CN113801956A - Fluorescent molecular marker primer group of rice GS2 gene and application thereof - Google Patents
Fluorescent molecular marker primer group of rice GS2 gene and application thereof Download PDFInfo
- Publication number
- CN113801956A CN113801956A CN202111220386.3A CN202111220386A CN113801956A CN 113801956 A CN113801956 A CN 113801956A CN 202111220386 A CN202111220386 A CN 202111220386A CN 113801956 A CN113801956 A CN 113801956A
- Authority
- CN
- China
- Prior art keywords
- rice
- gene
- molecular marker
- fluorescent molecular
- primer group
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Genetics & Genomics (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Botany (AREA)
- Mycology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to the technical field of rice breeding, and discloses a fluorescent molecular marker primer group of a rice GS2 gene, which comprises a GS2-Fat primer, a GS2-Fca primer and a GS2-R primer; applications are also disclosed. The fluorescent molecular marker primer group can simply, conveniently and reliably detect whether the rice variety contains the GS2 gene, so that the subsequent electrophoresis detection is omitted, toxic substances are avoided, and the primer group is more environment-friendly; the invention can directly read the genotype signal by fluorescence scanning, can rapidly realize genotyping by combining software analysis, has the advantages of convenience, rapidness, no pollution, high detection efficiency, low detection cost and the like, and is more suitable for large-batch genotyping work.
Description
Technical Field
The invention relates to the technical field of rice breeding, in particular to a fluorescent molecular marker primer group of a rice GS2 gene and application thereof.
Background
China is the first rice producing country and the first consuming country in the world, and the improvement of the rice yield plays an important role in guaranteeing the food safety of China, helping the employment of rural population, reducing poverty population and the like. Research shows that the breeding of new rice varieties with large grains and heavy ears is an effective way for exploiting the production potential of rice and realizing the increase of the yield per unit of rice. All international rice researches show that thousand kernel weight and grain size are in positive correlation in a certain range, and the yield can be increased by increasing the kernel weight.
GS2 is a gene controlling rice grain size, which regulates grain size by promoting cell division and cell expansion. The gene is located on the second chromosome of rice and is a semi-dominant site, and TC → AA replacement is carried out on the 3 rd exon so as to generate a large-grained phenotype. GS2 is used as a rare allelic variation gene for regulating and controlling the size of seeds, the application in breeding is rarely reported, most of the existing markers for GS2 gene selection are linked markers and dCaps markers needing enzyme digestion, the markers need to be subjected to electrophoresis detection by utilizing polyacrylamide gel or agarose gel, and the used detection materials are toxic and not environment-friendly, the detection process is complicated, and the analysis time is long. Therefore, the inventor abandons the traditional molecular marker, creates a fluorescent molecular marker, and rapidly realizes genotyping by combining fluorescent scanning with software analysis.
Disclosure of Invention
Based on the problems, the invention provides the fluorescent molecular marker primer group of the rice GS2 gene and the application thereof, the invention can simply, conveniently and reliably detect whether the rice variety contains the GS2 gene, and can realize the rapid breeding of the restorer rice variety with large grain characteristics and accelerate the breeding speed of large grain hybrid rice by combining the fluorescent molecular marker primer group of the rice GS2 gene and a conventional breeding method.
In order to solve the technical problems, the invention provides a fluorescent molecular marker primer group of the rice GS2 gene, which comprises the following three primers:
GS2-Fat：GAAGGTGACCAAGTTCATGCTCGTTTCCACAGGCTTTCTTTT；
GS2-Fca：GAAGGTCGGAGTCAACGGATTCGTTTCCACAGGCTTTCTTGA；
GS2-R：GATTCCAAGTACTGCGAGCG；
the nucleotide sequence of GS2-Fat is shown as SEQ ID NO.1, the nucleotide sequence of GS2-Fca is shown as SEQ ID NO.2, and the nucleotide sequence of GS2-R is shown as SEQ ID NO. 3.
In order to solve the technical problems, the invention also provides application of the fluorescent molecular marker primer group in preparation of a kit for breeding or identifying large-grain rice.
