As the concentration of the a-lactalbumin increases, the relative expression amount of spike protein decreases, which shows that the a-lactalbumin also has obvious inhibition effect on SARS-CoV-2 replicon live virus.
EXAMPLE 3 inhibition of SARS-CoV-2 Luc pseudovirus by a-lactalbumin and EC of trVLP 50 And CC 50 Measurement
1) Vero E6 cells and Caco-2-N cells at 2.0X10 4 Density of individual/wells was seeded into 96-well plates (Thermo Fisher) or 1.0X10 5 Density of individual/well was seeded into 24-well plates at 37 ℃,5% co 2 Culturing in an incubator.
2) Inhibition of SARS-CoV-2 Luc pseudovirus by a-lactalbumin EC 50 And CC 50 And (5) measuring.
Vero E6 cells were seeded in 24-well plates, and the next day, the concentration of 2mg/ml, 1mg/ml, 0.5mg/ml, 0.25mg/ml, 0.125mg/ml, 0.0625mg/ml, 0.03125mg/ml and 0.015625mg/ml of a-lactalbumin in the system was added to the cell culture wells, followed by the addition of SARS-CoV-2 Luc,650 TCID, virus 50 /well. After 2 hours, the supernatant was discarded, and washed 3 times with PBS buffer to remove virus particles that did not enter the cells, and then again in the cell culture wellThe concentrations of 2mg/ml, 1mg/ml, 0.5mg/ml, 0.25mg/ml, 0.125mg/ml, 0.0625mg/ml, 0.03125mg/ml and 0.015625mg/ml of a-lactalbumin in the system were added, respectively. The negative control group was Vero E6 cells inoculated into 24-well plates, and the next day, PBS equivalent to a-lactalbumin was added to the cell culture wells, followed by the addition of the virus SARS-CoV-2 Luc,650 TCID 50 /well. After 2 hours, the supernatant was discarded, and washed 3 times with PBS buffer to remove virus particles that did not enter the cells. The intracellular luciferase was quantified and the inhibition was counted 24h after virus infection by the method of Luciferase Assay System. The inhibition rate calculation method comprises the following steps: each group was tested using Luciferase Assay System to obtain the number, and the number of the added a-lactalbumin group was divided by the number of the negative control group, multiplied by 100%, to obtain the infection rate of the corresponding added a-lactalbumin group, inhibition rate (%) =100% -infection rate (%). Cytotoxicity of a-lactalbumin to Vero E6 was measured using CCK8 activity assay.
3) EC of a-lactalbumin-inhibited trVLP replicons 50 And CC 50 Measurement
Caco-2-N cells were seeded in 24-well plates, and next day, a-lactalbumin was added to the cell culture wells at a concentration of 2mg/ml, 1mg/ml, 0.5mg/ml, 0.25mg/ml, 0.125mg/ml, 0.0625mg/ml and 0.03125mg/ml, respectively, in the system, followed by the addition of viral trVLP replicons at a MOI=0.05 per well. After 2 hours, the supernatant was removed and washed 3 times with PBS buffer to remove virus particles not entering cells, and then a-lactalbumin at a concentration of 2mg/ml, 1mg/ml, 0.5mg/ml, 0.25mg/ml, 0.125mg/ml, 0.0625mg/ml and 0.03125mg/ml in the system was added again to the cell culture well. The negative control group was Caco-2-N cells seeded in 24-well plates, and next day, PBS equivalent to a-lactalbumin was added to the cell culture wells, followed by viral trVLP replicons at an moi=0.05 per well. After 2 hours, the supernatant was removed and washed 3 times with PBS buffer to remove virus particles that did not enter the cells. The intracellular viral RNA was quantitatively detected by qRT-PCR 96h after viral infection. The primers used were
bjmu-00737-SARS-CoV-2 RNA-F：CGAAAGGTAAGATGGAGAGCC；
bjmu-00738-SARS-CoV-2 RNA-R：TGTTGACGTGCCTCTGATAAG；
bjmu-00061-RPS11-F：GCCGAGACTATCTGCACTAC；
bjmu-00062-RPS11-R：ATGTCCAGCCTCAGAACTTC。
The inhibition rate calculation method comprises the following steps: (inhibition ratio= [1-2 ] -ΔCt (Experimental group RNA expression level)/2 -Δct (control RNA expression level)]x 100%). Cytotoxicity of a-lactalbumin on Caco-2-N was measured using CCK8 activity assay.
4) Results:
the results are shown in FIG. 4. FIG. 4A shows inhibition of SARS-CoV-2 Luc pseudovirus by a-lactalbumin EC 50 Measurement results, EC 50 The value is 0.1635/mL, the cell activity of the alpha-lactalbumin at the highest experimental concentration of 2mg/mL is still more than 90%, so that the CC cannot be effectively estimated 50 The a-lactalbumin has little toxicity to Vero E6 and is negligible. FIG. 4B shows the EC of a-lactalbumin-inhibited trVLP replicons 50 ，EC 50 The value is 0.6809mg/mL, and the cell activity of the alpha-lactalbumin at the highest experimental concentration of 2mg/mL is still more than 90%, so that the CC cannot be effectively estimated 50 It is shown that a-lactalbumin is very toxic and negligible. The inhibition of SARS-CoV-2 Luc pseudovirus and trVLP replicon by a-lactalbumin increased with increasing concentration, indicating that a-lactalbumin inhibits replication of SARS-CoV-2 pseudovirus and trVLP replicon virus infection in a dose-dependent manner.
The present application is described in detail above. It will be apparent to those skilled in the art that the present application can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the application and without undue experimentation. While the application has been described with respect to specific embodiments, it will be appreciated that the application may be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the application following, in general, the principles of the application and including such departures from the present disclosure as come within known or customary practice within the art to which the application pertains. The application of some of the basic features may be done in accordance with the scope of the claims that follow.

Claims (5)

  1. Use of a-lactalbumin for the manufacture of a product for inhibiting coronavirus infection:
    the coronavirus is SARS-CoV-2;
    the product is a medicine.
  2. Use of a-lactalbumin for the manufacture of a product for the treatment and/or prophylaxis of a disease caused by a coronavirus infection:
    the coronavirus is SARS-CoV-2;
    the product is a medicine.
  3. 3. The use according to claim 2, characterized in that: the disease caused by coronavirus infection is 2019 novel coronavirus pneumonia.
  4. 4. The use according to claim 1, characterized in that: the inhibition of coronavirus infection is inhibition of SARS-CoV-2 adsorption and/or entry into the cell.
  5. 5. Use according to any one of claims 1-4, characterized in that: the medicine is a liquid preparation or a solid preparation.
CN202111168041.8A 2021-09-30 2021-09-30 Use of a-lactalbumin for inhibiting coronaviruses Active CN113827707B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202111168041.8A CN113827707B (en) 2021-09-30 2021-09-30 Use of a-lactalbumin for inhibiting coronaviruses

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202111168041.8A CN113827707B (en) 2021-09-30 2021-09-30 Use of a-lactalbumin for inhibiting coronaviruses

Publications (2)

Publication Number Publication Date
CN113827707A CN113827707A (en) 2021-12-24
CN113827707B true CN113827707B (en) 2023-12-05

Family

ID=78968202

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202111168041.8A Active CN113827707B (en) 2021-09-30 2021-09-30 Use of a-lactalbumin for inhibiting coronaviruses

Country Status (1)

Country Link
CN (1) CN113827707B (en)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2004083524A (en) * 2002-08-28 2004-03-18 Morinaga Milk Ind Co Ltd Antiviral composition
WO2008138348A1 (en) * 2007-05-09 2008-11-20 Nya Hamlet Pharma Ab Preparation of complexed lactalbumin

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB0408752D0 (en) * 2004-04-20 2004-05-26 Hamlet Ltd Therapeutic treatment
FR2900342B1 (en) * 2006-04-27 2010-08-20 Cie Laitiere Europeenne USE OF ALPHA-LACTALBUMIN FOR REGULATION OF GLYCEMIA
EP2094309A2 (en) * 2006-11-17 2009-09-02 Nya Hamlet Pharma AB Alpha-lactalbumin composition

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2004083524A (en) * 2002-08-28 2004-03-18 Morinaga Milk Ind Co Ltd Antiviral composition
WO2008138348A1 (en) * 2007-05-09 2008-11-20 Nya Hamlet Pharma Ab Preparation of complexed lactalbumin

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
Breastfeeding importance and its therapeutic potential against SARS‐CoV‐2;Aline Vasques da Costa等;Physiol Rep;第9卷(第3期);第e14744页 *

Also Published As

Publication number Publication date
CN113827707A (en) 2021-12-24

Similar Documents

Publication Publication Date Title
Hu et al. The in vitro antiviral activity of lactoferrin against common human coronaviruses and SARS-CoV-2 is mediated by targeting the heparan sulfate co-receptor
Condor Capcha et al. Generation of SARS-CoV-2 spike pseudotyped virus for viral entry and neutralization assays: a 1-week protocol
López et al. Replication of the rotavirus genome requires an active ubiquitin-proteasome system
Pivniouk et al. The OM-85 bacterial lysate inhibits SARS-CoV-2 infection of epithelial cells by downregulating SARS-CoV-2 receptor expression
Duan et al. Ergosterol peroxide exhibits antiviral and immunomodulatory abilities against porcine deltacoronavirus (PDCoV) via suppression of NF-κB and p38/MAPK signaling pathways in vitro
CN110101705A (en) The anti-viral uses of BET family protein inhibitor
Xiong et al. STAT3‑regulated long non‑coding RNAs lnc‑7SK and lnc‑IGF2‑AS promote hepatitis C virus replication
Liu et al. Comparative analysis of selected innate immune-related genes following infection of immortal DF-1 cells with highly pathogenic (H5N1) and low pathogenic (H9N2) avian influenza viruses
CN110022889A (en) For improving growth, propagation and the oncolytic of oncolytic RNA virus and the composition and method of immunotherapeutic effects
Xu et al. Detection of viral components in exosomes derived from NDV-infected DF-1 cells and their promoting ability in virus replication
Wudiri et al. Cellular cholesterol facilitates the postentry replication cycle of herpes simplex virus 1
Pisoni et al. Compartmentalization of small ruminant lentivirus between blood and colostrum in infected goats
Peebles et al. Rescue of murine sarcoma virus from a sarcoma-positive leukemia-negative cell line: requirement for replicating leukemia virus
CN113827707B (en) Use of a-lactalbumin for inhibiting coronaviruses
US20230173006A1 (en) Application of traditional chinese medicine composition to preparation of medicine for treating or preventing coronavirus infection
Li et al. Transcriptome profiling reveals differential effect of interleukin-17A upon influenza virus infection in human cells
CN102876675A (en) Peptide nucleic acid for subgroup J avian leukosis viruses and application of peptide nucleic acid
US11274304B2 (en) Protective interfering nucleic acid molecule and virus-like particle, viral vector, or virus particle containing the same as well as pharmaceutical composition containing the protective interfering nucleic acid and its use
CN112336717B (en) Application of yiquincotine in preparation of medicine for preventing and treating porcine reproductive and respiratory syndrome
CN114028539B (en) Application of mucin 1 in inhibiting coronavirus
Hardestam et al. Antiviral effect of human saliva against hantavirus
CN102337250A (en) Infectious bovine rhinotracheitis virus strain and preparation method and application thereof
Chen et al. Delayed protein shut down and cytopathic changes lead to high yields of infectious pancreatic necrosis virus cultured in Asian Grouper cells
CN114246847B (en) Application of chalcone compounds in treatment of coronavirus infection
CN105663123B (en) Application of the compound of the structure containing tebufenpyrad in preparing anti-Ebola virus infection medicine

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant