CN113817837A - Free DNA sequence from Echinococcus granulosus and application thereof - Google Patents
Free DNA sequence from Echinococcus granulosus and application thereof Download PDFInfo
- Publication number
- CN113817837A CN113817837A CN202010559041.XA CN202010559041A CN113817837A CN 113817837 A CN113817837 A CN 113817837A CN 202010559041 A CN202010559041 A CN 202010559041A CN 113817837 A CN113817837 A CN 113817837A
- Authority
- CN
- China
- Prior art keywords
- free dna
- echinococcosis
- sequence
- echinococcus granulosus
- dna sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 108091028043 Nucleic acid sequence Proteins 0.000 title claims abstract description 67
- 201000003808 Cystic echinococcosis Diseases 0.000 title claims abstract description 49
- 241000244170 Echinococcus granulosus Species 0.000 title claims abstract description 35
- 208000009366 Echinococcosis Diseases 0.000 claims abstract description 55
- 238000001514 detection method Methods 0.000 claims abstract description 47
- 238000000034 method Methods 0.000 claims abstract description 45
- 206010014096 Echinococciasis Diseases 0.000 claims abstract description 43
- 238000003753 real-time PCR Methods 0.000 claims abstract description 26
- 230000035945 sensitivity Effects 0.000 claims abstract description 23
- 238000012216 screening Methods 0.000 claims abstract description 22
- 238000003745 diagnosis Methods 0.000 claims abstract description 20
- 210000004369 blood Anatomy 0.000 claims abstract description 15
- 239000008280 blood Substances 0.000 claims abstract description 15
- 238000003766 bioinformatics method Methods 0.000 claims abstract description 8
- 238000005516 engineering process Methods 0.000 claims abstract description 8
- 239000003814 drug Substances 0.000 claims abstract description 4
- 229940079593 drug Drugs 0.000 claims abstract description 3
- 238000002360 preparation method Methods 0.000 claims abstract 2
- 108020004414 DNA Proteins 0.000 claims description 46
- 238000012163 sequencing technique Methods 0.000 claims description 18
- 239000013642 negative control Substances 0.000 claims description 12
- 239000013641 positive control Substances 0.000 claims description 12
- 241000238631 Hexapoda Species 0.000 claims description 4
- 238000001962 electrophoresis Methods 0.000 claims description 3
- 238000001914 filtration Methods 0.000 claims description 3
- 238000004925 denaturation Methods 0.000 claims description 2
- 230000036425 denaturation Effects 0.000 claims description 2
- 239000012154 double-distilled water Substances 0.000 claims description 2
- 238000012257 pre-denaturation Methods 0.000 claims description 2
- 238000011144 upstream manufacturing Methods 0.000 claims description 2
- 210000002381 plasma Anatomy 0.000 description 12
- 239000000523 sample Substances 0.000 description 11
- 108020004707 nucleic acids Proteins 0.000 description 9
- 150000007523 nucleic acids Chemical class 0.000 description 9
- 102000039446 nucleic acids Human genes 0.000 description 9
- 230000003321 amplification Effects 0.000 description 6
- 238000003199 nucleic acid amplification method Methods 0.000 description 6
- 238000011161 development Methods 0.000 description 5
- 244000045947 parasite Species 0.000 description 5
- 238000003752 polymerase chain reaction Methods 0.000 description 5
- 238000012795 verification Methods 0.000 description 5
- 208000030852 Parasitic disease Diseases 0.000 description 4
- 208000037265 diseases, disorders, signs and symptoms Diseases 0.000 description 4
- 241000244160 Echinococcus Species 0.000 description 3
- 230000001900 immune effect Effects 0.000 description 3
- 230000008569 process Effects 0.000 description 3
- 238000011160 research Methods 0.000 description 3
- 238000007397 LAMP assay Methods 0.000 description 2
- 210000000683 abdominal cavity Anatomy 0.000 description 2
- 239000000427 antigen Substances 0.000 description 2
- 108091007433 antigens Proteins 0.000 description 2
- 102000036639 antigens Human genes 0.000 description 2
- 210000001124 body fluid Anatomy 0.000 description 2
- 239000010839 body fluid Substances 0.000 description 2
- 238000010276 construction Methods 0.000 description 2
- 201000010099 disease Diseases 0.000 description 2
- 230000000694 effects Effects 0.000 description 2
- 239000012634 fragment Substances 0.000 description 2
- 230000036541 health Effects 0.000 description 2
- 238000003384 imaging method Methods 0.000 description 2
- 238000010827 pathological analysis Methods 0.000 description 2
- 230000002265 prevention Effects 0.000 description 2
- 238000001356 surgical procedure Methods 0.000 description 2
- 241000242722 Cestoda Species 0.000 description 1
- 206010011732 Cyst Diseases 0.000 description 1
- 238000007400 DNA extraction Methods 0.000 description 1
- 238000002965 ELISA Methods 0.000 description 1
- 206010019646 Hepatic cyst Diseases 0.000 description 1
- 241001465754 Metazoa Species 0.000 description 1
- 238000012408 PCR amplification Methods 0.000 description 1
- 241000224016 Plasmodium Species 0.000 description 1
- 108091081062 Repeated sequence (DNA) Proteins 0.000 description 1
- 241000242678 Schistosoma Species 0.000 description 1
- 241001414987 Strepsiptera Species 0.000 description 1
- 241000223996 Toxoplasma Species 0.000 description 1
- 241000869417 Trematodes Species 0.000 description 1
- 241000223104 Trypanosoma Species 0.000 description 1
- 230000003187 abdominal effect Effects 0.000 description 1
- 230000002159 abnormal effect Effects 0.000 description 1
