CN113817728A

CN113817728A - Recombinant lentivirus capable of effectively interfering Tau protein expression and application thereof

Info

Publication number: CN113817728A
Application number: CN202010570721.1A
Authority: CN
Inventors: 岑小波; 李虹椿
Original assignee: West China Hospital of Sichuan University
Current assignee: West China Hospital of Sichuan University
Priority date: 2020-06-19
Filing date: 2020-06-19
Publication date: 2021-12-21
Also published as: WO2021253729A1

Abstract

The invention discloses a recombinant lentivirus capable of effectively interfering Tau protein expression and application thereof, belonging to the field of nervous system medicaments. The technical scheme of the invention mainly comprises the following steps: shRNA containing the sequence shown in SEQ ID NO.8, and a gene (double-stranded oligonucleotide) and a recombinant lentivirus for expressing the shRNA, wherein the shRNA can be sheared into siRNA for interfering the expression of Tau protein in cells. Experiments prove that the slow virus can promote the proliferation of nerve cells by infecting the nerve cells. Therefore, the substance interfering Tau expression is applied to the preparation of the medicine promoting the proliferation of the nerve cells, and has good application prospect.

Description

Recombinant lentivirus capable of effectively interfering Tau protein expression and application thereof

Technical Field

The invention belongs to the field of nervous system medicines.

Background

Tau protein (UniProt: P10636 (human), P10637 (mouse)) is a microtubule (microtubule) associated protein that promotes microtubule assembly and maintains its stability. The Gene encoding the Tau protein was the MAPT Gene (Gene ID: 4137 (human), 17762 (mouse)).

The study of Tau protein has focused mainly on the field of Alzheimer Disease (AD). The study suggests that senile plaques formed by abnormal deposition of beta-amyloid outside neurons are the main cause of AD, and a large amount of abnormally modified Tau protein exists in the brain of AD patients. Because abnormal modification of Tau protein involves multiple enzymes, new drugs for treating AD can be developed on the basis of the abnormal modification. The phosphatase and the enzyme activator drugs are applied to reduce the phosphorylation process of Tau protein, and the inhibition and even reversal effects on the degeneration of neuron fibers of AD patients are possible.

After the nervous system is damaged, the common ways for repairing the damaged nerve are suture operation and nerve transplantation, but the suture operation has high technical requirements on doctors, and some damages are not suitable for suture; however, the nerve transplantation is difficult to ensure sufficient nerve source and easy to pollute. Therefore, promoting the regeneration of nerve cells becomes a new direction for treating the damage of the nervous system. No report that the expression level of Tau protein is related to nerve cells is found.

Disclosure of Invention

The invention aims to solve the problems that: provides a recombinant lentivirus which can effectively interfere the expression of Tau protein and the application thereof in promoting the proliferation of nerve cells.

The technical scheme of the invention comprises the following steps:

the shRNA has a sequence comprising a sequence shown in SEQ ID NO.8 and a sequence which is reversely complementary with the sequence shown in SEQ ID NO. 8.

The shRNA has a sequence comprising a sequence shown in SEQ ID NO. 7.

A double-stranded oligonucleotide, the sequence of which comprises the sequence of SEQ ID NO. 1.

The double-stranded oligonucleotide as described in the above, which is formed by base complementary pairing of single-stranded oligonucleotides having sequences as shown in SEQ ID NO.3 and SEQ ID NO. 4.

A recombinant plasmid obtained by inserting the double-stranded oligonucleotide into a multiple cloning site of a viral expression vector.

The recombinant plasmid is used as the virus expression vector pLKD-CMV-G & PR-U6-shRNA.

A recombinant virus carrying the aforementioned double-stranded oligonucleotide or an RNA form thereof;

or, any single strand of the double-stranded oligonucleotide or its RNA form.

As with the recombinant viruses previously described, the recombinant viruses are lentiviruses.

