CN113789363B

CN113789363B - DTNS-mediated method for detecting 8-OG DNA glycosylase activity

Info

Publication number: CN113789363B
Application number: CN202111082138.7A
Authority: CN
Inventors: 吴玉姝; 吴敏; 刘敏; 韩军
Original assignee: Liaocheng University
Current assignee: Liaocheng University
Priority date: 2021-09-15
Filing date: 2021-09-15
Publication date: 2023-07-28
Anticipated expiration: 2041-09-15
Also published as: CN113789363A

Abstract

The invention belongs to the technical fields of biological detection and molecular biology, and particularly relates to a method for detecting 8-OGDNA glycosylase activity mediated by DTNS. Under the action of 8-OG DNA glycosylase, the structure of DTNS is changed from open state to closed state, and the distance between Cy3 donor and Cy5 acceptor is made to be close, so that efficient FRET is initiated. By utilizing the method, the activity of extracellular 8-OG DNA glycosylase can be sensitively and selectively detected, false positive signals generated by nuclease degradation can be prevented based on a FRET signal output mode, and the method is favorable for accurate imaging in living cells.

Description

DTNS-mediated method for detecting 8-OG DNA glycosylase activity

Technical Field

The invention belongs to the technical fields of biological detection and molecular biology, and particularly relates to a method for detecting 8-OG DNA glycosylase activity mediated by DTNS.

Background

The disclosure of this background section is only intended to increase the understanding of the general background of the invention and is not necessarily to be construed as an admission or any form of suggestion that this information forms the prior art already known to those of ordinary skill in the art.

8-oxidized guanine (8-OG) DNA glycosylase is a DNA repair enzyme used to repair a commonly oxidized DNA damage 8-OG. The enzyme recognizes 8-OG in double-stranded DNA and nicks glycosidic bonds to create a purine-free/pyrimidine-free (AP) site, which is then excised by the AP-cleavage activity inherent to the enzyme. However, abnormalities in intracellular 8-OG DNA saccharification enzyme activity can lead to incorrect base pairing between 8-OG and adenine during DNA replication, causing genetic mutations and increasing the incidence of several diseases, including digestive and pulmonary tumors. Thus, accurate and in situ detection of intracellular 8-OG DNA glycosylase activity is of great importance for understanding the function of 8-OG DNA glycosylase and for further investigation of mutation-related diseases.

Methods for detecting 8-OG DNA glycosylase activity include radiolabeling, HPLC, electrochemical, colorimetry and fluorescence. These methods generally detect 8-OG DNA glycosylase activity in buffer solutions or cell extracts and do not directly reflect the level of activity of the enzyme in the complex environment of living cells. In order to reveal the cellular processes involved in 8-OG DNA glycosylase and explore its mechanism of action, in situ fluorescence methods based on DNA functionalized nanomaterials have been developed for imaging intracellular 8-OG DNA glycosylase activity. These in situ fluorescence methods only show information on the activity of intracellular 8-OG DNA glycosylase by single fluorescence signal intensity. Although significant progress has been made, these in situ fluorescence methods, which rely on single fluorescence signal intensities, are still subject to interference by false positive signals generated by degradation of intracellular nucleases, thereby affecting detection accuracy. Thus, accurate and in situ imaging of intracellular 8-OG DNA glycosylase activity remains a challenge.

Disclosure of Invention

In order to solve the defects in the prior art, the invention provides a method for detecting the activity of 8-OG DNA glycosylase mediated by a DNA Tetrahedron Nano Switch (DTNS), and under the action of the 8-OG DNA glycosylase, the structure of the DTNS is changed from an open state to a closed state, so that the distance between a Cy3 donor and a Cy5 acceptor is close, and high-efficiency FRET is initiated. By utilizing the method, the activity of extracellular 8-OG DNA glycosylase can be sensitively and selectively detected, false positive signals generated by nuclease degradation can be prevented based on a FRET signal output mode, and the method is favorable for accurate imaging in living cells.

The invention specifically provides the following technical scheme:

the first aspect of the present invention provides a DNA tetrahedral nano-switch comprising: a DNA tetrahedron, wherein a double-stranded DNA probe is connected to one vertex of the DNA tetrahedron;

wherein the double-stranded DNA probe is formed by hybridization of a recognition chain containing 8-OG and a reporter chain marked with a donor/acceptor double fluorophore.

In a second aspect, the present invention provides a DTNS-mediated method for detecting the activity of 8-OG DNA glycosylase in an extracellular target, comprising:

(1) Constructing a DNA tetrahedron nano switch;

(2) Incubating extracellular targets and DNA tetrahedral nanoswitchs together;

(3) Fluorescence spectroscopy measurements were performed.

In a third aspect, the invention provides a method for DTNS-mediated imaging of the ratio of 8-oxidized guanine DNA glycosylase activity in living cells, comprising:

(1) Constructing a DNA tetrahedron nano switch;

(2) Incubating target cells and DNA tetrahedron nano switches together.

(3) Confocal laser scanning microscopy imaging was performed.

One or more embodiments of the present invention have at least the following beneficial effects:

the invention provides a DTNS mediated method for detecting the activity of 8-OG DNA glycosylase. Under the action of 8-OG DNA glycosylase, the structure of DTNS is changed from open state to closed state, and the distance between Cy3 donor and Cy5 acceptor is made to be close, so that efficient FRET is initiated. By using the method, the sensitive and selective detection of extracellular 8-OG DNA glycosylase activity is realized. In addition, based on the FRET signal output mode, the invention can prevent false positive signals generated by nuclease degradation and is beneficial to accurate imaging in living cells. In addition, in combination with the good cellular uptake capacity of DTNS, the present invention has been successfully used for accurate, in situ imaging of 8-OG DNA glycosylase activity in living cells. The present invention provides a promising tool for accurate and in situ analysis of intracellular 8-OG DNA glycosylase activity, which aids in the in-depth understanding of 8-OG DNA glycosylase function and further study of mutation related diseases.

Drawings

The accompanying drawings, which are included to provide a further understanding of the invention and are incorporated in and constitute a part of this specification, illustrate embodiments of the invention and together with the description serve to explain the invention.

FIG. 1 is a schematic diagram of a DTNS-mediated FRET strategy for ratio imaging of 8-OG DNA glycosylase activity in living cells;

fig. 2: (A) Agarose gel electrophoresis characterization of DNA tetrahedra and (B) DTNS; (C) Fluorescence emission spectra of DTNS in the presence and absence of target 8-OG DNA glycosylase.

FIG. 3 (A) fluorescence emission spectra of DTNS in the presence of target 8-OG DNA glycosylase at different concentrations; (B) F (F) _A /F _D A standard curve of ratio versus target 8-OG DNA glycosylase concentration; (C) Fluorescence emission spectrum of DTNS and (D) F in the presence of target or other DNA glycosylase _A /F _D Ratio of; error bars are standard deviations of the results of three parallel experiments.

FIG. 4 shows the F of DTNS in the presence and absence of DNaseI _A /F _D A ratio profile over time; error bars are standard deviations of the results of three parallel experiments.

FIG. 5 confocal fluorescence imaging of HeLa intracellular 8-OG DNA glycosylase activity using (A) DTNS and (B) control DTNS; a graduated scale: 20 μm.

Detailed Description

It should be noted that the following detailed description is exemplary and is intended to provide further explanation of the invention. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

It is noted that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of exemplary embodiments according to the present invention. As used herein, the singular is also intended to include the plural unless the context clearly indicates otherwise, and furthermore, it is to be understood that the terms "comprises" and/or "comprising" when used in this specification are taken to specify the presence of stated features, steps, operations, devices, components, and/or combinations thereof.

As described in the background art, the prior art methods for detecting the activity of 8-OG DNA glycosylase generally only detect the activity of 8-OG DNA glycosylase in buffer solutions or cell extracts, and cannot directly reflect the level of activity of the enzyme in the complex environment of living cells. While in situ fluorescence methods based on DNA functionalized nanomaterials can be used to image the intracellular 8-OG DNA glycosylase activity, these in situ fluorescence methods only display the information of the intracellular 8-OG DNA glycosylase activity by a single fluorescence signal intensity, and these in situ fluorescence methods relying on a single fluorescence signal intensity can be interfered by false positive signals generated by degradation of intracellular nucleases, thereby affecting the detection accuracy.

To solve the above technical problem, a first aspect of the present invention provides a DNA tetrahedral nano-switch, comprising: a DNA tetrahedron, wherein a double-stranded DNA probe is connected to one vertex of the DNA tetrahedron;

The DNA tetrahedron nano switch provided by the invention has the advantages that the distance between the donor and acceptor double fluorophores is far in the initial stage, and no FRET occurs. Under the action of 8-OG DNA glycosylase, 8-OG in the double-stranded DNA probe is removed and the resulting apurinic/Apyrimidinic (AP) site is also nicked, thus the reporter strand dissociates from the double-stranded DNA and forms a hairpin structure, bringing the donor/acceptor bifluorescens close to each other, and efficient FRET occurs.

The construction of the DNA tetrahedron nano switch can sensitively and selectively detect the activity of extracellular 8-OG DNA glycosylase. More importantly, based on the FRET signal output mode, false positive signals caused by nuclease degradation can be avoided, so that detection accuracy is improved. In addition, the good cell uptake capacity of the combined DTNS can accurately and in-situ image the activity of 8-OG DNA glycosylase in cells.

Further, the preparation method of the DNA tetrahedron comprises the following steps:

1) Preparation of DNA tetrahedra: mixing the four DNA chains in equimolar amount, heating at 90-95deg.C for 5-10min, rapidly transferring into ice water bath, cooling for 20-40min, and standing at 3-5deg.C for 1-2 hr;

2) Preparation of double-stranded DNA probe R-H: mixing the recognition chain R and the reporter chain H in equimolar amounts, and incubating at 25 ℃ for 1-1.5H;

3) Preparation of DTNS: the DNA tetrahedron prepared above and double-stranded DNA probe R-H were mixed in equimolar amounts and incubated at 25℃for 1-1.5H.

The preparation of the DNA tetrahedron and the double-stranded DNA probe R-H, DTNS are all carried out in 1 XPBS buffer.

(1) Constructing a DNA tetrahedron nano switch;

(2) Incubating extracellular targets and DNA tetrahedral nanoswitchs together;

(3) Fluorescence spectroscopy measurements were performed.

Further, incubation is carried out at 37℃for 60-100min, preferably 90min.

Further, in the fluorescence spectrum measurement process, the excitation wavelength is 525nm, and the emission wavelength is 550nm-750nm. The excitation and emission slit width was 10nm and the photomultiplier voltage was 700V.

(1) Constructing a DNA tetrahedron nano switch;

(2) Incubating target cells and DNA tetrahedron nano switches together.

(3) Confocal laser scanning microscopy imaging was performed.

Further, the target cells were first cultured in DMEM medium supplemented with 10% fbs and 1% penicillin-streptomycin, then inoculated on confocal dishes, incubated for 20-25h, and then co-incubated with DNA tetrahedron nanoswitch.

Further, the incubation time is 2-4 hours, preferably 3 hours.

Further, in the confocal laser scanning microscope imaging process, cy3 emission light in the range of 550nm-639nm and Cy5 emission light in the range of 640nm-700nm are collected under excitation light of 543nm wavelength.

In order to enable those skilled in the art to more clearly understand the technical scheme of the present invention, the technical scheme of the present invention will be described in detail with reference to specific embodiments.

1. Experimental procedure

(1) Materials and instruments

The DNA oligonucleotides used in the present invention were synthesized and purified by the manufacturer (China, shanghai), and specific sequences are shown in Table 1.8-OG DNA glycosylase (Fpg), uracil DNA Glycosylase (UDG), alkylated adenine DNA glycosylase (hAAG), DNase I (DNase I) were all purchased from New England Biolabs (China, beijing). Fetal Bovine Serum (FBS) was purchased from the organism double (china, shanghai). Cell culture media DMEM and RPMI-1640 purchased Yu Punuo race (chinese, armed). Penicillin-streptomycin solution, pancreatin was purchased from bi yun (china, shanghai).

Agarose gel imaging was performed using the 4600SF gel imaging system (China, tiancan). The fluorescence spectrum measurement adopts an F-7000 fluorescence spectrophotometer. Confocal fluorescence imaging was performed using an LSM-880 confocal laser scanning microscope (Zeiss, germany).

(2) Preparation of DTNS

First, DNA tetrahedra are prepared. Four DNA strands were mixed in equimolar amounts in 1 XPBS buffer (pH 7.4). The mixed sample was heated at 95℃for 5min, then rapidly transferred to an ice-water bath for cooling for 30min, followed by 1h at 4 ℃. The prepared samples were stored at 4℃for further use.

Second, a double-stranded DNA probe R-H was prepared. The recognition strand R and reporter strand H were mixed in equimolar amounts in 1 XPBS buffer (pH 7.4) and incubated for 1H at 25 ℃.

Finally, DTNS was prepared. The DNA tetrahedron prepared above and double-stranded DNA probe R-H were mixed in equimolar amounts in 1 XPBS buffer (pH 7.4) and incubated for 1H at 25 ℃. The final DTNS concentration was 500nM.

(3) Electrophoretic characterization

DNA tetrahedra and unlabeled DTNS were characterized by agarose gel electrophoresis. 2.5% agarose gel was prepared: 1.5g agarose, 60mL 1 XTBE buffer, 8.0. Mu.L nucleic acid dye GelRed. 10.0. Mu.L of DNA sample was mixed with 2.0. Mu.L of 6 Xgel loading buffer, and then 6.0. Mu.L of the mixture was taken for sizing. Electrophoresis was run in 1 XTBE buffer for about 1 hour at 100V voltage.

(4) Detection of extracellular target 8-OG DNA glycosylase Activity

To detect extracellular target 8-OG DNA glycosylase activity, 100. Mu.L of a mixed solution of 1 XNEBuffer 1 and 100. Mu.g/mL Bovine Serum Albumin (BSA) containing 100nM DTNS at different concentrations of target (0U/mL, 1.0U/mL,2.0U/mL,5.0U/mL,8.0U/mL,10U/mL and 20U/mL) was incubated at 37℃for 90min. Then, fluorescence spectrum measurement is performed on the mixed solution. The excitation wavelength is 525nm, and the emission wavelength is 550nm-750nm. The excitation and emission slit width was 10nm and the photomultiplier voltage was 700V. In addition, in order to study the selectivity, other steps were consistent with the above except that the target 8-OG DNA glycosylase was replaced with another DNA glycosylase.

(5) Investigation of the ability to prevent false Positive signals

To investigate the preventive capacity of this strategy for false positive signals caused by DNase I degradation, 100. Mu.L of a mixed solution containing 100nM DTNS,0.5U/mL DNase I,1 XPBS buffer (pH 7.4) was incubated at 37℃for 2h. The control group was the same as above except that DNase I was not present. The spectral conditions at the time of measuring the fluorescence spectrum are the same as those in (4).

(6) Cell culture

HeLa cells were cultured in DMEM medium supplemented with 10% FBS and 1% penicillin-streptomycin. MCF-7 cells were cultured in RPMI-1640 medium supplemented with 10% FBS and 1% penicillin-streptomycin. All cell lines were placed at 37℃with 5% CO ₂ Is cultured in a cell culture vessel.

(7) Confocal fluorescence imaging 8-OG DNA glycosylase Activity in living cells

To ratio image 8-OG DNA glycosylase activity in living cells, heLa cells were seeded on confocal dishes and incubated for 24h. HeLa cells were then incubated with 100nM DTNS or control DTNS for 3h. Subsequently, the cells were washed three times with PBS for confocal laser scanning microscopy imaging. At 543nm wavelength of excitation light, cy3 emission light in the range of 550nm-639nm and Cy5 emission light in the range of 640nm-700nm were collected.

2. Analysis of results

(1) Design principle of DTNS-mediated FRET strategy

The design principle of the invention is shown in figure 1, and the designed DTNS consists of two parts: DNA tetrahedra and double stranded DNA probes. The DNA tetrahedron is assembled from four custom DNA strands (A, B, C, D, table 1) with a short single strand of DNA overhanging the vertices. The double-stranded DNA probe is formed by hybridization of a recognition strand containing an 8-OG damaged base and a reporter strand labeled with a Cy3/Cy5 double fluorophore, and a short single-stranded DNA whose terminal is suspended complementary to the DNA sequence suspended at the vertex of the tetrahedron. Thus, the double-stranded DNA probe can be ligated to one vertex of a DNA tetrahedron by base-pairing to obtain DTNS.

Initially, DTNS was in an open state, and the labeled Cy3 donor and Cy5 acceptor were separated from each other, resulting in inefficient FRET. However, when 8-OG DNA glycosylase is present, the structure of DTNS changes from an open state to a closed state. Specifically, the 8-OG DNA glycosylase removes the 8-OG from the double-stranded DNA probe and cleaves the generated AP site, causing the double-stranded DNA to unwind and release the reporter strand. Subsequently, the released reporter strand forms a hairpin structure by base-pairing, bringing the distance between the Cy3 donor and the Cy5 acceptor close, and efficient FRET occurs. In addition, DTNS readily enters living cells due to the good cellular uptake capacity of DNA tetrahedra, and the fluorescence intensity of Cy3 donor is reduced and the fluorescence intensity of Cy5 acceptor is increased by the action of intracellular 8-OG DNA glycosylase.

(2) Characterization and detection feasibility study of DTNS

To verify the formation of DTNS, agarose gel electrophoresis analysis was performed. First, as four DNA strands are added one by one, the electrophoretic mobility of the product bands gradually decreases (FIG. 2A). This is due to the increasing molecular weight of the hybridization product and its more complex spatial structure, indicating that the DNA tetrahedra have been successfully assembled. Next, recognition strand R was mixed in equal amounts with reporter strand H, only one band was observed in lane 2, and the electrophoretic mobility of this band was lower than that of reporter strand H in lane 1 (FIG. 2B), indicating that R and H hybridized to form a DNA double strand R-H with a higher molecular weight. Finally, mixing the DNA double strand R-H with equal amounts of DNA tetrahedra, it was observed in lane 4 that both the R-H band and the tetrahedral band disappeared, but a new band with lower mobility appeared (FIG. 2B), indicating that the DNA double strand R-H had been attached to the DNA tetrahedra, thereby forming DTNS.

In addition, the feasibility of DTNS-mediated FRET for detecting target 8-OG DNA glycosylase activity was examined extracellularly. As shown in fig. 2C, the fluorescence intensity of the Cy3 donor at 565nm decreased, while the fluorescence intensity of the Cy5 acceptor at 665nm increased, after the target was added. This suggests that DTNS can effectively recognize the target and undergo a transition of structure from open to closed state, triggering efficient FRET, thus verifying the feasibility of the present strategy for extracellular detection of targets.

(3) Extracellular analytical performance of the DTNS-mediated FRET strategy

Subsequently, the ability of the DTNS-mediated FRET strategy to quantitatively detect the target 8-OG DNA glycosylase activity was examined extracellularly. As shown in fig. 3A, cy3 donor fluorescence gradually decreases and Cy5 acceptor fluorescence gradually increases with increasing target concentration. And, fluorescence ratio of Cy5 acceptor to Cy3 donor (F _A /F _D ) Shows good linearity with target concentration in the range of 0U/mL to 10U/mL (FIG. 3B). The detection limit of the 8-OG DNA glycosylase activity of the strategy is 0.3653U/mL, which is superior or equivalent to the previous study.

To investigate the selectivity of this strategy, other DNA glycosylase activities were also detected extracellularly by this strategy. As shown in FIGS. 3C and 3D, only the target 8-OG DNA glycosylase triggers efficient FRET and high F _A /F _D The ratio, which confirms that the present strategy has good selectivity.

Thus, the strategy is capable of detecting the 8-OG DNA glycosylase activity of a target object sensitively and selectively outside cells, and also suggests that the strategy has potential application to cell imaging of the 8-OG DNA glycosylase activity.

(4) Examining the ability of the DTNS-mediated FRET strategy to prevent false positive signals

To examine the preventive ability of the strategy against false positive signals, DNaseI against background F was studied _A /F _D Influence of the ratio. DNaseI is an endonuclease that hydrolyzes both single-stranded and double-stranded DNA. As shown in FIG. 4, after DNaseI is added to the DTNS, F of the background _A /F _D The ratio does not rise but falls slightly. This is because after DTNS is degraded by dnaseli, the distance between the Cy3 donor and Cy5 acceptor will be further, and no FRET occurs. This result indicates that this strategy prevents false positive signals caused by nuclease degradation, which is critical for accurate imaging within cells.

(5) Intracellular imaging of 8-OG DNA glycosylase activity

Based on the above results, the feasibility of the DTNS-mediated FRET strategy for ratiometric imaging of 8-OG DNA glycosylase activity in living cells was further investigated. As shown in fig. 5A, a clear FRET signal (red, cy 5) was observed in the cytoplasm after incubation of DTNS with HeLa cells for 3h. This is because the structure of DTNS is changed from an open state to a closed state by the action of 8-OG DNA glycosylase endogenous to the cell, and the distance between Cy3 donor and Cy5 acceptor is brought close, thereby initiating efficient FRET. This result demonstrates the feasibility of the present strategy to ratio image 8-OG DNA glycosylase activity in living cells. In addition, to confirm the specificity of this strategy to image the endogenous 8-OG DNA glycosylase activity in living cells, a control DTNS without 8-OG was designed. As shown in fig. 5B, after incubation of control DTNS with HeLa cells for 3h, no FRET signal was apparent in the cytoplasm (red, cy 5). These results confirm that the present strategy can be used for in situ and accurate imaging of intracellular 8-OG DNA glycosylase activity.

The DNA oligonucleotide sequences used in the examples are shown in Table 1:

TABLE 1

Wherein, the symbol "O" in SEQ ID NO.5 is a damaged base "8-OG".

The above description is only of the preferred embodiments of the present invention and is not intended to limit the present invention, but various modifications and variations can be made to the present invention by those skilled in the art. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Sequence listing

<110> university of chat

<120> a DTNS-mediated method for detecting 8-OG DNA glycosylase activity

<130>

<160> 7

<170> PatentIn version 3.3

<210> 1

<211> 78

<212> DNA

<213> artificial sequence

<400> 1

atcacccaaa ccctcaatct tttacattcc taagtctgaa acattacagc ttgctacacg 60

agaagagccg ccatagta 78

<210> 2

<211> 78

<212> DNA

<213> artificial sequence

<400> 2

tcagccaagc atactaacta ttttatcacc aggcagttga cagtgtagca agctgtaata 60

gatgcgaggg tccaatac 78

<210> 3

<211> 55

<212> DNA

<213> artificial sequence

<400> 3

tcaactgcct ggtgataaaa cgacactacg tgggaatcta ctatggcggc tcttc 55

<210> 4

<211> 55

<212> DNA

<213> artificial sequence

<400> 4

ttcagactta ggaatgtgct tcccacgtag tgtcgtttgt attggaccct cgcat 55

<210> 5

<211> 24

<212> DNA

<213> artificial sequence

<400> 5

aatcaactog gagaatotaa ctga 24

<210> 6

<211> 24

<212> DNA

<213> artificial sequence

<400> 6

aatcaactgg gagaatgtaa ctga 24

<210> 7

<211> 72

<212> DNA

<213> artificial sequence

<400> 7

agattgaggg tttgggtgat tttcagttac attctcccag ttgattccat gtgtagaaat 60

caactgggag aa 72

Claims

1. A DNA tetrahedral nano-switch, characterized by: comprising the following steps: a DNA tetrahedron, wherein a double-stranded DNA probe is connected to one vertex of the DNA tetrahedron;

the double-stranded DNA probe is formed by hybridization of an identification chain containing 8-OG and a reporter chain marked with a donor/acceptor double fluorophore;

the donor/acceptor bifluorescence is Cy3 and Cy5;

the preparation method of the DNA tetrahedron comprises the following steps:

1) Preparation of DNA tetrahedra: mixing four DNA strands in equimolar amount, heating at 95deg.C for 5min, rapidly transferring into ice water bath, cooling for 30min, and standing at 4deg.C for 1 hr;

2) Preparation of double-stranded DNA probe R-H: mixing the recognition chain R and the reporter chain H in equimolar amounts, and incubating for 1H at 25 ℃;

3) Preparation of DTNS: mixing the DNA tetrahedron prepared above and double-stranded DNA probe R-H in equimolar amount, and incubating for 1H at 25 ℃;

the preparation of the DNA tetrahedron and the double-stranded DNA probe R-H, DTNS is carried out in a 1 XPBS buffer solution pH 7.4;

the identification chain R is as follows: aatcaactoggaaattaactga (SEQ ID No. 5);

the report chain H is:

AGATTGAGGGTTTGGGTGATTTTCAGTTACAT(Cy5)-TCTCCCAGTTGATTCCATGT

GTAGAAATCAACTGGGAGAA-(Cy3)(SEQ ID NO.7)；

wherein, the symbol "O" in SEQ ID NO.5 is a damaged base "8-OG";

the four DNA chains are specifically:

the A chain nucleotide sequence is as follows:

ATCACCCAAACCCTCAATCTTTTACATTCCTAAGTCTGAAACATTACAGCTTGCTA

CACGAGAAGAGCCGCCATAGTA(SEQ ID NO.1)；

the nucleotide sequence of the B chain is as follows:

TCAGCCAAGCATACTAACTATTTTATCACCAGGCAGTTGACAGTGTAGCAAGCTGTAATAGATGCGAGGGTCCAATAC(SEQ ID NO.2)；

the nucleotide sequence of the C chain is as follows:

TCAACTGCCTGGTGATAAAACGACACTACGTGGGAATCTACTATGGCGGCTCTTC

(SEQ ID NO.3)；

the nucleotide sequence of the D chain is as follows:

TTCAGACTTAGGAATGTGCTTCCCACGTAGTGTCGTTTGTATTGGACCCTCGCAT(SEQ ID NO.4)。

2. the method for preparing a DNA tetrahedron according to claim 1, wherein:

the preparation of the DNA tetrahedron and double-stranded DNA probe R-H, DTNS was carried out in 1 XPBS buffer pH 7.4.

3. A DTNS-mediated method for detecting 8-OG DNA glycosylase activity in an extracellular target, comprising:

(1) Constructing the DNA tetrahedral nano-switch of claim 1;

(2) Incubating extracellular targets and DNA tetrahedral nanoswitchs together;

(3) Fluorescence spectroscopy measurements were performed.

4. A method as claimed in claim 3, wherein: incubating at 37℃for 60-100min.

5. The method of claim 4, wherein: incubate at 37℃for 90min.

6. A method as claimed in claim 3, wherein: in the fluorescence spectrum measurement process, the excitation wavelength is 525nm, and the emission wavelength is 550nm-750nm; the excitation and emission slit width was 10nm and the photomultiplier voltage was 700V.

7. A DTNS-mediated method of imaging the ratio of 8-oxidized guanine DNA glycosylase activity in living cells for the purpose of non-disease diagnosis, characterized by:

(1) Constructing the DNA tetrahedral nano-switch of claim 1;

(2) Incubating target cells and DNA tetrahedral nano switches together;

(3) Confocal laser scanning microscopy imaging was performed.

8. The method of claim 7, wherein: target cells were first cultured in DMEM medium supplemented with 10% fbs and 1% penicillin-streptomycin, then inoculated on confocal dishes, incubated for 20-25h, and then co-incubated with DNA tetrahedron nanoswitch.

9. The method as recited in claim 8, wherein: incubation time is 2-4h.

10. The method of claim 9, wherein: incubation time was 3h.

11. The method of claim 7, wherein: in the confocal laser scanning microscope imaging process, cy3 emission light in the range of 550-639 nm and Cy5 emission light in the range of 640-700 nm are collected under the excitation light with the wavelength of 543 nm.