- 238000004458 analytical method Methods 0.000 description 1
- 230000009286 beneficial effect Effects 0.000 description 1
- 239000002775 capsule Substances 0.000 description 1
- 239000003153 chemical reaction reagent Substances 0.000 description 1
- 230000000052 comparative effect Effects 0.000 description 1
- 208000031513 cyst Diseases 0.000 description 1
- 210000002726 cyst fluid Anatomy 0.000 description 1
- 238000013461 design Methods 0.000 description 1
- 230000006806 disease prevention Effects 0.000 description 1
- 238000011841 epidemiological investigation Methods 0.000 description 1
- 238000002474 experimental method Methods 0.000 description 1
- 201000011066 hemangioma Diseases 0.000 description 1
- 230000002440 hepatic effect Effects 0.000 description 1
- 201000007270 liver cancer Diseases 0.000 description 1
- 208000014018 liver neoplasm Diseases 0.000 description 1
- 239000003550 marker Substances 0.000 description 1
- 230000035800 maturation Effects 0.000 description 1
- 238000002156 mixing Methods 0.000 description 1
- 238000012986 modification Methods 0.000 description 1
- 230000004048 modification Effects 0.000 description 1
- 238000007857 nested PCR Methods 0.000 description 1
- 239000013610 patient sample Substances 0.000 description 1
- 108090000623 proteins and genes Proteins 0.000 description 1
- 210000003296 saliva Anatomy 0.000 description 1
- 238000011896 sensitive detection Methods 0.000 description 1
- 210000002966 serum Anatomy 0.000 description 1
- 239000002689 soil Substances 0.000 description 1
- 241000894007 species Species 0.000 description 1
- 238000011895 specific detection Methods 0.000 description 1
- 238000012360 testing method Methods 0.000 description 1
- 208000037972 tropical disease Diseases 0.000 description 1
- 210000002700 urine Anatomy 0.000 description 1
- 206010048282 zoonosis Diseases 0.000 description 1
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
-
- G—PHYSICS
- G16—INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
- G16B—BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
- G16B30/00—ICT specially adapted for sequence analysis involving nucleotides or amino acids
- G16B30/10—Sequence alignment; Homology search
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Physics & Mathematics (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- General Health & Medical Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- General Engineering & Computer Science (AREA)
- Immunology (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Computational Biology (AREA)
- Evolutionary Biology (AREA)
- Medical Informatics (AREA)
- Spectroscopy & Molecular Physics (AREA)
- Theoretical Computer Science (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a free DNA sequence derived from Echinococcus granulosus, which is 101 bases in length and has a sequence shown in SEQ ID NO. 3. In addition, the invention also discloses a screening method of the free DNA sequence derived from the Echinococcus granulosus, which comprises the following steps: firstly, obtaining a large number of free DNA sequences from a blood sample of a cystic echinococcosis patient by a resequencing technology; secondly, analyzing, comparing and screening out free DNA sequences derived from echinococcus granulosus from the echinococcus granulosus by a bioinformatics method; and thirdly, verifying the echinococcosis patients and healthy people by a fluorescent quantitative PCR method and screening to obtain the echinococcosis drug. In addition, the invention also discloses the application of the free DNA sequence in the preparation of echinococcosis diagnosis and detection products. The detection result shows that the free DNA sequence has higher sensitivity and specificity in the detection of echinococcosis patients, and has good application prospect in the field of echinococcosis diagnosis and detection.
Description
Technical Field
The invention belongs to the field of biotechnology and medicine, and particularly relates to a free DNA sequence derived from Echinococcus granulosus; in addition, the invention also relates to the application of the free DNA sequence in preparing echinococcosis (or echinococcosis) detection and diagnosis products. The invention is funded by national science foundation (81601792, 81772224, 81772225 and 81501771) and the open topic of national health committee echinococcosis prevention and treatment research focus laboratory (2020WZK 2008).
Background
Echinococcus spp (Echinococcus spp.) is a parasitic disease of zoonosis which seriously affects human health and animal husbandry development and is a parasitic disease mainly prevented and treated in China. Wherein echinococcosis caused by Echinococcus granulosus (Echinococcus grandis) is cystic echinococcosis, accounting for 98% of total echinococcosis. China is the country with the most serious echinococcosis epidemic, 370 echinococcosis epidemic counties in China, the area of an epidemic region accounts for more than 40% of the area of the national soil, the number of sick people exceeds 16 ten thousand, the number of threatened population is nearly 6000 thousand, the echinococcosis disease burden accounts for 40% of the global disease burden, and the echinococcosis disease burden is the highest in the world.
At present, the diagnosis of echinococcosis patients adopts an ultrasonic examination method, and serum immunology auxiliary diagnosis is carried out on suspected cases by taking the characteristic image of echinococcosis and epidemiological investigation as main diagnosis bases.
Ultrasonic examination is a noninvasive examination method, which is the first choice for screening and diagnosing the echinococcosis at present, but still has some problems, such as the abdominal ultrasonic examination adopted in the actual examination can only examine the abdominal cavity, and can not find the focus outside the abdominal cavity, the requirements on the technical level and the clinical experience of operators in the examination process are high, the examination process is easily confused with hepatic cyst, hepatic hemangioma, liver cancer and the like, and the diagnosis cannot be performed on the small capsule which lacks a characteristic image structure within 2cm, so that the missed diagnosis or the misdiagnosis is caused. When the echinococcosis image is atypical, immunological detection is used as an auxiliary diagnosis method. At present, most of antigens used for immunological detection are crude antigens, are derived from cyst fluid, metacercaria, cyst wall and other polypide components, are generally high in sensitivity but insufficient in specificity, and often have cross reaction with other tapeworms and trematodes, so that the immunological detection result is generally high in false positive.
Therefore, the development of a sensitive and specific detection method is urgently needed in the field of echinococcosis detection and diagnosis. Molecular biology methods based on specific nucleic acid markers have been proven to be sensitive, specific, and efficient detection methods in various diseases, and have also been explored in the field of echinococcosis detection and diagnosis, and detection and diagnosis are performed by methods such as Polymerase Chain Reaction (PCR), nested PCR, fluorescent PCR, loop-mediated isothermal amplification (LAMP), and the like.
The key point of the molecular biology method is that a nucleic acid marker with high enough sensitivity and specificity is obtained through screening and is used as a detection target, free DNA (cell-free DNA) is DNA molecules in an extracellular free state existing in body fluids such as blood, urine, saliva and the like, free DNA of a parasite source is possibly generated by the fact that DNA molecules secreted or released by a parasite body in the processes of growth, development, maturation, disintegration and the like enter the body fluid circulation of a host, and the free DNA of the parasite source is proved to be a nucleic acid target capable of being used for detecting or diagnosing the parasitic diseases in parasite researches such as plasmodium, toxoplasma, schistosoma, trypanosoma and the like.
No document discloses the application of the Echinococcus granulosus free DNA sequence as echinococcosis (or echinococcosis) detection and diagnosis.
Disclosure of Invention
One of the technical problems to be solved by the present invention is to provide a free DNA sequence derived from Echinococcus granulosus.
The second technical problem to be solved by the invention is the screening method of the free DNA sequence.
The third technical problem to be solved by the present invention is the application of the above-mentioned free DNA sequence.
The method adopts a large-flux genomics sequencing combined with bioinformatics analysis to screen and obtain the free DNA sequence from the Echinococcus granulosus, preliminarily identifies the DNA sequence to have higher sensitivity and specificity through a fluorescence quantitative PCR method, and can be applied to echinococcosis detection and diagnosis.
The technical scheme adopted by the invention for solving the technical problems is as follows:
in one aspect of the present invention, there is provided a free DNA sequence derived from Echinococcus granulosus, which is 101 bases in length and has the sequence shown in SEQ ID NO. 3:
GCAAGATCTTCACGAGCCTCAGAGAATTCACCTTCTTCCATGCCTTCACCGACGTACCAATGAACGAATGCACGCTTGCCGTACATAAGATCAAACTTGTG
as a preferred technical scheme of the invention, the free DNA sequence is obtained by screening the plasma free DNA of the cystic hydatid patient after being verified in the patient and the healthy person by a fluorescent quantitative PCR method through a genome re-sequencing technology and a bioinformatics analysis method.
In a second aspect of the present invention, there is also provided a method for screening the above-mentioned isolated DNA sequence derived from Echinococcus granulosus, comprising the steps of:
firstly, obtaining a large number of free DNA sequences from a blood sample of a cystic echinococcosis patient by a resequencing technology;
secondly, analyzing, comparing and screening out free DNA sequences derived from echinococcus granulosus from the echinococcus granulosus by a bioinformatics method;
and thirdly, verifying the echinococcosis patients and healthy people by a fluorescent quantitative PCR method and screening to obtain the echinococcosis drug.
As a preferred technical solution of the present invention, the first step specifically comprises the following steps:
(1) extracting free DNA of fresh plasma of an echinococcosis patient by using a kit;
(2) constructing a library of DNA samples qualified by electrophoresis detection;
(3) and performing double-end sequencing after the library is qualified.
As a preferred technical scheme of the invention, the second step specifically comprises the following steps:
(1) firstly, performing data filtration by using preprocessing software Trimmomatic to remove low-quality data and obtain clean sequencing data;
(2) the data were then aligned to the reference genome: comparing the clean sequencing data sequence with echinococcus granulosus reference genome information, extracting a sequence on the comparison, comparing with a human reference genome, removing the sequence of the compared human genome, and comparing with the echinococcus granulosus reference genome to obtain a free DNA sequence derived from the echinococcus granulosus;
(3) and (3) comparing free DNA sequences in the data obtained in the step (2) of 6 samples of different cystic echinococcosis patients, and extracting the free DNA sequences which exist in the 6 samples of the patients and have higher abundance to obtain candidate free DNA sequences.
As a preferred technical solution of the present invention, the third step specifically includes the steps of: and (3) taking samples of the hydatid patient and the healthy person as positive and negative controls, and verifying the sensitivity and the specificity of the insect source free DNA sequence obtained by the second step one by a fluorescent quantitative PCR method to screen out a section of free DNA sequence with the optimal sensitivity and specificity.
As a preferred technical scheme of the invention, in the third step, the PCR primer sequence adopted by the fluorescent quantitative PCR method aiming at the sequence shown in SEQ ID NO.3 is as follows:
f: GCAAGATCTTCACGAGCCTC, as shown in SEQ ID NO. 21;
r: CACAAGTTTGATCTTATGTACGGCA, as shown in SEQ ID NO. 22.
As a preferred technical solution of the present invention, in the third step, the reaction conditions of the fluorescence quantitative PCR method are: pre-denaturation at 95 ℃ for 10min, denaturation at 95 ℃ for 15sec, and 40 cycles; 60 ℃ anneal for 30sec, 40 cycles.
As a preferred technical solution of the present invention, in the third step, the reaction system of the fluorescence quantitative PCR method comprises: 2X fluorescent quantitation kit (Roche) FastStart Universal SYBR Green Master (ROX) 5. mu.l; ddH2O 3.4. mu.l; upstream primer 0.3 μ l; 0.3 mul of downstream primer; DNA template 1. mu.l.
In another aspect of the invention, the application of the free DNA sequence derived from the Echinococcus granulosus in preparing diagnosis and detection products for echinococcosis is provided. The diagnosis and detection products comprise various common products in the field of biological detection, such as gene chips, kits, nucleic acid detection reagents and the like.
Compared with the prior art, the invention has the following beneficial effects:
1. the kit has high sensitivity and specificity, and is high in specificity and sensitivity based on specific free DNA of a parasitic insect source as a detection target, and is verified by blood samples of a patient with the hydatid disease and a healthy person;
2. the method has good repeatability, the reaction system and the reaction conditions are stable, and the detection repeatability of the positive sample is good;
3. the efficiency is high, the time from taking a sample to be detected to extracting free DNA to completing fluorescent quantitative PCR detection to obtain a result is only about 2 hours, nearly hundreds of samples can be detected at one time, and large-flux detection is realized.
The screening of the free DNA is based on a genomic re-sequencing technology, so that the quantity of the candidate free DNA sequences obtained by screening is very large (more than 200 candidate sequences with high abundance are verified, 63 sequences are verified, and the verification results of 20 sequences are listed in the application). The verification of sensitivity and specificity needs sequence-by-sequence verification by a fluorescent quantitative PCR method, a specificity detection primer is designed according to the characteristics of each candidate free DNA sequence, the candidate free DNA sequence is short, the GC content is different, a large number of repeated sequences are possibly contained, and the primer design needs to be searched and optimized for multiple times to ensure the detection sensitivity. And (3) aiming at each candidate sequence, 16 samples of negative and positive controls are adopted for verification and are parallelly detected for 2 times, the overall workload is very large, and the sequence shown by SEQ ID NO.3 with high sensitivity and specificity is finally obtained by screening.
The invention discloses a free DNA sequence derived from Echinococcus granulosus, which is used as a detection target and verified in plasma samples of echinococcosis patients and healthy people by a fluorescent quantitative PCR method, and the detection result shows that the free DNA sequence has higher sensitivity and specificity in the detection of the echinococcosis patients, can be applied to the development of diagnosis or detection kits based on nucleic acid detection and the like, and has good application prospect in the field of echinococcosis diagnosis and detection.
Detailed Description
The following examples are intended to illustrate the invention only and are not intended to limit the scope of the invention. The experimental procedures, in which specific conditions are not specified in the examples, are generally carried out under conventional conditions or conditions recommended by the manufacturers.
According to the method, a large number of free DNA sequences are obtained from a cystic echinococcosis patient blood sample through a re-sequencing technology, insect-derived free DNA sequences derived from echinococcus granulosus are screened out from the sample through bioinformatics method analysis and comparison, the sensitivity and specificity of the insect-derived free DNA sequences are verified one by one through a fluorescence quantitative PCR method by taking the echinococcosis patient blood sample and a healthy human blood sample as positive and negative controls, and a free DNA sequence with optimal sensitivity and specificity is screened out, wherein the specific implementation mode is as follows:
example 1 obtaining of Echinococcus granulosus-derived free DNA sequence
1.1 sources of resequencing plasma samples
Fresh plasma of 6 cystic echinococcosis patients was diagnosed, the echinococcosis patients were diagnosed by clinical imaging and were all in accordance with the indication of the operation, blood samples were collected before the operation, and the cystic echinococcosis patients were diagnosed by pathological diagnosis after the operation.
1.2 Re-sequencing
1.2.1 plasma sample free DNA extraction
The fresh plasma free DNA of the echinococcosis patients was extracted using QIAamp Circulating Nucleic Acid Kit (QIAGEN). And building a library after the electrophoresis detection is qualified.
1.2.2 library construction
Randomly breaking a qualified DNA Sample into a 350bp fragment by using a Covaris ultrasonic nucleic acid cutting instrument, constructing a library by using a TruSeq DNA LT Sample Prep Kit, repairing the tail end of the DNA fragment, adding poly A tail, adding a sequencing joint, purifying, performing PCR amplification and the like, and finally completing library construction.
1.2.3 sequencing
And (4) entrusting Shanghai Europe and Yi biomedicine science and technology limited company to perform double-end sequencing by using a sequencer after the library is qualified.
1.3 bioinformatics analysis
After the sequencing data is downloaded, data filtration is carried out by using preprocessing software Trimmomatic, low-quality data is removed, clean sequencing data is obtained, and then the data is compared with a reference genome. Mixing DNA of two species including human and Echinococcus granulosus in sample plasma free DNA, firstly comparing a clean sequencing data sequence with reference genome information of the Echinococcus granulosus, extracting a sequence on the comparison, comparing with the reference genome, removing the sequence compared with the human genome, and then comparing with the reference genome of the Echinococcus granulosus to obtain the free DNA sequence derived from the Echinococcus granulosus. 6 groups of entomogenous free DNA sequence data are obtained from 6 human samples of cystic echinococcosis patients, the free DNA sequences in the 6 groups of data are compared, and the free DNA sequences which exist in the 6 groups of data and have higher abundance are extracted to obtain candidate free DNA sequences. Because of the huge information on candidate sequences obtained, only some sequences are listed here, see table 1:
TABLE 1
Example 2 verification of sensitivity and specificity of free DNA sequences
2.1 Standard blood samples as positive and negative controls
8 portions of blood plasma of cystic echinococcosis patients, which are diagnosed by clinical imaging and accord with the surgical indication, blood samples are collected before surgery, and the cystic echinococcosis patients are diagnosed by pathological diagnosis after surgery, wherein the 8 portions of blood plasma are extracted by QIAamp Circulating Nucleic Acid Kit of QIAGEN company to be used as positive control;
8 parts of healthy human plasma, which is from the same echinococcosis epidemic area as the echinococcosis patient, has no abnormal index by physical examination, is negative by parasite ELISA detection, and 8 parts of plasma adopts QIAamp Circulating Nucleic Acid Kit of QIAGEN company to extract free DNA as negative control.
2.2 fluorescent quantitative PCR detection
The positive control and the negative control were used as templates, the candidate free DNA sequences described in 1.3 of example 1 (see Table 1) were used as detection targets, specific primers were designed based on the sequences, and detection was performed one by the fluorescent quantitative PCR method.
The Roche fluorescence quantitative PCR detection kit comprises: FastStart Universal SYBR Green Master (ROX);
fluorescent quantitative PCR reaction system:
fluorescent quantitative PCR reaction conditions:
95℃ 0min
at 95 ℃ for 15s 40 cycles
60 ℃ 30s 40 cycle
2.2.1 test results
Tables 2-3 show the free DNA sequences with the sequence numbers SEQ ID NO.1-SEQ ID NO.20 described in 1.3 of example 1, P1-P8 are positive controls 1-8, N1-N8 are negative controls 1-8, the result of the fluorescent quantitative PCR is Ct value, which shows negative underwrited and positive values, each free DNA sequence is detected twice in parallel, both the two results are negative and considered as negative amplification, both the two results are positive and considered as positive amplification, one positive and one negative in the positive control and one positive and one negative in the negative control are considered as positive amplification. The results of the fluorescent quantitative PCR are shown in the following tables 2 to 3, and only the results of the partial sequences are shown due to the large number of the samples:
TABLE 2
TABLE 3
The free DNA sequence described in 1.3 of example 1 is used as a detection target, and the blood samples of a patient with hydatid disease and a healthy person are used as positive and negative controls, so that the effective detection result is that the amplification is positive in the positive control and negative in the negative control. As can be seen from the results in tables 2 to 3 above, the detection results using the free DNA sequence numbered 3 (i.e., SEQ ID NO.3) as the detection target are effective and the effect is optimal, and 5 positive parts and 3 negative parts are amplified in 8 positive control patient samples; in 8 negative control healthy human blood samples, amplification is positive by 1 part, and amplification is negative by 7 parts. It can be seen that the inventors unexpectedly screened the free DNA sequence shown in SEQ ID NO.3 for the best detection among a large number of candidate free DNA sequences. The PCR primer sequence adopted by the fluorescent quantitative PCR method aiming at the sequence shown in SEQ ID NO.3 is as follows: f: GCAAGATCTTCACGAGCCTC, as shown in SEQ ID NO. 21; r: CACAAGTTTGATCTTATGTACGGCA, as shown in SEQ ID NO. 22.
2.2.2 sensitivity and specificity
The susceptibility is the number of true positive patients/the number of patients' blood samples x 100%
Specificity ═ number of true negative patients/number of healthy human blood samples × 100%
Table 4 shows comparative data on the sensitivity and specificity of the free DNA sequences numbered 1 to 20 (i.e.SEQ ID NO.1 to SEQ ID NO. 20).
TABLE 4
The results in Table 4 above show that the Echinococcus granulosus-derived free DNA sequence of accession No.3 has higher sensitivity and specificity in detecting and diagnosing echinococcosis as a detection target than other accession No. sequences, and from the results in Table 4, five sequences with 100% specificity are numbered 1, 9, 10, 11 and 18; in these five sequences, the sensitivity was 0% for numbers 9 and 11, 25.0% for numbers 1 and 18, and 37.5% for number 10. Two sequences with 100% sensitivity, numbered 4 and 6, respectively, but 25.0% and 12.5% specificity, respectively, were present. In conclusion, the sensitivity of the No.3 is 62.5%, the specificity is 87.5%, and the sequence is higher than other sequences, so that an unexpected technical effect is achieved, and therefore, the No.3 free DNA sequence derived from the Echinococcus granulosus has development and application potentials in the field of echinococcosis diagnosis and detection.