Use of an inhibitor of Tau protein expression or a precursor of an inhibitor of Tau protein expression in the preparation of a medicament for promoting proliferation of neural cells.

The use as described above, the Tau protein expression inhibitor or the precursor of the Tau protein expression inhibitor comprises a DNA or RNA sequence as set forth in SEQ ID No.1 or 8;

preferably, the precursor of the Tau protein expression inhibitor is the shRNA, the double-stranded oligonucleotide, the recombinant plasmid or the recombinant virus.

"inhibitor of Tau protein expression" refers to: a substance capable of specifically inhibiting the expression of Tau protein, comprising: miRNA that specifically binds MAPT gene transcripts, miRNA mimics (artificial analogs of miRNA), miRNA agomir (artificial analogs of miRNA that are more stable than miRNA mimics by special chemical modification), siRNA.

"precursor of an inhibitor of Tau protein expression" means: the substance which can be converted into the Tau protein expression inhibitor through in vivo biochemical reaction comprises genes of shRNA and shRNA, genes of miRNA and genes of siRNA, and also comprises a viral vector carrying the genes of shRNA, genes of miRNA and genes of siRNA, wherein the viral vector can be lentivirus, adenovirus or adeno-associated virus.

The invention discloses that the Tau protein inhibitor or the precursor thereof can promote the proliferation of nerve cells for the first time, and the Tau protein inhibitor or the precursor thereof is applied to the preparation of the medicine for promoting the proliferation of the nerve cells and has good prospect in the clinical application of nervous system repair.

Obviously, many modifications, substitutions, and variations are possible in light of the above teachings of the invention, without departing from the basic technical spirit of the invention, as defined by the following claims.

The present invention will be described in further detail with reference to the following examples. This should not be understood as limiting the scope of the above-described subject matter of the present invention to the following examples. All the technologies realized based on the above contents of the present invention belong to the scope of the present invention.

Drawings

FIG. 1: pLKD-CMV-G & PR-U6-shRNA vector map.

FIG. 2: electrophoresis picture after vector linearization (restriction).

FIG. 3: PCR verification.

FIG. 4: EGFP fluorescence in 293T cells.

FIG. 5: western blot detection of Tau.

FIG. 6: EGFP fluorescence detection in N2a cells.

FIG. 7: edu and EGFP flow cytometer detection results.

FIG. 8: edu and EGFP double positive statistical histogram.

Detailed Description

Example 1 preparation of recombinant lentiviruses that interfere with the expression of Tau protein

And designing siRNA targets according to the transcripts of the mouse Tau gene, and arranging primer synthesis. Annealing the single-stranded primer into a double-stranded oligo (oligonucleotide) sequence, connecting the double-stranded oligo and oligonucleotide sequence into an Age I and EcoR I double-enzyme digestion linearized RNA interference vector pLKD-CMV-G & PR-U6-shRNA (the map is shown in figure 1), and replacing the original ccdB toxic gene. Transformants are screened by colony PCR, and sequencing verification is carried out on the screened positive clones. And (5) sequencing to verify correct clone, and performing high-purity plasmid extraction.

First, the main steps

1. Interfering target design and primer synthesis:

according to the general principle and experience of shRNA design, 3 to 4 siRNA targets are designed, and single-stranded primer synthesis is arranged. After screening, the targets shown in Table 1 were selected.

TABLE 1 siRNA target sequences

The single-stranded primer sequences are shown in Table 2. In the table: most regions of the sh-Tau-F and the sh-Tau-R are reversely complementary, and a double strand with a sticky end can be formed; sh-control-F is reverse complementary to most of the region of sh-control-R and can form a double strand with sticky ends. The capital bold font and the capital underlined font are Stem regions, the capital italic font is a Loop region, and the lower case part is a terminal linker sequence (comprising a transcription termination sequence and an enzyme digestion site sequence).

TABLE 2 DNA primer fragments

2. Primer annealing to form double-stranded fragments with sticky ends:

dissolving the synthesized single-stranded primer into 20. mu.M with oligo annealing buffer, and naturally cooling 30. mu.l of each complementary single strand to room temperature to form a double-stranded oligo fragment. Mu.l of the suspension was used for the subsequent ligation reaction and the remainder was stored at-20 ℃.

The core sequence of shRNA generated by transcription of the double-stranded oligo is:

the shRNA is cut by endonuclease in vivo, the Loop region is removed, and the core sequence of the generated siRNA is as follows: GGAGUUUGACACAAUGGAA (SEQ ID NO. 8).

Note: the capital bold font and the capital underlined font of SEQ ID NO. 3-7 are Stem regions, and the capital italic font is a Loop region.

3. Preparation of linearized expression vector:

carrying out enzyme digestion on the expression vector by using restriction enzyme, wherein the enzyme digestion reaction system is as follows: plasmid 2. mu.g, 10 × reaction Buffer 5. mu.l, restriction enzyme 1. mu.l each, make up 50. mu.l of deionized water, incubate in 37 ℃ water bath for more than 2 h. Carrying out Agarose Gel electrophoresis on the enzyme digestion product to detect the enzyme digestion effect, cutting a target carrier band from the Gel after the Agarose Gel electrophoresis, and recovering the Gel by using TaKaRa miniBEST Agarose Gel DNA Extraction Kit Ver.3.0, wherein the specific steps refer to the Kit specification.

4. The interfering fragment (double-stranded oligo fragment) was ligated into an expression vector:

the ligation reaction system is shown in Table 3.

TABLE 3 ligation reaction System

Ligation was carried out overnight at 16 ℃.

Description of the drawings: the annealed double-stranded oligo added for the positive control is a previously annealed verified fragment, which is the same length as the annealed double-stranded oligo added for the ligation group, but is not sequence-related.

5. Colony PCR to identify positive transformants:

transformants grown on the plate were picked and resuspended in 10. mu.l of LB medium, and 1. mu.l was used as a template for colony PCR identification. The reaction system and PCR cycling conditions were as follows:

6. sequencing the positive clone:

and (4) identifying the obtained positive clone by the colony, and sending the positive clone to a sequencing company for sequencing verification. And (5) comparing the sequencing results by using Vector NTI software, and analyzing the sequencing results.

7. And (3) small plasmid extraction:

the correct positive clones were verified by sequencing and plasmids were extracted using AxyPrep plasmid DNA minikit.

8. And (3) packaging the virus:

the 293T cells with good state are inoculated in a 6-well plate before transfection, and the transfection is prepared when the cell adherence rate reaches about 70-80%. 30 minutes before transfection, the complete medium, fresh and containing the double antibody, was replaced. Two 1.5mL EP tubes were taken and labeled as tube A and BTubes, 500. mu.L of reduced serum medium (Opti-MEM) were added, while in tube A6. mu.g of the DNA lentiviral plasmid of interest, 6. mu.g of the PS-PAX2 lentiviral helper plasmid and 6. mu.g of the PMD2.G lentiviral helper plasmid were added; add 5. mu.L Lipofect2000 to tube B^TMAfter the reagent is transfected, the mixture is gently mixed and kept stand for 5 min. Gently adding the liquid in the tube A into the tube B, and then placing the mixed liquid in a cell culture box at 37 ℃ for incubation for 10-15 min. The liposome plasmid complex was gently added to a 6-well plate confluent with 293T cells and gently shaken 20-30 times. After 4-6h incubation, the 6-well plate medium containing the transfection mixture was removed while incubation continued with the addition of fresh complete medium. After 24h, cells were observed by an inverted fluorescence microscope and their transfection efficiency was calculated. After a final overnight incubation of 48-72h, the supernatant was collected.

Second, result in

1. Linearization of the expression vector:

the expression vector was double digested with Age I and EcoR I to obtain the 312bp ccdB gene and 8.2kb vector fragment, and the digestion map is shown in FIG. 2. In the figure, the first lane is the interference vector without enzyme digestion, the second lane is the double enzyme digestion linearized interference vector, the third lane is the 1kb DNA ladder Marker.

2. Colony PCR identification of positive clones:

transformants were identified by colony PCR with forward primer hU 6-F2: TACGATACAAGGCTGTTAGAGAG (SEQ D No.9), in the human U6 promoter sequence; reverse primer pY-SEQIR: CTATTAATAACTAATGCATGGC (SEQ ID NO.10), located 5' to the CMV promoter. Positive clones gave a 332bp fragment (FIG. 3).

3. And (3) analyzing a sequencing result:

the sequencing result shows that the double-stranded Oligo is successfully inserted into the vector, the sequencing result is as follows, the underlined part is the insertion sequence, and the single-stranded primer sequence is matched with the underlined part:

4. results of viral packaging

The 48h pathological changes of 293T cells transfected by recombinant lentivirus (abbreviated as "sh-Tau lentivirus") interfering with Tau protein expression are shown in FIG. 4 (200X visual field), and it can be seen that lentivirus invades cells successfully and replicates in large quantity.

5. Results of titer determination

As shown in Table 4, the sh-Tau lentivirus titer obtained by the invention is very high and can reach 6 multiplied by 10 at most⁸。

TABLE 4 Virus titer assay

Example 2sh-Tau lentivirus neuronal cell proliferation

Materials and methods

1. Experimental Material

1.1 Experimental reagents

(1) RIPA lysate, purchased from Shanghai Bin Yuntian Biotechnology Ltd.

(2) BCA method protein concentration determination kit, purchased from Pierce company of America.

(3)5 XSDS-PAGE electrophoresis buffer from Shanghai Bintian Biotechnology Ltd.

(4) SDS-PAGE reagents (30% polyacrylamide, Tris-base, SDS, ammonium persulfate, TEMED, glycine).

(5)0.45 μ M pore size PVDF membrane, available from Millipore, USA.

(6) Prestained protein marker, available from Thermo Scientfic, USA.

(7) Chemiluminescence development kit, purchased from Millipore corporation, usa.

(8) Antibody: mouse anti-mouse Tau monoclonal antibody (MA5-12808), purchased from Thermo Scientfic; rabbit anti-mouse β -actin antibody (4697) from Cell Signaling Technology; horseradish peroxidase-labeled goat-anti-rabbit secondary antibody (L3012-2) and goat-anti-mouse secondary antibody (L3032-2) were purchased from SAB.

(9) sh-Tau lentivirus and control lentivirus (sh-control lentivirus) were constructed as described in example 1.

(10)Click-iT^TM Plus EdU Alexa Fluor^TM647Flow Cytometry Assay Kit, available from Thermo scientific corporation, USA.

1.2 preparation of the principal agent

(1) SDS-PAGE running buffer: to 15.1g Tris-base, 94g glycine and 5g SDS was added

800mL of double distilled water is stirred and dissolved, the volume is fixed to 1000mL, and the solution is stored at room temperature.

(2) And (3) membrane transfer buffer solution: 600mL of double distilled water was added to 2.9g of glycine, 5.8g of Tris-base and 0.37g of SDS, and after dissolution by stirring, the volume was adjusted to 800mL, and 200mL of methanol was added and the mixture was stored at room temperature.

(3)10 × TBS buffer: adding 800mL double distilled water into 60.5g Tris-base and 87.5g NaCl, stirring to dissolve, then dropwise adding concentrated hydrochloric acid to adjust the pH value to 7.4, finally fixing the volume to 1000mL, and storing at room temperature.

(4) TBST buffer: 1000mL of 1 XPSS buffer was prepared with 10 XPSS buffer, and 1mL of Tween 20 was added thereto and mixed well, followed by storage at room temperature.

(5) Blocking buffer: 100mL of TBST buffer was added to 5g of skim milk powder, and the mixture was dissolved with stirring and immediately used or stored at 4 ℃ (ready to use).

(6) Antibody buffer solution: to 5g of bovine serum albumin was added 100mL of TBST buffer, and the mixture was dissolved with stirring and immediately used or stored at 4 ℃ (ready for use).

1.3 Experimental apparatus

(1) Ultrasonication apparatus, purchased from Ningbo New Ganoderma apparatus research institute.

(2) ChemiScope Mini imaging apparatus, available from Shanghai flight science and technology, Inc.

(3) High speed cryogenic centrifuge, available from Eppendorff, germany.

(4) Protein electrophoresis tank and electrophoresis power supply available from Bio-Rad of America

(5) Microplate reader, available from Thermo scientific, usa.

(6) Decoloration shaker, purchased from Chengdu Jianxin laboratory instruments Co.

(7) Cell culture chamber, purchased from Thermo scientific, usa.

2. Test cell

2.1 cell culture

Mouse neuroblastoma 2a cells (Mouse neuroblastoma 2a cells, N2a) were purchased from ATCC (American Type Culture Collection, Manassas, VA, USA) and cultured under the Culture conditions recommended by ATCC. That is, the cells were cultured in DMEM high-glucose medium containing 10% fetal bovine serum, 1% penicillin 100U/mL and streptomycin 100U/mL. The cell culture box conditions were 37 ℃ and 5% of saturated concentration CO₂。

2.2 Lentiviral infection of cells of interest:

(1) n2a cells were seeded into 6-well plates.

(2) When the cell density reaches about 50-70%, the infection of N2a cell begins.

(3) 100uL of complete medium was added to a 1.5mL EP tube, and the volume of virus required to be added was calculated based on the MOI value of the cells of interest and the virus titer, while adding Polybrene at a concentration of 10ug/mL of the infection enhancer.

(4) After 72h of infection, the cell fluorescence intensity was observed with an inverted fluorescence microscope. Then, according to the infection efficiency, the corresponding resistant drug Puromycin (2.5ug/ml) is added into the culture medium to screen the cells.

3. Protein extraction

The RIPA lysate contains 50mM Tris (pH 7.4), 150mM NaCl, 1% NP-40, 0.5% sodium deoxyholate, 0.1% SDS, and various inhibitors of sodium orthovanadate, sodium fluoride, EDTA and leupeptin, and can effectively inhibit protein degradation. The specific operation steps are as follows:

(1) PMSF was added to the RIPA lysate before use to give a final concentration of 1mM PMSF.

(2) Adding lysis solution containing PMSF into the tissue, breaking the cells by ultrasonic wave until no obvious tissue particles are generated, centrifuging at 13000g for 10min at 4 ℃, and collecting supernatant.

(3) After the protein concentration in the supernatant was quantified using the BCA protein concentration measurement kit, a lysate containing PMSF and a5 x SDS loading buffer were added to adjust the concentrations to uniform concentrations. Heating in water bath at 100 deg.C to denature protein for 5min, and performing subsequent Western blot (Western blot) or storing at-20 deg.C for one week.

4. Western blotting (western blot)

(1) Preparation of SDS-PAGE gels: the glue concentration of the upper layer concentrated glue is 5%, and the glue concentration of the lower layer separation glue is 10%.

(2) Electrophoresis: the loading amount of each porin is 30-50 mug, electrophoresis is carried out at 60V for about 30min until the sample enters the separation gel, electrophoresis is carried out at 80V for about 80min, and the sample is separated.

(3) Film transfer: just before the electrophoresis is finished, the PVDF membrane with proper size is soaked in methanol for 10s for activation, and then is placed in a membrane conversion buffer solution together with 6 pieces of filter paper with the same size for standby. After electrophoresis is finished, the gel, the filter paper and the PVDF membrane are made into a membrane rotating sandwich structure according to the sequence of (black surface) sponge-3 pieces of filter paper-gel-PVDF membrane-3 pieces of filter paper-sponge (red surface), bubbles between layers are removed, the membrane rotating sandwich structure is placed in a membrane rotating clamp, and the membrane rotating is carried out for 60min at a constant current of 300 mA.

(4) And (3) sealing: after the membrane transfer is finished, the PVDF membrane is marked and transferred into a sealing buffer solution to be sealed for 1.5h at room temperature.

(5) Antibody incubation and membrane washing: diluting the primary antibody to a proper concentration by using an antibody buffer solution, coating a PVDF membrane, and incubating overnight at 4 ℃; incubating for 1h at 37 ℃ the next day to ensure primary temperature return; washing off excessive primary antibody on the surface of the membrane by TBST (8 min/time, 4 times in total) at room temperature; diluting the secondary antibody to a proper concentration by using an antibody buffer solution, coating a PVDF membrane, and incubating for 1h at room temperature; TBST (8 min/time, 4 times in total) washes off the excess secondary antibody on the membrane surface; tween in the membrane surface TBST was washed off with 1 × TBS (8 min/time, 2 times in total).

(6) Exposure: and (3) uniformly dropwise adding a developing solution on the PVDF film, and exposing in a dark room.

5. Cellular immunofluorescence

(1) Bottoming a glass slide: the sterilized coverslip was placed in a 6-well plate on a sterile clean bench, 1mL of polylysine at a concentration of 0.01mg/mL was added to each well, and the 6-well plate was placed in a cell incubator for 15min and the liquid was aspirated. After washing the slide 3 times with sterile PBS before seeding the cells, N2a cells were seeded into 6-well plates, with approximately 4X 10 cells per well⁵When the cells grow to 60-70%Cells were fixed after confluency.

(2) Fixing: the medium was discarded and washed 3 times for 3min each time with 4 ℃ pre-cooled PBS solution in 6-well plates. Then, precooled paraformaldehyde was added to fix the cells for 10min, and then the cells were washed with precooled PBS solution 3 times for 5min each time.

(3) Sealing: mounting with a mounting medium containing DAPI, taking care to flip the cover slip over a clean slide, taking care not to generate bubbles, and storing the slide in a refrigerator at 4 ℃ after mounting.

(4) The observed cells were photographed and imaged using a Nikon A1RMP + two-photon confocal microscope.

6. Flow cytometry

Edu (5-Ethyl-2' -deoxyuridine) flow assay procedure reference Click-iT^TM Plus EdU Alexa Fluor^TM647Flow Cytometry Assay Kit, the specific operation steps are as follows:

(1) edu was added to the cell culture medium before detection to give a final medium concentration of 10uM, and the cells were incubated for 1 h.

(2) After incubation, cells were harvested, i.e.200 ul/well (EDTA free) of pancreatin was used for digestion and 2ml of medium was added. Centrifuging at 1000rpm for 5min, discarding supernatant, adding 3ml of D-PBS, resuspending, centrifuging again according to the above conditions, and discarding supernatant.

(3) Adding 1ml of flow cytofluoric sorting buffer solution FACS to re-suspend the cells, and obtaining the single cell suspension.

(4) Centrifuging the cell suspension for 7min at normal temperature under 200g centrifugation condition, discarding the supernatant, adding 1ml of Fixable visual stability Stain 780 antibody diluent (1: 1000) into each tube except blank control tubes, immediately mixing by vortex, and incubating for 30min at 4 ℃ in the dark.

(5) After incubation, 2ml of FACS solution is added, the mixture is blown and uniformly mixed, and then the mixture is centrifuged for 7min under the conditions of normal temperature and 200g, and then the supernatant is discarded.

(6) 1ul of blocking antibody CD16/CD32 (1: 100) was added to each tube and incubated at 4 ℃ for 10min protected from light.

(7) After incubation, 200ul of FACS solution was added, and the mixture was centrifuged at 200g for 7min at room temperature, and the supernatant was discarded.

(8) Then 100. mu.l of Click-iT was added to both blank and co-stained tubes^TMFIxative (provided in kit), vortex immediately, blow and mix well. And incubating at 4 deg.C in dark for 15min, adding 3ml FACS solution, blowing, mixing, centrifuging at 400g for 5min, and discarding supernatant.

(9) Then 100. mu.l of 1X Click-iT is added^TMsaponin-based amplification and wash reagent (provided in kit), vortexed and vortexed immediately and vortexed, and incubated at 4 ℃ in the dark for 15 min.

(10) 1X Reaction Buffer Additive (provided in kit) was prepared.

(11) D-PBS, Copper protective, Fluorescent dye reagent Additive (provided by kit) was added to the Reaction system in the appropriate ratio. (the solution was ready within 15 min.

(12) The prepared reaction solution (500 ul per tube) was added to each tube, vortexed, mixed, and incubated at 4 ℃ for 30min in the dark.

(13) 3ml of 1 XClick-iT was added to each tube^TMsaponin-based amplification and wash reagent, centrifuged at 200g for 7min and the supernatant discarded.

(14) Finally, 100ul of 1X Click-iT is added^TMsaponin-based amplification and wash reagent, and adding the corresponding fluorescent antibody to the solution, and incubating at 4 ℃ in the dark for 30 min.

(15) After incubation was complete, 3ml of 1 XClick-iT was added to each tube^TMsaponin-based fertilization and wash reagent, and pipetting the resuspended cells. The supernatant was discarded after centrifugation at 200g for 7min at room temperature.

(16) 200ul of 1X Click-iT was added^TMThe cell suspension can be detected by resuspending the cells in saponin-based amplification and wash reagent.

Second, result in

Expression of Tau in N2a cells

The result of the Western blot experiment shows that after sh-Tau is transfected into N2a cells, the expression of the cell endogenous Tau protein is obviously reduced.

Propagation of N2a cells

Both sh-control and sh-Tau virus transfected N2a cells Expressed Green Fluorescent Protein (EGFP), as shown in FIG. 6.

Edu is a thymine nucleoside analogue, which can be incorporated into replicating DNA molecule instead of thymine during cell proliferation period, and can rapidly detect DNA replication activity and cell proliferation ability by detecting Edu signal intensity.

In this example, EGFP and Edu double positives were used to represent lentivirus-infected and proliferating cells, and as shown in FIGS. 7 and 8, the sh-Tau lentivirus-infected cells showed a greater proportion of EGFP and Edu double positives;

the results of this example show that: after inhibiting the expression of Tau protein, the proliferation rate of N2a cells is obviously increased.

In conclusion, the recombinant lentivirus is prepared, so that the expression of Tau protein of nerve cells is inhibited, and the proliferation of the nerve cells can be remarkably promoted. The inhibitor of Tau protein is used for preparing the medicine for promoting the proliferation of nerve cells, and has good clinical application prospect.

SEQUENCE LISTING

<110> Sichuan university Hospital in western China

<120> recombinant lentivirus capable of effectively interfering Tau protein expression and application thereof

<130> GY159-2020P0110141CC

<160> 11

<170> PatentIn version 3.5

<210> 1

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

ggagtttgac acaatggaa 19

<210> 2

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

ttctccgaac gtgtcacgt 19

<210> 3

<211> 58

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

ccggggagtt tgacacaatg gaattcaaga gattccattg tgtcaaactc cttttttg 58

<210> 4

<211> 58

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

aattcaaaaa aggagtttga cacaatggaa tctcttgaat tccattgtgt caaactcc 58

<210> 5

<211> 58

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

ccggttctcc gaacgtgtca cgtttcaaga gaacgtgaca cgttcggaga attttttg 58

<210> 6

<211> 58

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

aattcaaaaa attctccgaa cgtgtcacgt tctcttgaaa cgtgacacgt tcggagaa 58

<210> 7

<211> 47

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

ggaguuugac acaauggaau ucaagagauu ccauuguguc aaacucc 47

<210> 8

<211> 19

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

ggaguuugac acaauggaa 19

<210> 9

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

tacgatacaa ggctgttaga gag 23

<210> 10

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

ctattaataa ctaatgcatg gc 22

<210> 11

<211> 917

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

tgggaattat tttgactgta aacacaaaga tattagtaca aaatacgtga cgtagaaagt 60

aataatttct tgggtagttt gcagttttaa aattatgttt taaaatggac tatcatatgc 120

ttaccgtaac ttgaaagtat ttcgatttct tggctttata tatcttgtgg aaaggacgaa 180

acaccgggga gtttgacaca atggaattca agagattcca ttgtgtcaaa ctcctttttt 240

gaattcggat ccattaggcg gccgcgtgga taaccgtatt accgccatgc attagttatt 300

aatagtaatc aattacgggg tcattagttc atagcccata tatggagttc cgcgttacat 360

aacttacggt aaatggcccg cctggctgac cgcccaacga cccccgccca ttgacgtcaa 420

taatgacgta tgttcccata gtaacgccaa tagggacttt ccattgacgt caatgggtgg 480

agtatttacg gtaaactgcc cacttggcag tacatcaagt gtatcatatg ccaagtacgc 540

cccctattga cgtcaatgac ggtaaatggc ccgcctggca ttatgcccag tacatgacct 600

tatgggactt tcctactttg gcagtacatc tacgtattag tcatcgctat taccatggtg 660

atgcggtttg ggcagtacat caatgggcgt gggatagcgg tttgactcac gtggattttc 720

caagtctcct cccccattga cgtcaatggg agtttgtttt gggcaccaaa atcatcgggg 780

actttcccaa atgtcgtaac aactccgccc tcattgacgc aaaggggcgg gtaggcgtgt 840

acggtgggaa ggtctatata agccagagcg tggatgaagt tgatcgggca gaatctgcgt 900

agcggtatac cgtgacg 917

Claims

1. An shRNA, which is characterized in that: the sequence comprises the sequence shown in SEQ ID NO.8 and the sequence which is reversely complementary with the sequence shown in SEQ ID NO. 8.

2. An shRNA according to claim 1, wherein: the sequence of the polypeptide comprises the sequence of SEQ ID NO. 7.

3. A double-stranded oligonucleotide, characterized in that: the sequence of the polypeptide comprises the sequence of SEQ ID NO. 1.

4. The double-stranded oligonucleotide of claim 3, wherein: it is a double-stranded oligonucleotide formed by base complementary pairing of single-stranded oligonucleotides with sequences shown as SEQ ID NO.3 and SEQ ID NO. 4.

5. A recombinant plasmid, characterized in that: it is a recombinant plasmid obtained by inserting the double-stranded oligonucleotide according to claim 3 or 4 into the multiple cloning site of a viral expression vector.

6. The recombinant plasmid of claim 5, wherein: the virus expression vector is pLKD-CMV-G & PR-U6-shRNA.

7. A recombinant virus, characterized in that: said recombinant virus carrying the double-stranded oligonucleotide of any one of claims 3 or 4 or an RNA form thereof;

or, any single strand of the double-stranded oligonucleotide or its RNA form.

8. The recombinant virus of claim 7, wherein: the recombinant virus is a lentivirus.

10. Use according to claim 9, characterized in that: the Tau protein expression inhibitor or the precursor of the Tau protein expression inhibitor comprises a DNA or RNA sequence of SEQ ID No.1 or 8;

preferably, the precursor of the Tau protein expression inhibitor is the shRNA, double-stranded oligonucleotide, recombinant plasmid or recombinant virus according to any one of claims 1 to 8.