Further, the method for breeding the large-grain rice restorer line by using the kit comprises the following steps:
s1: screening and identifying a material containing a GS2 gene from rice germplasm resources by using a fluorescent molecular marker primer group of the rice GS2 gene, hybridizing the material containing the GS2 gene serving as a male parent with a hybrid rice restorer line mainly applied to production to obtain a hybrid F1Seed generation; screening and identifying by adopting a PCR amplification method, rapidly detecting a PCR amplification product in an enzyme-labeling instrument comprising three fluorescence detection channels of FAM, HEX and ROX, reading a fluorescence intensity signal value, automatically genotyping a fluorescence signal value file by using an SNP decoder tool in combination with label information to obtain a genotype result, and screening according to the genotype result;
s2: f in step S11Selfing to obtain F2Generation, fluorescent molecular marker primer group F of rice GS2 gene2Selecting single plants containing target genes and having excellent agronomic characters from the generations for backcrossing;
s3: after two continuous backcross generations, carrying out multi-generation selfing, selecting each generation by using a fluorescent molecular marker primer group of the rice GS2 gene in combination with agronomic characters to obtain a stable plant line containing the GS2 gene, and then testing and matching the plant line with a sterile line.
Further, the PCR amplification reaction system is 10 μ L, which is as follows: mu.L of 2 XPAMS master mix containing 2 universal fluorescent primers, 0.15. mu.L of 10mM GS2-Fat labeled primer, 0.15. mu.L of 10mM GS2-Fca labeled primer, 0.4. mu.L of 10mM GS2-R universal reverse primer, 1. mu.L of template DNA, 3.3. mu.L of LddH2O; the PCR amplification reaction procedure was as follows: 94 ℃ for 4 min; then 10 cycles of 94 ℃, 20s, 65 ℃ and-0.8 ℃ are carried out for 1 min; then 32 cycles of 94 ℃, 20s, 56 ℃ for 1 min.
Compared with the prior art, the invention has the beneficial effects that: the fluorescent molecular marker primer group can simply, conveniently and reliably detect whether the rice variety contains the GS2 gene, so that the subsequent electrophoresis detection is omitted, toxic substances are avoided, and the primer group is more environment-friendly; the invention can directly read the genotype signal by fluorescence scanning, can rapidly realize genotyping by combining software analysis, has the advantages of convenience, rapidness, no pollution, high detection efficiency, low detection cost and the like, and is more suitable for large-batch genotyping work.
Drawings
FIG. 1 is a diagram showing the results of genotyping 72 rice germplasm resources in accordance with an embodiment of the present invention;
FIG. 2 is a graph comparing the grain types of R38 with the parents G204 and R789 of an example of the invention.
Detailed Description
In order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention is further described in detail below with reference to examples and accompanying drawings, and the exemplary embodiments and descriptions thereof are only used for explaining the present invention and are not meant to limit the present invention.
Example (b):
the GS2 gene is located on a second chromosome of rice and is a semi-dominant site, TC → AA substitution is carried out on a No.3 exon so as to generate a large-grain phenotype, and the difference bases in the sequences of GS2 and GS2 are as follows:
therefore, in this example, a fluorescent molecular marker primer set PM-GS2 of the rice GS2 gene was developed by using the base difference of TC → AA existing in exon 3 between GS2 and GS2, wherein PM-GS2 consists of the following three primers:
GS2-Fat：GAAGGTGACCAAGTTCATGCTCGTTTCCACAGGCTTTCTTTT；
GS2-Fca：GAAGGTCGGAGTCAACGGATTCGTTTCCACAGGCTTTCTTGA；
GS2-R：GATTCCAAGTACTGCGAGCG；
the nucleotide sequence of GS2-Fat is shown as SEQ ID NO.1, the nucleotide sequence of GS2-Fca is shown as SEQ ID NO.2, and the nucleotide sequence of GS2-R is shown as SEQ ID NO. 3.