In summary, the above embodiments are merely preferred embodiments of the present invention, and are not intended to limit the scope of the present invention, and any modifications, equivalents, improvements, etc. made within the spirit and principle of the present invention should be included in the scope of the present invention.
Sequence listing
<110> Chinese disease prevention and control center for prevention and control of parasitic diseases institute (national center for research on tropical diseases)
<120> a free DNA sequence derived from Echinococcus granulosus and application thereof
<130> WH-NP-20-100685
<160> 22
<170> PatentIn version 3.5
<210> 1
<211> 131
<212> DNA
<213> Artificial sequence (unknown)
<400> 1
gatggatgga tggatggatg gatggatgga tggatggatg gatggatgga tggatggatg 60
gatggatgga tggatggatg gatggatgga tggatggatg gatggatgga tggatggatg 120
gatggatagg n 131
<210> 2
<211> 114
<212> DNA
<213> Artificial sequence (unknown)
<400> 2
aatgaacggg cagcaatatt tcaaatctgt ctgaaaacaa ggagaacgaa aatgacctaa 60
cttttaaggc atactttttg atgaatgaga tcacactaag tagtctccac ttga 114
<210> 3
<211> 101
<212> DNA
<213> Artificial sequence (unknown)
<400> 3
gcaagatctt cacgagcctc agagaattca ccttcttcca tgccttcacc gacgtaccaa 60
tgaacgaatg cacgcttgcc gtacataaga tcaaacttgt g 101
<210> 4
<211> 142
<212> DNA
<213> Artificial sequence (unknown)
<400> 4
tttcacgcac tctttactct ctcttcagag tacttttcaa ctttccctca cggtacttgt 60
ccgctatcgg actcgtgcct gtatttagcc ttggatggag tttaccaccc actttgggct 120
gcaatctcaa acaacccgac tc 142
<210> 5
<211> 106
<212> DNA
<213> Artificial sequence (unknown)
<400> 5
ggaggaggta gtggtggtgg tggtggttga aaggcgtttg gatagaggca cgtctcaatg 60
gaagacgatc gaccactgga aaagtagtgc tccaacccag ctgctg 106
<210> 6
<211> 147
<212> DNA
<213> Artificial sequence (unknown)
<400> 6
aatttccgca tcaagcaatt tgtcaagcga tttaaatttt ggtctagatg tctttggctc 60
ataaatggac gtacattccc gctagaaaca ctgaaaagcc gacaataata tttaaattaa 120
tattggggaa cacaagtctg atttatt 147
<210> 7
<211> 126
<212> DNA
<213> Artificial sequence (unknown)
<400> 7
aaggcatgaa accgcatagc ctaggcagga accctcccca caaattgcga ttatttatga 60
tgcatactga tcgtgtgcct cggtgcagag actgaattaa cgattcttag gcatagtgcg 120
tggtcg 126
<210> 8
<211> 136
<212> DNA
<213> Artificial sequence (unknown)
<400> 8
agaggtggga gggtaaggag atgtaatagg aactaggtct gacattcccc acccatgccc 60
atatctcaat tggtaaaggt agtcagccga accggaaacg gaagcaaccg cttctggctg 120
gaggttttca attctt 136
<210> 9
<211> 130
<212> DNA
<213> Artificial sequence (unknown)
<400> 9
ggccgcctca aacaccaatt ccagcatgta accttgagac ctaaaatcaa ctctactcaa 60
ggtagaaagt agaagtaact cttagctcct ctattttagg cggacaaagg cacagaaacc 120
gtccagtccc 130
<210> 10
<211> 129
<212> DNA
<213> Artificial sequence (unknown)
<400> 10
gagcctttac tgctgcccat tagatctcat gaatcacagt gggaacatcc taactggttt 60
aagctcacga taaagacaga acaatgaact aagcgtcgca acaatcccca tggatgatcg 120
gatttgcta 129
<210> 11
<211> 82
<212> DNA
<213> Artificial sequence (unknown)
<400> 11
cacagacaaa cacagacaaa acttgcagtc agatggccaa ggagcttaag ttcaacgtct 60
gctaattgtt tgcgaaatgc ac 82
<210> 12
<211> 112
<212> DNA
<213> Artificial sequence (unknown)
<400> 12
agcagagctt ctccttaatg tcacgcacta tttcgcgctc agcagtggtg gtgaacgagt 60
aacctcgctc agtcaagatc ttcatgaggt agtcagtcag atcacgacca gc 112
<210> 13
<211> 101
<212> DNA
<213> Artificial sequence (unknown)
<400> 13
tgactaattg accaatcaga gcgagaagga cttggcggaa ggtctaacga tgcaatgttc 60
ggagagagaa gctcgtagaa acactcatca gtctatcggt a 101
<210> 14
<211> 96
<212> DNA
<213> Artificial sequence (unknown)
<400> 14
aaaatcgccg ctatggtgac aagctctggc gtcacacaca cacgtccagt tggttagcca 60
gccagttagc tagccagcta gatatggagg gtgcca 96
<210> 15
<211> 102
<212> DNA
<213> Artificial sequence (unknown)
<400> 15
ttaatgatgt ctacagaatc gacaaagagt gaaagtcagg atagtaactg tgattaatct 60
ctaaattagt ttaaaggaga agatatcaac taatgagata aa 102
<210> 16
<211> 107
<212> DNA
<213> Artificial sequence (unknown)
<400> 16
cgcctccgcg tttgccctcc aattccgctg cccaggttac agagtggccg agcctaacgg 60
acgccgacgc cgattcagac gaggcacagc atcggcgccg ctgcgaa 107
<210> 17
<211> 96
<212> DNA
<213> Artificial sequence (unknown)
<400> 17
aacgaggaat tcctagtaag tgcaggtcat aagcttgcgc tgattacgtc cctgcccttt 60
gtacacaccg cccgtcgcta ctaccgattg aatggt 96
<210> 18
<211> 142
<212> DNA
<213> Artificial sequence (unknown)
<400> 18
gagtcgggtt gtttgagatt gcagcccaaa gtgggtggta aactccatcc aaggctaaat 60
acaggcacga gtccgatagc ggacaagtac cgtgagggaa agttgaaaag tactctgaag 120
agagagtaaa gagtgcgtga aa 142
<210> 19
<211> 112
<212> DNA
<213> Artificial sequence (unknown)
<400> 19
ctaaagctaa atattggccg gagaccgata gcacacaagt agagtgatcg aaagatgaaa 60
agcactttga aaagagagtt aaacagcacg tgaaattgtt gaaagggaag cg 112
<210> 20
<211> 132
<212> DNA
<213> Artificial sequence (unknown)
<400> 20
tgttgggacc cgaaagatgg tgaactatgc ctgaataggg tgaagccaga ggaaactctg 60
gtggaggctc gcagcggttc tgacgtgcaa atcgatcgtc aaatttgggt ataggggcga 120
aagactaatc ga 132
<210> 21
<211> 20
<212> DNA
<213> Artificial sequence (unknown)
<220>
<221> misc_feature
<223> primer
<400> 21
gcaagatctt cacgagcctc 20
<210> 22
<211> 25
<212> DNA
<213> Artificial sequence (unknown)
<220>
<221> misc_feature
<223> primer
<400> 22
cacaagtttg atcttatgta cggca 25
Claims (10)
1. A free DNA sequence derived from Echinococcus granulosus, which is 101 bases in length and has a sequence shown in SEQ ID NO. 3:
GCAAGATCTTCACGAGCCTCAGAGAATTCACCTTCTTCCATGCCTTCACCGACGTACCAATGAACGAATGCACGCTTGCCGTACATAAGATCAAACTTGTG。
2. the isolated DNA sequence of claim 1, wherein the isolated DNA sequence is obtained by screening after plasma isolated DNA of a cystic hydatid patient is verified in a patient or a healthy person by a fluorescent quantitative PCR method by combining a genome re-sequencing technology with a bioinformatics analysis method.
3. The method of claim 1 or 2, wherein the method comprises the steps of:
firstly, obtaining a large number of free DNA sequences from a blood sample of a cystic echinococcosis patient by a resequencing technology;
secondly, analyzing, comparing and screening out free DNA sequences derived from echinococcus granulosus from the echinococcus granulosus by a bioinformatics method;
and thirdly, verifying the echinococcosis patients and healthy people by a fluorescent quantitative PCR method and screening to obtain the echinococcosis drug.
4. The screening method of claim 3, wherein the first step specifically comprises the steps of:
(1) extracting free DNA of fresh plasma of an echinococcosis patient by using a kit;
(2) constructing a library of DNA samples qualified by electrophoresis detection;
(3) and performing double-end sequencing after the library is qualified.
5. The screening method according to claim 3, wherein the second step comprises the steps of:
(1) firstly, performing data filtration by using preprocessing software Trimmomatic to remove low-quality data and obtain clean sequencing data;
(2) the data were then aligned to the reference genome: comparing the clean sequencing data sequence with echinococcus granulosus reference genome information, extracting a sequence on the comparison, comparing with a human reference genome, removing the sequence of the compared human genome, and comparing with the echinococcus granulosus reference genome to obtain a free DNA sequence derived from the echinococcus granulosus;
(3) and (3) comparing free DNA sequences in the data obtained in the step (2) of 6 samples of different cystic echinococcosis patients, and extracting the free DNA sequences which exist in the 6 samples of the patients and have higher abundance to obtain candidate free DNA sequences.
6. The screening method of claim 3, wherein the third step specifically comprises the steps of: and (3) taking samples of the hydatid patient and the healthy person as positive and negative controls, and verifying the sensitivity and the specificity of the insect source free DNA sequence obtained by the second step one by a fluorescent quantitative PCR method to screen out a section of free DNA sequence with the optimal sensitivity and specificity.
7. The screening method according to claim 3 or 6, wherein in the third step, the PCR primer sequence used for the sequence shown in SEQ ID No.3 in the fluorescent quantitative PCR method is:
f: GCAAGATCTTCACGAGCCTC, as shown in SEQ ID NO. 21;
r: CACAAGTTTGATCTTATGTACGGCA, as shown in SEQ ID NO. 22.
8. The screening method according to claim 3 or 6, wherein in the third step, the reaction conditions of the fluorescent quantitative PCR method are: pre-denaturation at 95 ℃ for 10min, denaturation at 95 ℃ for 15sec, and 40 cycles; 60 ℃ anneal for 30sec, 40 cycles.
9. The screening method according to claim 3 or 6, wherein in the third step, the reaction system of the fluorescent quantitative PCR method comprises: 2 XFluorogenic quantitation kit FastStart Universal SYBR Green Master 5. mu.l; ddH2O 3.4. mu.l; upstream primer 0.3 μ l; 0.3 mul of downstream primer; DNA template 1. mu.l.
10. Use of the free DNA sequence according to claim 1 or 2 for the preparation of a product for diagnosis and detection of echinococcosis.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN202010559041.XA CN113817837A (en) | 2020-06-18 | 2020-06-18 | Free DNA sequence from Echinococcus granulosus and application thereof |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN202010559041.XA CN113817837A (en) | 2020-06-18 | 2020-06-18 | Free DNA sequence from Echinococcus granulosus and application thereof |
Publications (1)
Publication Number | Publication Date |
---|---|
CN113817837A true CN113817837A (en) | 2021-12-21 |
Family
ID=78911759
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN202010559041.XA Pending CN113817837A (en) | 2020-06-18 | 2020-06-18 | Free DNA sequence from Echinococcus granulosus and application thereof |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN113817837A (en) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN114496088A (en) * | 2022-01-27 | 2022-05-13 | 中国农业科学院兰州兽医研究所 | Echinococcus disease microbial marker and screening method and application thereof |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN107365849A (en) * | 2017-08-10 | 2017-11-21 | 西南民族大学 | The kit of dog particulate, Echinococcus multilocularis based on POCKIT Micro fluorescent PCR platforms and application |
CN110656187A (en) * | 2019-10-28 | 2020-01-07 | 中国疾病预防控制中心寄生虫病预防控制所 | Kit and method for detecting echinococcus in lesion tissues or canine feces by using multiple RAA and multiple PCR (polymerase chain reaction) |
-
2020
- 2020-06-18 CN CN202010559041.XA patent/CN113817837A/en active Pending
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN107365849A (en) * | 2017-08-10 | 2017-11-21 | 西南民族大学 | The kit of dog particulate, Echinococcus multilocularis based on POCKIT Micro fluorescent PCR platforms and application |
CN110656187A (en) * | 2019-10-28 | 2020-01-07 | 中国疾病预防控制中心寄生虫病预防控制所 | Kit and method for detecting echinococcus in lesion tissues or canine feces by using multiple RAA and multiple PCR (polymerase chain reaction) |
Non-Patent Citations (1)
Title |
---|
张亚楼;JEAN MATHIEU BART;温浩;马旭东;苗玉清;陈雪鸿;: "PCR方法诊断家犬感染细粒棘球绦虫的特异性及在临床诊断中的应用价值", 中国地方病学杂志, no. 05 * |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN114496088A (en) * | 2022-01-27 | 2022-05-13 | 中国农业科学院兰州兽医研究所 | Echinococcus disease microbial marker and screening method and application thereof |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN109207592B (en) | Kit for colorectal cancer detection and application thereof | |
JP6369857B2 (en) | Method for obtaining information on hepatocellular carcinoma, and marker and kit for obtaining information on hepatocellular carcinoma | |
CN110904225B (en) | Combined marker for liver cancer detection and application thereof | |
CN112226538B (en) | Primer probe combination, kit and method for novel coronavirus detection | |
CN111172287B (en) | Application of exosome lncRNA RN7SL5P as internal reference gene in gastric cancer lncRNA detection | |
CN113481311B (en) | SNP molecular marker for identifying Brucella vaccine strain M5 and application thereof | |
CN111676292A (en) | Composition for detecting liver cancer, kit and application thereof | |
CN114317762B (en) | Three-marker composition for detecting early liver cancer and kit thereof | |
CN111518877B (en) | One-tube method nest type real-time quantitative PCR detection kit for detecting echinococcus multilocularis and echinococcus granulosus by parting trace samples | |
CN112226536A (en) | CRISPR-Cas13 system for detecting novel coronavirus and kit and method thereof | |
CN108315478A (en) | The probe and kit of RAA Fluorometric assay hydrophobins | |
CN113355414B (en) | Esophageal cancer detection kit and application thereof | |
CN113724862A (en) | Colorectal cancer biomarker and screening method and application thereof | |
CN113817837A (en) | Free DNA sequence from Echinococcus granulosus and application thereof | |
CN111826446A (en) | Primer, probe and kit for early screening and auxiliary diagnosis of bladder cancer | |
CN115961038A (en) | Composition for detecting gastric cancer, kit and application thereof | |
CN113862370B (en) | Primer, probe and kit for screening liver cancer and application of kit | |
CN116064786A (en) | Composition for detecting gastric cancer, kit and application thereof | |
CN114908147A (en) | RT-qPCR detection method for distribution of human mesenchymal stem cells in mouse and application thereof | |
CN114410795A (en) | Liver cancer early detection based on miRNA (micro ribonucleic acid) feature marker | |
CN111733254B (en) | Biomarker DNA molecular fragment for detecting echinococcus granulosus and application thereof | |
CN116814781A (en) | Markers, kits and devices for detecting urothelial cancer | |
CN112011595A (en) | Whole genome amplification method for SARS-CoV-2 virus, application and sequencing method and kit | |
CN113151557A (en) | LAMP primer group, kit and method for detecting histoplasma capsulatum | |
CN109295228B (en) | Kit for detecting lung cancer related mutant gene in plasma free DNA and application thereof |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination |