CN113801941A

CN113801941A - Primer group, kit and method for detecting bovine polled gene

Info

Publication number: CN113801941A
Application number: CN202010554625.8A
Authority: CN
Inventors: 张毅; 颜泽; 王雅春; 张胜利; 肖炜
Original assignee: China Agricultural University
Current assignee: China Agricultural University
Priority date: 2020-06-17
Filing date: 2020-06-17
Publication date: 2021-12-17
Anticipated expiration: 2040-06-17
Also published as: CN113801941B

Abstract

The invention relates to the technical field of gene mutation detection, in particular to a primer group, a kit and a method for detecting bovine polled genes. The primer group comprises primers shown as SEQ ID NO. 1-9, and more preferably, the primer group also comprises primers shown as SEQ ID NO. 10-12. The method can simultaneously detect the Celtic pollens, the Mongolian pollens and the Friesian pollens of the cattle, and can quickly, accurately and massively realize the detection of the phenotype and/or the genotype of the cattle pollens. When the invention is applied to the molecular breeding of cattle pollenless character, pollenless gene homozygote can be selected to efficiently improve the pollenless gene frequency of the cattle of the offspring.

Description

Primer group, kit and method for detecting bovine polled gene

Technical Field

The invention relates to the technical field of gene mutation detection, in particular to a primer group, a kit and a method for detecting bovine polled genes.

Background

In nature, the oxhorn is a tool for resisting natural enemies and competing for spouses, and under intensive large-scale cultivation conditions, the existence of the horn not only can bring mutual injury to animals, but also brings safety threat to raising personnel. At present, the horn of the calf within one week of birth is usually removed in a large-scale cattle farm, but the horn has the defects that stress reaction is brought to the calf, animal growth and animal welfare are influenced, and meanwhile, manpower, material resources and financial resources are consumed. The natural pollenless is a favorable character in the production of cattle, and the method for detecting the gene of the pollenless of the cattle is developed and can be used for molecular breeding of the pollenless character of the cattle. For example, when selecting cattle, identifying and selecting polled homozygotes can rapidly increase the frequency of polled genes in the offspring cattle population.

The genetic mode of the bovine pollenless character is autosomal dominant inheritance, has the characteristic of multiple alleles, and currently, three types of pollenless genes from different sources are known to be positioned on the No.1 chromosome of a cow (reference genome: Bos _ taurus _ UMD _ 3.1). The first gene is named Celtic allele (Medgorac et al.2012) and belongs to insertion deletion type mutation (InDel) in beef cattle such as Angus cattle, French Press cattle, Simmental cattle and other beef and dairy cattle varieties, namely a 212bp repeat exists at 1,705,834 and 1,706,045bp on chromosome 1 instead of a 10bp sequence at 1,706,051 and 1,706,060bp, and the site is expressed as P_202ID. The second, called the Mongolian allele (Medgorac et al.2017), was found in Mongolian cattle and has two specific mutation sites, one is the 1bp insertion deletion at 1,975,461-1,975,487 bp, denoted as P_1ID(ii) a Second, there is a 219bp insertion at 1,976,128bp, denoted as P_219ID. The third gene, called the Friesian allele (Medugorac et al.2012), is mainly present in the breed of cows represented by holstein cows and jersey cows. There are 5 closely linked candidate mutation sites for this allele, 3 of which are Single Nucleotide Polymorphisms (SNPs), respectively: 1,654,405bp G → A (P)_G1654405A) (ii) a 1,655,463bp C → T (P)_C1655463T) (ii) a 1,768,587bp C → A (P)_C1768587A). The other 2 are insertion deletions (InDel), i.e., a 5bp segment of InDel (P) at 1,649,163-one 1,649,169bp_5ID) After 1,909,352-1,989,480bp, a tandem repeat (P) of length 80,128bp is present_80kbID) An SNP (1,909,354: T → A) and a deletion of 2bp (1,909,396D2: TG) are also present within the tandem repeat.

The detection technology of the 3 kinds of bovine pollens has been reported in the current research. Detection of the Celtic polled gene can be carried out by agarose gel electrophoresis (Medgorac et al 2012) or fragment length analysis (capillary electrophoresis) of PCR amplification products (Wiedemar et al 2014). The detection of the Mongolian poller gene was also carried out by agarose gel electrophoresis of the PCR amplification product (Medgorac et al 2017). Medgorac et al (2012), which is directed against a complex Friesian polled gene, reported a method for detecting 5 closely linked mutation sites, i.e., P was detected using a commercial kit (KASPar, KBioscience)_G1654405AAnd P_C1655463T(ii) a Detection of P Using restriction fragment Length PCR (PCR-RFLP)_C1768587A(ii) a Detection of P by PCR amplification product fragment length analysis_5ID(ii) a For the complex 80kb repeat fragment (P)_80kbID) The internal 2bp deletion was typed by PCR amplification product fragment length analysis. Wiedemar et al, (2014) reported that SNPs and P associated with Friesian pollens were determined by direct Sanger sequencing of PCR amplification products_5IDTyping is carried out to P_80kbIDDesigning a repeated fragment specific primer, carrying out agarose gel electrophoresis on a PCR amplification product, and judging whether the product carries the polled gene or not by observing the existence of a product band.

Summarizing the existing detection methods, the following problems exist: 1. there is no unified detection technology that can detect three polled alleles at the same time; 2. the existing detection method based on the Sanger sequencing technology has multiple operation steps and long time consumption, and cannot realize rapid detection; 3. for Friesian pollens, the reported PCR amplification product agarose gel electrophoresis detection can only judge whether the pollens carry the pollens or not, cannot distinguish heterozygotes and homozygotes of pollens, and does not achieve the effect of accurate typing.

KASP (Kompetitive Allle-Specific PCR) is a DNA variation typing technology which is newly appeared in recent years, is based on the competitive Allele specificity PCR principle, has the characteristics of accuracy, flexibility and low cost, and can detect different variation types such as SNP, Indel, large fragment deletion insertion and the like. Based on the KASP principle, the invention optimally designs specific primer combinations, develops a new method for simultaneously detecting 3 bovine polled genes, and obviously improves the efficiency of bovine polled gene detection.

Disclosure of Invention

In order to solve the technical problems, the invention provides a primer group, a kit and a method for quickly detecting bovine polled genes.

In order to achieve the purpose, the invention selects specific sites of 3 polled genes, including Celtic polled gene site P_202IDMongolian polled gene locus P_1IDThe Friesian pollenless gene involves the following two sites-P_C1768587AAnd P_80kbID. The invention discovers that P is utilized_80kbIDIdentifying whether it carries Friesian polled allele and simultaneously using P_C1768587AThe site is used for judging whether the gene is a homozygote or a heterozygote of the polled gene in an auxiliary way, and the detection of the Friesian polled gene can be accurately realized.

Specific primer combinations (see figure 1, table 1 below) are respectively and optimally designed aiming at the 4 sites, each primer combination comprises 3 primers, including 2 upstream primers and 1 downstream primer, wherein the 2 upstream primers are designed according to the difference of the allele sequences of the sites, different fluorescent groups (FAM and HEX) are respectively added in the KASP amplification process, and finally, genotyping is carried out according to the fluorescent signals of PCR products. The primer combinations can realize the simultaneous detection of 3 polled genes by adopting the same technical platform, thereby realizing the rapid, accurate and batch detection of the polled characters of the cattle according to the genotypes of the molecular marker loci.

TABLE 1 primer sequences

According to the above findings, the present invention provides, in the first place, a primer set for detecting bovine polled genes, comprising:

primer set I: an upstream primer:

5’-GATAGTTTTCTTGGTAGGCTGGTATTCTT-3’(SEQ ID NO.1)，

5’-GTGAGATAGTTTTCTTTGCTCTTTAGATCA-3’(SEQ ID NO.2)；

a downstream primer:

5’-TTGGGATAGACTTAAAAATGAAAAGAGAGT-3’(SEQ ID NO.3)；

primer set II: an upstream primer:

5’-TGTCAAGTGTCTCTGTCAAGAGATTCAG-3’(SEQ ID NO.4)，

5’-CTGTCAAGTGTCTCTGTCAAGATTCAGA-3’(SEQ ID NO.5)；

a downstream primer:

5’-CCTGCCATGATAAAGATGTTGGCT-3’(SEQ ID NO.6)；

primer set III: an upstream primer:

5’-CCCCTCCCCTGTGTGTG-3’(SEQ ID NO.7)，

5’-CCCTCCCCTGTGTGCA-3’(SEQ ID NO.8)；

a downstream primer:

5’-GGAAGAAACCTACATGAGTGAGTG-3’(SEQ ID NO.9)。

the primer group can simultaneously identify whether the object to be detected carries the Celtic polled gene, the Mongolian polled gene and the Friesian polled gene. Wherein, the primer group I and the primer group II can also identify the genotypes of the Celtic polled gene and the Mongolian polled gene respectively.

Preferably, the genome further comprises:

primer set IV: an upstream primer:

5’-CCAGTTTTATCTTTTTCCCCTCCAC-3’(SEQ ID NO.10)；

5’-CCAGTTTTATCTTTTTCCCCTCCAA-3’(SEQ ID NO.11)；

a downstream primer:

5’-GGTCAGGAGGCAAAACCAACAAT-3’(SEQ ID NO.12)。

since the primer set IV can further identify the genotype of the Friesian polled gene, the genotypes of the Celtic polled gene, the Mongolian polled gene and the Friesian polled gene can be simultaneously identified by using the primer set.

The primer group has good detection effect when applied to KASP, and preferably, when KASP is used for detection, two upstream primers are respectively connected with different fluorescent sequences (such as FAM and HEX).

The invention further provides application of the primer group in preparation of a bovine pollenless gene detection reagent.

The invention also provides a kit for detecting the bovine pollens, which comprises the primer group.

Preferably, the kit further comprises a PCR premix and/or a control.

Preferably, the reaction procedure of the kit in work is as follows:

(1) denaturation at 95 deg.C for 15 min;

(2) dropping PCR amplification for 10 cycles, wherein the denaturation temperature is 95 ℃, the annealing temperature is dropped from 61 ℃ to 55 ℃ in 10 cycles, and each cycle is denatured for 20-30 sec and extended for 45-60 sec;

(3) performing conventional PCR amplification for 26 cycles, wherein the denaturation temperature is 95 ℃, the annealing temperature is 55 ℃, the denaturation time is 20-30 sec, and the extension time is 45-60 sec in each cycle;

(4) extension at 37 ℃ for 60 sec.

As a preferred embodiment, in step 2), the reaction procedure of the PCR amplification is as follows:

(1)95℃，15min；

(2)95 ℃, 20sec, 61-55 ℃, 60sec, and 10 cycles of reduction by 0.6 ℃ per cycle;

(3)95 ℃, 20sec, 55 ℃, 60sec, 26 cycles;

(4)37℃，60sec。

preferably, the kit is provided with reaction systems aiming at the primer groups I to IV respectively during work, and the reaction system of 1 microliter is as follows:

wherein the primer mixed solution contains any one of primer groups I-IV;

preferably, in the primer mixture, the concentration of each upstream primer is 8-12 mu M, and the concentration of each downstream primer is 20-30 mu M.

The invention further provides a method for detecting bovine polled genes, which comprises the following steps:

1) extracting DNA of a sample to be detected;

2) performing PCR amplification by using the genome or the kit;

3) judging whether the sample to be detected carries the bovine pollenless gene or not according to the amplification result; and/or judging the bovine pollenosis genotype of the sample to be detected.

As described above, the primer group I and the primer group II can identify whether the object to be tested carries the Celtic polled gene and the Mongolian polled gene, and can also identify the genotypes of the Celtic polled gene and the Mongolian polled gene respectively; the primer group III can identify whether the object to be detected carries the Friesian pollens, and the primer group IV can further identify the genotypes of the Friesian pollens. The primer set provided by the invention can be selected by the skilled person according to the needs.

Preferably, KASP is used for the detection.

Preferably, the reaction procedure of the PCR amplification in step 2) is as follows:

(1)95℃，15min；

(2) reducing the temperature by 0.6 ℃ per cycle for 10 cycles at 95 ℃, 20-30 sec, 61-55 ℃, 45-60 sec;

(3) 26 cycles of 95 ℃, 20-30 sec, 55 ℃, 45-60 sec;

(4)37℃，60sec。

preferably, in step 2), reaction systems are prepared for the primer sets I to IV in the PCR amplification, respectively, and 1 μ L of the reaction system is as follows:

wherein the primer mixed solution contains any one of primer groups I-IV;

In some embodiments, when the PCR amplification is completed, a fluorescence signal scanner (e.g., product No. G020010) is used to scan and determine the genotype based on a scatter plot of the fluorescence signal.

The specific determination method is as follows:

1) celtic pollenless gene P_202IDIn the locus detection results, the genotypes corresponding to the insN/insN, the-/insN and the' -/-respectively are homozygous polled, heterozygous polled and horned genotypes.

2) Mongolian polled gene P_1IDIn the site detection results: "insN/insN"; the genotypes corresponding to "-/insN" and "-/" are homozygous polled, heterozygous polled and horned genotypes, respectively.

3) Friesian pollenless gene P_80kbIDIn the detection result of the locus, "insN" and "-/-" respectively correspond to the carrier polled gene and the carrier polled gene; at P_80kbIDIn individuals whose site detection result is "insN", P_C1768587AThe locus detection result 'CA' is heterozygous polled, and 'AA' is homozygous polled.

The invention further provides application of the primer group, the kit or the method in bovine molecular breeding.

The invention further provides application of the primer group, the kit or the method in early prediction of the horny or polled traits of cattle.

The invention further provides application of the primer group, the kit or the method in screening hornless cattle or eliminating horned cattle.

The invention has the following beneficial effects:

the method can simultaneously detect the Celtic pollex gene, the Mongolian pollex gene and the Friesian pollex gene, and can quickly, accurately and massively realize the detection of the phenotype and/or the genotype of the cattle pollex character. When the invention is applied to the molecular breeding of cattle pollenless characters, the pollenless gene frequency of a progeny cattle group can be efficiently improved.

Drawings

FIG. 1 shows the positions of 3 kinds of bovine polled gene mutation sites and primers designed by the present invention, wherein F is a forward primer and R is a reverse primer;

FIG. 2 shows the Celtic polled gene P of example 2_202IDA locus typing scattergram;

FIG. 3 shows the Mongolian polled gene P of example 2_1IDA locus typing scattergram;

FIG. 4 shows Friesian pollens P from example 2_C1768587AA parting scatter diagram;

FIG. 5 shows Friesian pollens P from example 2_80kbIDA parting scatter diagram;

FIG. 6 shows Celtic polled gene P of example 3_202IDCarrying out agarose gel electrophoresis typing on a gel picture of a site PCR product;

FIG. 7 shows the Mongolian polled gene P of example 3_219IDCarrying out agarose gel electrophoresis typing on a gel picture of a site PCR product;

FIG. 8 shows Friesian pollens P from example 3_C1768587ASite Sanger sequencing peak plot;

FIG. 9 shows Friesian pollens P from example 3_80kbIDAgarose gel electrophoresis of the site PCR product was used to shape the gel images.

Detailed Description

The following examples are intended to illustrate the invention but are not intended to limit the scope of the invention.

Example 1 Process for design and optimization of primer set

Based on the 3 kinds of polled gene sequences, typing primer groups I, II and III are designed. Wherein the primer set I is according to P_202IDOptimally designing the specific sequences of 2 alleles of the locus, and utilizing the difference of the tail ends of the repeated sequences; primer set II is according to P_219IDOptimally designing the specific sequences of 2 alleles at the site, and replacing 6 bases at 628bp upstream of the repetitive sequence by 7 bases (resulting in 1bp length difference); the primer III is according to P_80kbIDSite 2The specific sequence of each allele is optimally designed, and 2bp deletion in a repetitive sequence is utilized.

The optimization design process of the primer III is specifically explained as an example. Specifically, the inventors' Sanger sequencing of P80kbID site of the Friesian polled gene showed the following results, where original 80Kb sequence is shown in parentheses "{ }" and 80Kb sequence of copy 2 unique to the Friesian polled allele is shown in brackets "[ ]".

Partial sequence of wild-type allele

{AGTGCAGAAGTCGGTGGTCTGAAAGGTCGCCCCTCCCCTGTGTGTGCACACGTACACACTCACTCATGTAGGTTTCTTCCAG(SEQ IDNO.13)……GCTTCCTTGGTGGCTCAGTC}AGTAAAGAATCTGCCTGC(SEQ ID NO.14)

Partial sequence of polled allele

{AGTGCAGAAGTCGGTGGTCTGAAAGGTCGCCCCTCCCCTGTGTGTGCACACGTACACACTCACTCATGTAGGTTTCTTCCAG(SEQ ID NO.13)……GCTTCCTTGGTGGCTCAGTC}[AGAGCAGAAGTCGGTGGTCTGAAAGGTCGCCCCTCCCCTGTGTGCACACGTACACACTCACTCATGTAGGTTTCTTCCAGGGCCCAGAG(SEQ ID NO.15)……GGGGCTTCCTTGGTGGCTCAGTC]TAAAGAATCTGCCTGCAATGC(SEQ ID NO.16)

The comparison sequencing result shows that 3 base variations (marked by a lower-dotted wavy line) exist in the 2 nd copy 80Kb sequence of the Friesian polled allele, and comprise 1) AGT starting mutation to AGA, 2) TGTGTGTG at the 39 th-46 bp position mutation to TGTGTGTG, and 3) AGTAAA mutation to TAAA from the base immediately after 80Kb repetition. The inventors tried to design typing primers at the above three mutation sites, but only the primer design at the 2 nd mutation was successful, and the primer design at the remaining two mutation sites failed.

The primer group III can detect whether the Friesian pollens exist or not through preliminary detection, but can not determine homozygote and heterozygote because the wild type sequence and the first copy sequence of the mutant type are found in P through Sanger sequencing_80kbIDThe genotypes of the loci were completely identical. To solve this problem, the inventors introduced another mutation site (P) closely related to the Friesian pollenless gene_C1768587A) Design of primer group IV can realize the accuracy of Friesian polled geneAnd (4) parting.

EXAMPLE 2 typing assay for three bovine polled genes

The frozen semen of 39 bulls of different breeds is collected, and the genome DNA is extracted by a high-salt method. Wherein the sample comprises 9 cows of Holstein and Jersey; beef cattle of 17 heads, the breeds including Angus cattle, Flevilch cattle, Charolly cattle, Riwood Zan cattle and Simmental cattle; in addition, 13 cattle are selected from Sanhe cattle, Qinchuan cattle and Mongolian cattle in China.

SNP typing is carried out based on the principle of KASP competitive allele specificity PCR, wherein PCR reaction is finished on a microfluidic chip (Beijing Boo classical biotechnology, product number G020010), and the method comprises the following steps:

1) injecting 5-10 ng of genomic DNA of a sample to be detected into a chip hole on a special microfluidic chip;

2) and respectively preparing PCR amplification reaction mixed liquor aiming at the 4 sites. The reaction mix for each site contained site-specific primers (table 1), PCR mix and double distilled water. Injecting the prepared mixed solution into the chip reaction hole from the microfluidic chip injection hole by using a liquid transfer device, and sealing the inlet and the outlet; wherein, the PCR reaction system in each chip hole is prepared as follows:

wherein, the PCR premix (2 × univarial KASP Master Mix) is purchased from LGC (UK), the concentration of 2 allele-specific primers in the primer mixture is 12 μ M, and the concentration of downstream universal primer is 30 μ M.

3) Putting the chip into a centrifuge to centrifuge for 1min at 4000 rpm;

4) placing the mixture into a chip heat sealing instrument for heat sealing for 1 sec;

5) putting the mixture on a flat PCR instrument for amplification reaction, wherein the PCR amplification procedure is as follows: firstly, denaturing at 95 ℃ for 15min, then performing touchdown PCR (touchdown PCR) amplification for 10 cycles, wherein the denaturation temperature is 95 ℃, the annealing temperature is lowered from 61 ℃ to 55 ℃ in 10 cycles, and each cycle is denatured for 20sec and extended for 60 sec; then carrying out conventional PCR amplification for 26 cycles, wherein the denaturation temperature is 95 ℃, the annealing temperature is 55 ℃, and the denaturation and extension are 20sec and 60sec in each cycle; and finally an extension of 60sec at 37 ℃.

6) And after the PCR amplification program is operated, putting the chip into a fluorescence signal scanner for scanning to generate an image file, converting the image file into a data signal value through software, and then typing based on a scatter diagram.

The detailed results of the detection are shown in table 2. Celtic pollenless gene P_202IDThe locus typing scattergram is shown in FIG. 2; mongolian polled gene P_1IDThe locus typing scattergram is shown in FIG. 3; friesian pollenless gene P_C1768587A、P_80kbIDThe site-specific scattergrams are shown in fig. 4 and 5, respectively.

TABLE 2 test results

Example 3 conventional testing verifies the accuracy of the KASP method

To verify the accuracy of the KASP assay results, all 39 samples were subjected to target site PCR amplification and polled by agarose gel electrophoresis or Sanger sequencing.

(1) PCR primer

The detection was carried out for different polled gene loci using primers reported in the literature and designed on-line with Primer3.0(http:// bioinfo. ut. ee/primer3/), the details of which are given in Table 3.

TABLE 3 primer sequences and amplified fragment lengths

(1) PCR amplification

And (3) PCR reaction system: a total volume of 25. mu.L, 10 XBuffer 2.5. mu.L, 2. mu.L of dNTP mix (2.5 mM each), 0.5. mu.L of Taq enzyme (5U/. mu.L), 0.5. mu.L of upstream and downstream primers (20. mu.M each), 1. mu.L of genomic DNA template (about 50ng), was made up to 25. mu.L with double distilled water.

And (3) PCR reaction conditions: pre-denaturation at 94 ℃ for 5 min; then 35 cycles, 94 ℃ denaturation 30sec, primer corresponding annealing temperature renaturation 30sec, 72 ℃ extension 30 sec; finally, extension was carried out at 72 ℃ for 7 min.

The instrument is an Applied Biosystems model 9700 PCR instrument.

(3) Gel electrophoresis and Sanger sequencing of PCR products

P_219ID、P_80kbIDAnd P_202IDThe PCR products of the loci are detected and typed by agarose gel electrophoresis, P_C1768587ASites were typed using direct Sanger sequencing of PCR products.

A2% agarose gel was prepared, and 4. mu.L of the PCR product from each sample was spotted, followed by electrophoresis in TAE buffer at 110V for 20min, and the results of the electrophoresis were observed in a gel imaging system. The PCR product gel maps are shown in FIG. 6, FIG. 7 and FIG. 9, respectively. The Sanger sequencing peak diagram is shown in FIG. 8.

The typing result is completely consistent with the KASP result, which shows that the detection method is accurate.

Although the invention has been described in detail hereinabove by way of general description, specific embodiments and experiments, it will be apparent to those skilled in the art that many modifications and improvements can be made thereto based on the invention. Accordingly, such modifications and improvements are intended to be within the scope of the invention as claimed.

Sequence listing

<110> university of agriculture in China

<120> primer set, kit and method for detecting bovine polled gene

<130> KHP201112663.2

<160> 24

<170> SIPOSequenceListing 1.0

<210> 1

<211> 29

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

gatagttttc ttggtaggct ggtattctt 29

<210> 2

<211> 30

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

gtgagatagt tttctttgct ctttagatca 30

<210> 3

<211> 30

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

ttgggataga cttaaaaatg aaaagagagt 30

<210> 4

<211> 28

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

tgtcaagtgt ctctgtcaag agattcag 28

<210> 5

<211> 28

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

ctgtcaagtg tctctgtcaa gattcaga 28

<210> 6

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

cctgccatga taaagatgtt ggct 24

<210> 7

<211> 17

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

cccctcccct gtgtgtg 17

<210> 8

<211> 16

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

ccctcccctg tgtgca 16

<210> 9

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

ggaagaaacc tacatgagtg agtg 24

<210> 10

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

ccagttttat ctttttcccc tccac 25

<210> 11

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

ccagttttat ctttttcccc tccaa 25

<210> 12

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

ggtcaggagg caaaaccaac aat 23

<210> 13

<211> 82

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

agtgcagaag tcggtggtct gaaaggtcgc ccctcccctg tgtgtgcaca cgtacacact 60

cactcatgta ggtttcttcc ag 82

<210> 14

<211> 38

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

gcttccttgg tggctcagtc agtaaagaat ctgcctgc 38

<210> 15

<211> 109

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

gcttccttgg tggctcagtc agagcagaag tcggtggtct gaaaggtcgc ccctcccctg 60

tgtgcacacg tacacactca ctcatgtagg tttcttccag ggcccagag 109

<210> 16

<211> 44

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

ggggcttcct tggtggctca gtctaaagaa tctgcctgca atgc 44

<210> 17

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

tcaagaaggc ggcactatct 20

<210> 18

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 18

tataggcaga gggtcagttt atca 24

<210> 19

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 19

ccatgggtca ctcctacctt 20

<210> 20

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 20

tcgttgcatt gttcagcaat 20

<210> 21

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 21

aggaggttgg catttgattg 20

<210> 22

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 22

aaatccagag ttgagccgat 20

<210> 23

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 23

tatcacctgc catgataa 18

<210> 24

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 24

gagtcccatc tattgtcc 18

Claims

1. A primer set for detecting bovine polled genes, comprising:

primer set I: an upstream primer:

5’-GATAGTTTTCTTGGTAGGCTGGTATTCTT-3’，

5’-GTGAGATAGTTTTCTTTGCTCTTTAGATCA-3’；

a downstream primer:

5’-TTGGGATAGACTTAAAAATGAAAAGAGAGT-3’；

primer set II: an upstream primer:

5’-TGTCAAGTGTCTCTGTCAAGAGATTCAG-3’，

5’-CTGTCAAGTGTCTCTGTCAAGATTCAGA-3’；

a downstream primer:

5’-CCTGCCATGATAAAGATGTTGGCT-3’；

primer set III: an upstream primer:

5’-CCCCTCCCCTGTGTGTG-3’，

5’-CCCTCCCCTGTGTGCA-3’；

a downstream primer:

5’-GGAAGAAACCTACATGAGTGAGTG-3’。

2. the primer set according to claim 1, further comprising:

primer set IV: an upstream primer:

5’-CCAGTTTTATCTTTTTCCCCTCCAC-3’；

5’-CCAGTTTTATCTTTTTCCCCTCCAA-3’；

a downstream primer:

5’-GGTCAGGAGGCAAAACCAACAAT-3’。

3. use of the primer set according to claim 1 or 2 for preparing a bovine polled gene detection reagent.

4. A kit for detecting bovine polled genes, comprising the primer set of claim 1 or 2;

preferably, the kit further comprises a PCR premix and/or a control.

5. A method for detecting bovine polled genes, comprising:

1) extracting DNA of a sample to be detected;

2) performing PCR amplification using the genome of claim 1 or 2 or the kit of claim 4;

3) judging whether the sample to be detected carries the bovine pollenless gene or not according to the amplification result; and/or judging the bovine pollenosis genotype of the sample to be detected;

preferably KASP is used for the detection.

6. The method of claim 5, wherein in step 2), the reaction procedure of the PCR amplification is as follows:

(1)95℃，15min；

(3) 26 cycles of 95 ℃, 20-30 sec, 55 ℃, 45-60 sec;

(4)37℃，60sec。

7. the method according to claim 5 or 6, wherein in step 2), reaction systems are provided for the primer sets I to IV, respectively, and 1. mu.L of the reaction systems are as follows:

wherein the primer mixed solution contains any one of primer groups I-IV;

8. Use of the primer set according to claim 1 or 2, the kit according to claim 4, or the method according to any one of claims 5 to 7 for molecular breeding of cattle.

9. Use of the primer set of claim 1 or 2, the kit of claim 4 or the method of any one of claims 5 to 7 for the early prediction of bovine horny or polled traits.

10. Use of the primer set of claim 1 or 2, the kit of claim 4 or the method of any one of claims 5 to 7 for screening hornless cattle or culled cattle.