The PM-GS2 can be used for preparing a kit for breeding or identifying large-grain rice, and the reaction system of the kit for PCR amplification is 10 mu L, and specifically comprises the following steps: 5 μ L of 2 × PARMS master mix (containing 2 universal fluorescent primers), 0.15 μ L of 10mM GS2-Fat labeled primer, 0.15 μ L of 10mM GS2-Fca labeled primer, 0.4 μ L of 10mM GS2-R universal reverse primer, 1 μ L of template DNA, 3.3 μ L of ddH2O。
The PCR amplification reaction procedure was as follows: 94 ℃ for 4 min; then 10 cycles of 94 ℃, 20s, 65 ℃ (-0.8 ℃ per cycle), 1 min; then 32 cycles of 94 ℃, 20s, 56 ℃ for 1 min.
Next, in this embodiment, the PM-GS2 is used to breed the rice large-grain restorer line, and the specific method is as follows:
s1: PM-GS2 is utilized to screen and identify a material containing a GS2 gene from rice germplasm resources, the material containing the GS2 gene is taken as a male parent to be hybridized with a hybrid rice restorer line mainly applied to production to obtain a hybrid F1Seed generation; wherein the PCR amplification method is adopted for screening and identification, andthe PCR amplification product is rapidly detected in an enzyme labeling instrument comprising three fluorescence detection channels of FAM, HEX and ROX, the fluorescence intensity signal value is read, the fluorescence signal value file is subjected to gene typing automatically through an SNP decoder (http:// www.snpway.com/snpdecoder01/) tool by combining with the marking information, the genotype result is obtained, and screening is carried out according to the genotype result;
if FAM fluorescence signals are obtained by scanning, the GS2 allelic gene type containing AA base is divided into green dots on a scatter typing graph; if the scanning obtains HEX fluorescence signals, the allele type of gs2 containing TC bases is shown, and blue dots are shown on the typing chart; if scanning simultaneously obtains two fluorescence signals of FAM and HEX, the allele type containing heterozygous AA/TC base is represented by red dots on a typing graph; referring to the attached figure 1, the DNA of 72 parts of rice material is extracted, PM-GS2 is used for PCR amplification, and the method is used for genotyping, so that two rice variety materials are screened to contain GS2 gene, and the screened material G204 which contains GS2 gene and has better agronomic character is used as male parent to be hybridized with a hybrid rice restorer R789 mainly applied to production to obtain hybrid F1Seed generation;
s2: f in step S11Selfing to obtain F2Instead, from F using PM-GS22Selecting a single plant containing a target gene GS2 gene with excellent agronomic characters from the generations to backcross with R789;
s3: after two generations of continuous backcross, carrying out multi-generation selfing, selecting each generation by utilizing PM-GS2 in combination with agronomic characters, comparing different plant lines of each generation, selecting the best single plant, and carrying out continuous selfing until the plant lines are basically stable; comparing different multiple plant lines, detecting the molecular marker again, selecting a stable plant line with good high yield performance, excellent panicle grain character, stronger resistance and a detection molecular marker, and obtaining a stable plant line containing the GS2 gene;
s4: and (3) testing and matching the stable line system serving as a male parent with different sterile lines, and performing area-system comparison on different testing and matching combinations through agronomic characters, combining ability and heterosis to finally select the restoring line with the most excellent comprehensive characters.
The rice large grain restoration system finally obtained in the embodiment is R38, see figure 2, which is a grain type comparison graph of R38 and parents G204 and R789, see the following table, which is a comparison result of R38 and the parent agronomic traits, and as can be seen from figure 2 and the following table, the thousand grain weight, the grain length and the grain width of R38 are obviously increased compared with those of the parent R789, and the setting rate is equivalent.
TABLE 1 comparison of the Large grain restorer line R38 bred with the agronomic traits of the parents
The above is an embodiment of the present invention. The embodiments and specific parameters in the embodiments are only for the purpose of clearly illustrating the verification process of the invention and are not intended to limit the scope of the invention, which is defined by the claims, and all equivalent structural changes made by using the contents of the specification and the drawings of the present invention should be covered by the scope of the present invention.
Sequence listing
<110> Guangxi Zhuang nationality college of autonomous region agro-sciences
Fluorescent molecular marker primer group of <120> rice GS2 gene and application
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 42
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
gaaggtgacc aagttcatgc tcgtttccac aggctttctt tt 42
<210> 2
<211> 42
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
gaaggtcgga gtcaacggat tcgtttccac aggctttctt ga 42
<210> 3
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
gattccaagt actgcgagcg 20
Claims (4)
1. The fluorescent molecular marker primer group of the rice GS2 gene is characterized by consisting of three primers as follows:
GS2-Fat：GAAGGTGACCAAGTTCATGCTCGTTTCCACAGGCTTTCTTTT；
GS2-Fca：GAAGGTCGGAGTCAACGGATTCGTTTCCACAGGCTTTCTTGA；
GS2-R：GATTCCAAGTACTGCGAGCG；
the nucleotide sequence of GS2-Fat is shown as SEQ ID NO.1, the nucleotide sequence of GS2-Fca is shown as SEQ ID NO.2, and the nucleotide sequence of GS2-R is shown as SEQ ID NO. 3.
2. Use of the fluorescent molecular marker primer set of claim 1 in the preparation of a kit for breeding or identifying large-grained rice.
3. The application of claim 2, wherein the method for breeding the rice large-grain restorer line by using the kit is as follows:
s1: screening and identifying a material containing a GS2 gene from rice germplasm resources by using a fluorescent molecular marker primer group of the rice GS2 gene, hybridizing the material containing the GS2 gene serving as a male parent with a hybrid rice restorer line mainly applied to production to obtain a hybrid F1Seed generation; screening and identifying by adopting a PCR amplification method, rapidly detecting a PCR amplification product in an enzyme-labeling instrument comprising three fluorescence detection channels of FAM, HEX and ROX, reading a fluorescence intensity signal value, automatically genotyping a fluorescence signal value file by using an SNP decoder tool in combination with label information to obtain a genotype result, and screening according to the genotype result;
s2: f in step S11Selfing to obtain F2Generation, fluorescent molecular marker primer group F of rice GS2 gene2Selecting single plants containing target genes and having excellent agronomic characters from the generations for backcrossing;
s3: after two continuous backcross generations, carrying out multi-generation selfing, selecting each generation by using a fluorescent molecular marker primer group of the rice GS2 gene in combination with agronomic characters to obtain a stable plant line containing the GS2 gene, and then testing and matching the plant line with a sterile line.
4. The use according to claim 3, wherein the PCR amplification reaction system is 10 μ L, in particular as follows: mu.L of 2 XPAMS master mix containing 2 universal fluorescent primers, 0.15. mu.L of 10mM GS2-Fat labeled primer, 0.15. mu.L of 10mM GS2-Fca labeled primer, 0.4. mu.L of 10mM GS2-R universal reverse primer, 1. mu.L of template DNA, 3.3. mu.L of ddH2O; the PCR amplification reaction procedure was as follows: 94 ℃ for 4 min; then 10 cycles of 94 ℃, 20s, 65 ℃ and-0.8 ℃ are carried out for 1 min; then 32 cycles of 94 ℃, 20s, 56 ℃ for 1 min.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111220386.3A CN113801956A (en) | 2021-10-20 | 2021-10-20 | Fluorescent molecular marker primer group of rice GS2 gene and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111220386.3A CN113801956A (en) | 2021-10-20 | 2021-10-20 | Fluorescent molecular marker primer group of rice GS2 gene and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN113801956A true CN113801956A (en) | 2021-12-17 |
Family
ID=78898079
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111220386.3A Pending CN113801956A (en) | 2021-10-20 | 2021-10-20 | Fluorescent molecular marker primer group of rice GS2 gene and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113801956A (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2018059120A1 (en) * | 2016-09-29 | 2018-04-05 | 武汉多倍体生物科技有限公司 | Two-line restorer line for polyploid rice and breeding method therefor |
| CN110747288A (en) * | 2019-11-14 | 2020-02-04 | 扬州大学 | Rice large grain gene function marker and application |
| CN110846432A (en) * | 2019-11-27 | 2020-02-28 | 广西壮族自治区农业科学院 | Codominant fluorescent molecular marker and detection method of brown planthopper resistant gene Bph3 |
| CN111876513A (en) * | 2020-06-23 | 2020-11-03 | 湖南杂交水稻研究中心 | Functional marker for detecting nitrogen-efficient and cold-resistant gene OsGRF4 of rice and application thereof |
-
2021
- 2021-10-20 CN CN202111220386.3A patent/CN113801956A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2018059120A1 (en) * | 2016-09-29 | 2018-04-05 | 武汉多倍体生物科技有限公司 | Two-line restorer line for polyploid rice and breeding method therefor |
| CN110747288A (en) * | 2019-11-14 | 2020-02-04 | 扬州大学 | Rice large grain gene function marker and application |
| CN110846432A (en) * | 2019-11-27 | 2020-02-28 | 广西壮族自治区农业科学院 | Codominant fluorescent molecular marker and detection method of brown planthopper resistant gene Bph3 |
| CN111876513A (en) * | 2020-06-23 | 2020-11-03 | 湖南杂交水稻研究中心 | Functional marker for detecting nitrogen-efficient and cold-resistant gene OsGRF4 of rice and application thereof |
Non-Patent Citations (1)
| Title |
|---|
| 黄娟等: "水稻香味基因荧光分子标记开发及育种应用", 植物生理学报, vol. 56, no. 05, pages 1015 - 1022 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109825621B (en) | Wheat spikelet number QTL (quantitative trait locus) linked SNP (single nucleotide polymorphism) molecular marker and application thereof | |
| CN108004344B (en) | Corn whole genome SNP chip and application thereof | |
| CN106967803B (en) | High-throughput molecular marker for detecting fertility restorer gene of radish Ogura-CMS (fertility restorer gene) and application of high-throughput molecular marker | |
| CN112080582B (en) | KASP molecular marker closely linked with major QTL locus of wheat spike length and application thereof | |
| CN112626260B (en) | Molecular marker linked with peanut kernel weight major QTL (quantitative trait locus) and application thereof | |
| CN113774161B (en) | KASP molecular marker of peanut pod and kernel size major QTL and application thereof | |
| CN115927703A (en) | Primer group for detecting specific molecular markers of rice grain type genes GS3 and GW5 and application thereof | |
| CN109609687B (en) | KASP marker primer combination for detecting watermelon fusarium wilt resistance and application thereof | |
| CN108179220B (en) | KASP marker tightly linked with wheat dwarf gene Rht12 and application thereof | |
| CN117737279A (en) | Cadmium low-accumulation hybrid rice molecular marker, rice mutant OsNramp5 gene, and identification method, application and primer thereof | |
| CN115029465B (en) | KASP and dCAPS markers coseparated with rape seed secondary dormancy main effect QTL and application thereof | |
| CN115323070A (en) | Multiple KASP marker primer group of major gene of wheat grain hardness and application | |
| CN113801956A (en) | Fluorescent molecular marker primer group of rice GS2 gene and application thereof | |
| CN106399495B (en) | SNP marker closely linked with soybean short stalk character and application thereof | |
| CN111549172B (en) | Watermelon leaf posterior green gene linkage site and CAPS marker | |
| CN114231651A (en) | Radish whole genome SSR core primer combination suitable for SSR-Seq technology and application thereof | |
| CN108570517B (en) | Specific primer related to Ning-Mai No. 9 low protein of weak gluten wheat and application of specific primer | |
| CN111485032A (en) | Method for identifying cucumber female line and SNP primer combination used by same | |
| CN109652582B (en) | SNP molecular marker for identifying Huyunuo No.3 waxy corn and application thereof | |
| CN110923355A (en) | Linkage KASP molecular marker for rice high temperature resistance character and application thereof | |
| CN111004857A (en) | Molecular marker primer of major QTL (quantitative trait locus) site of soybean branch number and application of molecular marker primer | |
| CN110724755B (en) | CAPS marker primer group linked with watermelon internode length and application thereof | |
| CN117286287B (en) | KASP (KASP) marker of soybean shade-tolerance gene GmYUC2 and application thereof | |
| CN113278726B (en) | Molecular marker Oil-4-3776551 for assisting in identifying high and low soybean Oil content, kit and method | |
| CN116622877B (en) | SNP molecular marker related to lotus rhizome internode shape and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |