CN113774069A - Tobacco NtCLC-f gene mutant and molecular identification method and application thereof - Google Patents
Tobacco NtCLC-f gene mutant and molecular identification method and application thereof Download PDFInfo
- Publication number
- CN113774069A CN113774069A CN202111293671.8A CN202111293671A CN113774069A CN 113774069 A CN113774069 A CN 113774069A CN 202111293671 A CN202111293671 A CN 202111293671A CN 113774069 A CN113774069 A CN 113774069A
- Authority
- CN
- China
- Prior art keywords
- ntclc
- tobacco
- gene
- mutant
- gene mutant
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Biotechnology (AREA)
- Wood Science & Technology (AREA)
- Biophysics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- Analytical Chemistry (AREA)
- Biomedical Technology (AREA)
- Microbiology (AREA)
- Botany (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Mycology (AREA)
- Cell Biology (AREA)
- Immunology (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a tobacco NtCLC-f gene mutant and a molecular identification method and application thereof, wherein the tobacco NtCLC-f gene mutant is Ntclc-f, which is characterized in that C at the 1003 th site of the tobacco NtCLC-f gene is mutated into T to form a stop codon, so that the gene is stopped in advance; the nucleotide sequence of the gene mutant Ntclc-f is shown as SEQ ID N0.2. The invention provides a tobacco NtCLC-f gene mutant, a molecular identification method and application for the first time through systematic research, the content of chloride ions in tobacco leaves of tobacco plants obtained by the NtCLC-f gene mutant Ntclc-f for reducing the content of the chloride ions in the tobacco leaves is reduced by 28.6% compared with that of a reference, and the content of the chloride ions in the tobacco leaves is obviously reduced.
Description
Technical Field
The invention relates to the technical field of plant molecular biology, in particular to a tobacco NtCLC-f gene mutant, a molecular identification method and application thereof.
Background
The content of chloride ions is an important quality parameter in tobacco, the content of the chloride ions in tobacco leaves is proper from 0.3% to 0.8%, if the content of the chloride ions in the tobacco leaves is too high, the combustibility of a cigarette product can be influenced, smoldering of the cigarette product can be caused, so that more carbon monoxide and tar can be contained in the smoke of the cigarette product, and the health of consumers can be harmed. And when the content of the chloride ions is higher, the phenomenon of flameout can be directly caused.
At present, when vegetables and food crops are planted in China, a large amount of chemical fertilizers and pesticides are used, the existing chemical fertilizers contain a large amount of chloride ions, and the content of the chloride ions in the cultivated soil exceeds the standard in the use process of the chemical fertilizers containing the chloride ions. The exceeding of the soil chloride ion content can cause the cultivated crops to excessively absorb chloride ions, so that the chloride ion content in the crops is over-standard, and the quality of the crops is influenced.
In order to solve the problem of high content of chloride ions in tobacco leaves, the adoption of a low-chloride fertilizer is the most direct means, but considering that the production cost of the low-chloride fertilizer is obviously higher than that of a high-chloride fertilizer, fertilizer manufacturers and farmers often do not use the low-chloride fertilizer but use the high-chloride fertilizer in consideration of the cost factor. In addition, the content of chloride ions in the current Chinese cultivated soil exceeds the standard seriously, and even if the fertilizer with low chloride ion content is used at present, the problem that the content of the chloride ions in crops, particularly tobacco, exceeds the standard cannot be solved quickly; therefore, the traditional agricultural measures are difficult to change the problem that the chloride ions in the tobacco leaves exceed the standard at present.
Therefore, in view of the above, there is a need to research a tobacco NtCLC-f gene mutant and a molecular identification method and application to solve the above technical problems.
Disclosure of Invention
The invention aims to obtain a tobacco NtCLC-f gene mutant for reducing the content of chloride ions in tobacco leaves, aims to provide a molecular identification method for the tobacco NtCLC-f gene mutant Ntclc-f, and aims to reduce the content of the chloride ions in the tobacco leaves.
The first purpose of the invention is realized by that the tobacco NtCLC-f gene mutant is Ntclc-f, which is characterized in that C at the 1003 th site of the tobacco NtCLC-f gene is mutated into T to form a stop codon, so that the gene is stopped in advance; the nucleotide sequence of the gene mutant Ntclc-f is shown as SEQ ID N0.2.
The second purpose of the invention is realized by a molecular identification method of NtCLC-f gene mutant Ntclc-f, wherein a DNA fragment of the mutant Ntclc-f is obtained by amplifying a primer pair, an upstream primer of the primer pair is NtCLC-fF, and the nucleotide sequence of the upstream primer is shown as SEQ ID N0.3; the downstream primer is NtCLC-fR, and the nucleotide sequence of the downstream primer is shown as SEQ ID N0.4.
The third purpose of the invention is realized by the application of the tobacco NtCLC-f gene mutant Ntclc-f in reducing the content of chloride ions in tobacco leaves.
The invention also provides a preparation method of the NtCLC-f gene mutant, which comprises the following steps:
1. EMS mutagenesis of tobacco seeds:
firstly, cleaning and disinfecting tobacco seeds by using sodium hypochlorite, and then washing the tobacco seeds by using distilled water; then soaking the tobacco plants in a phosphate buffer solution to increase the germination rate of the seeds; soaking the tobacco seeds obtained by soaking in 0.5% EMS (ethyl methane sulfonate) solution for 10-15 hours, and then centrifuging and filtering to dry the tobacco seeds. Rinsing the centrifugally filtered tobacco seeds with distilled water for 50 times, fully washing to remove EMS solution, and treating EMS waste liquid with sodium hydroxide to avoid pollution.
2. Screening to obtain mutant plants:
firstly, extracting mutant tobacco DNA; designing a specific primer by taking DNA of the mutant material as a template to carry out PCR amplification;
the upstream primer is NtCLC-fF: CCATTGTATCTGATACTGGGGATG
The downstream primer is NtCLC-fR: CATTCCCTGGAATAGCTGAATTTAT
Sequencing analysis is carried out on the PCR product obtained by amplification, a mutant material is obtained by analyzing the sequencing result, and the tobacco plant terminated in advance is selected as a candidate mutant material; obtaining M2 seeds from the candidate mutant material from the inbred; planting the M2 seeds to obtain M2 mutant plants, identifying the mutants by using an upstream primer NtCLC-fF and a downstream primer NtCLC-fR, and finally obtaining homozygous mutant plants; and detecting the content of chloride ions in the homozygous mutant tobacco plant.
The invention has the beneficial effects that:
1. the tobacco NtCLC-f gene mutant provided by the invention is obtained by mutating the 1003 th site C of the tobacco NtCLC-f gene into T after mutagenesis of tobacco seeds, and the mutation can obviously reduce the content of chloride ions in tobacco leaves of tobacco.
2. The invention adopts EMS mutagenesis means to directly knock out chloride ion transport related genes in the cultivated tobacco to create a tobacco variety with low chloride ion content, and has good application prospect in reducing the chloride ion content of tobacco leaves by adopting a molecular identification method for knocking out specific chloride ion absorption channels in the tobacco by adopting the molecular means.
Drawings
The above and/or additional aspects and advantages of the present invention will become apparent and readily appreciated from the following description of the embodiments, taken in conjunction with the accompanying drawings of which:
FIG. 1 is a diagram showing the sequencing results of the mutants of the present invention;
FIG. 2 is a diagram showing the amplification bands of the mutants of the present invention;
FIG. 3 is a diagram showing the comparison of chloride ion content between the mutant of the present invention and wild type individual plant.
Detailed Description
Reference will now be made in detail to embodiments of the present invention, examples of which are illustrated in the accompanying drawings, wherein like or similar reference numerals refer to the same or similar elements or elements having the same or similar function throughout. The embodiments described below with reference to the drawings are illustrative and intended to be illustrative of the invention and are not to be construed as limiting the invention.
With the development of molecular biology technology, knocking out a specific chloride ion absorption channel in tobacco by adopting a molecular means is a means for solving the problem of high chloride ion content in tobacco leaves of tobacco; directly knocking off chloride ion transport related genes in the cultivated tobacco by adopting an EMS mutagenesis method is an effective method for creating tobacco varieties with low chloride ion content.
The cDNA sequence of the NtCLC-f gene of the wild tobacco plant is shown as follows:
as shown in figure 1, the mutation of C at the 1003 th site of the NtCLC-f gene into T is generated to obtain a mutant Ntclc-f, and the mutation is shown as T at the boxed position of the wild tobacco plant sequence. Single nucleotide changes at this site will result in a change in the amino acid sequence encoded by the NtCLC-f gene following the mutation site, forming a stop codon, leading to premature termination of the gene.
Screening homozygous mutant plants by sequencing and harvesting to obtain M2-generation tobacco seeds with a mutant Ntclc-f and capable of remarkably reducing the content of chloride ions in tobacco leaves; according to the embodiment of the invention, the nucleic acid of the mutant provides gene resources for cultivating the tobacco variety with low chloride ion content.
The gene sequences in this application include either the DNA form or the RNA form, one of which is disclosed, meaning the other is also disclosed.
Through comparison, the cDNA of the tobacco NtCLC-f gene mutant Ntclc-f has c.1003C > T mutation compared with SEQ ID NO.1, and furthermore, compared with the wild type NtCLC-f amino acid sequence of an encoded product, the encoded product is changed after the mutation site to form a stop codon, so that the gene is terminated in advance. In conclusion, the presence of the c.1003c > T mutation can significantly alter the function of the NtCLC-f gene.
Example 2, please refer to fig. 2, according to the second aspect of the present invention, a molecular identification method of a tobacco NtCLC-f gene mutant ntccl-f is provided, a DNA fragment of the mutant ntcclc-f is amplified by a primer pair, an upstream primer of the primer pair is NtCLC-fF, and a nucleotide sequence thereof is shown as SEQ ID N0.3; the downstream primer is NtCLC-fR, and the nucleotide sequence of the downstream primer is shown as SEQ ID N0.4.
1. The method for obtaining the tobacco mutant material comprises the following steps:
(1) firstly, cleaning and disinfecting tobacco seeds by using sodium hypochlorite, and then washing the tobacco seeds by using distilled water;
(2) soaking tobacco plants in a phosphate buffer solution to increase the germination rate of seeds;
(3) soaking the tobacco seeds obtained by soaking in 0.5% EMS (ethyl methane sulfonate) solution for 10-15 hours, and then centrifuging and filtering to dry the seeds;
(4) and rinsing the seeds with distilled water for 50 times, and fully washing the EMS solution to obtain the tobacco mutant material. EMS waste liquid is treated by sodium hydroxide so as to avoid pollution.
2. The preparation method of the specific tobacco NtCLC-f gene mutant Ntclc-f comprises the following steps:
screening to obtain a mutant Ntclc-f:
(1) the obtained mutant material DNA is used as a template to design a specific primer for PCR amplification,
the upstream primer is NtCLC-fF: CCATTGTATCTGATACTGGGGATG
The downstream primer is NtCLC-fR: CATTCCCTGGAATAGCTGAATTTAT
The PCR reaction conditions were as follows:
the amplified bands are shown in FIG. 2.
(2) Carrying out electrophoresis on the PCR product obtained by amplification in 0.8% agarose gel, after the electrophoresis is finished, recovering and purifying the PCR product by using a PCR product purification kit of Qiagen company according to the product instruction, sequencing by using Invitrogen, and verifying the sequence result as shown in figure 1;
(3) self-crossing candidate mutant material to obtain M2 seeds;
(4) m2 seeds are planted to obtain M2 mutant plants, the upstream primer NtCLC-fF and the downstream primer NtCLC-fR are used for identifying the mutants, and finally the homozygous mutant plants of which the mutants are Ntclc-f are obtained. The nucleotide sequence of the gene mutant Ntclc-f is SEQ ID No: 1, the mutant contains a nucleotide sequence of NtCLC-f, wherein C at the 1003 th site of the gene sequence is mutated into T, so that the change of a base from glutamine to termination mutation is generated to form a termination codon, the gene is terminated in advance, and the nucleotide sequence of the gene mutant Ntclc-f is shown as SEQ ID N0.2.
Example 3: in this example, the content of chloride ions was measured in each of wild-type tobacco and tobacco having the gene mutant Ntclc-f obtained in example 2. The content of the chloride ions is measured according to YC/T162-2011 continuous flow method for measuring the chloride of the tobacco and the tobacco products.
The principle is as follows: extracting chloride ions in a tobacco sample by using a 5% acetic acid aqueous solution, reacting the extracted chloride ions with mercury thiocyanate to release thiocyanate radicals, further reacting the thiocyanate radicals with ferric iron to form a complex, and carrying out colorimetric determination on reaction products at 460nm or 480 nm.
The equipment used in this example is: continuous flow Analyzer- (American API) (SEAL AA3, Germany) (ALLIANCE, France).
The experimental vessel used in this example: a horizontal shaking table, a balance-sensing quantity of 0.0001g, a 150mL triangular bottle or plastic bottle, a rubber plug and filter paper.
Reagent Brij35 solution (polyethoxy lauryl ether) was prepared: 5 drops of 22% Brij35 are added to 1L of water and stirred uniformly.
The preparation method of the color developing agent used in the embodiment comprises the following steps: (1) mercury thiocyanate [ Hg (SCN)2]2.1g of the mercuric thiocyanate solution is put into a beaker, added with methanol for dissolution, transferred into a 500mL volumetric flask, and subjected to constant volume to scale with the methanol to obtain a mercuric thiocyanate stock solution; (2) iron nitrate [ Fe (NO3)3·9H2O]Adding 101.0g of nitric acid (HNO3) into a beaker, adding 15.8mL of nitric acid, dissolving with water, transferring into a 500mL volumetric flask, and metering to a scale with water to obtain a ferric nitrate stock solution; (3) and respectively putting 240mL of the mercuric thiocyanate stock solution and 240mL of the ferric nitrate stock solution into 1000mL volumetric flasks, adding water to a constant volume to a scale, and adding 1mLBrij35 to obtain the color developing agent.
A color developing reagent: in a 1L flask, 520mg Hg (SCN)2Dissolving in 200mL of methanol, adding 600mL of distilled water, and shaking up; adding 63mLHNO3, and shaking up; adding 40g Fe (NO3)39H20 was dissolved and diluted to 1000mL with purified water.
And (3) an analysis step: weighing 0.3g of tobacco sample in a 150mL triangular bottle or plastic bottle (to the accuracy of 0.0001 g); add 50mL of acetic acid (5%) solution and cover the stopper; oscillating and extracting for 30min on an oscillator; filtering with filter paper, and loading on the machine. (if the concentration of the sample solution is beyond the concentration range of the working standard solution, the sample solution should be diluted).
The chlorine content, on a dry basis, is calculated from the following formula:
in the formula:
c-instrumental observations of total phytoalkaloids in milligrams (mg/mL) in the sample fluid;
v-volume of extract in milliliters (mL);
m is the mass of the sample in milligrams (mg);
w-moisture content of the sample.
Through determination, the average content of chloride ions in wild type tobacco without mutation is 0.35%, the average content of chloride ions in tobacco with mutation at the NtCLC-f site is 0.25% (as shown in figure 3), the average content of chloride ions in the tobacco with mutation at the NtCLC-f site is reduced by nearly 28.6% compared with the average content of chloride ions in the wild type tobacco without mutation, and the chloride ions are greatly reduced, so that the tobacco with mutation at the NtCLC-f site has great value for tobacco breeding, and the tobacco NtCLC-f gene mutant Ntclc-f has great application value for tobacco breeding.
In the description herein, references to the description of the term "one embodiment," "some embodiments," "an example," "a specific example," or "some examples," etc., mean that a particular feature, structure, material, or characteristic described in connection with the embodiment or example is included in at least one embodiment or example of the invention. In this specification, the schematic representations of the terms used above do not necessarily refer to the same embodiment or example. Furthermore, the particular features, structures, materials, or characteristics described may be combined in any suitable manner in any one or more embodiments or examples.
Although embodiments of the present invention have been shown and described above, it is understood that the above embodiments are exemplary and should not be construed as limiting the present invention, and that variations, modifications, substitutions and alterations can be made in the above embodiments by those of ordinary skill in the art without departing from the principle and spirit of the present invention.
Sequence listing
<110> research institute of tobacco agricultural science in Yunnan province
<120> tobacco NtCLC-f gene mutant, molecular identification method and application
<130> 2021
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 2178
<212> DNA
<213> Artificial sequence (Artificial)
<400> 1
atgacgggag gcgagtacag cgatcacaat gttttattac gttctacttc atcggcgtca 60
gaaggcgatt tagaaagcca gtcgccgagg agaacgaata ccagaagcat taaggatcta 120
ttaaagcggt tggatcgagg gttttcgggt cggcgatcag agagggacca aaactcgtcg 180
tcttctcctt cttctaatcg cggtgtttcg gatgaagttc tcggcgatag tgctccaccg 240
gaatgggcga tgttgcttgt tggatgtctc cttggccttg ctactggcct ttgtgttgct 300
gcctttaacc gcggggtaca cgtaatacac gagtgggcgt gggctggtac tcctaatgat 360
ggtgctgctt ggcttcgttt gcaaaggcta gctgatactt ggcaccggat acttttaata 420
ccagttttgg gtggagtcat tgttggcatg ctgcatggtc tgcttgaaat attggaccaa 480
ataacacagt ccagctcttc tcagggacaa ggatttgatt tgattgctgg aatcttccct 540
acagtgaagg ccactcaggc tgctatcact ctgggtactg gttgttcttt gggtcctgaa 600
ggccctagtg tagatattgg gaagtcatgt gcctatggat gctccatgat gatggaaaac 660
aaccgggaaa ggagaatagc tctcattgca gctggtgcag ctgctggaat tgcttcaggt 720
ttcaatgcag cggtagcagg ttctttcttt gcgattgaaa cagttttaag accactccgt 780
gcagaaaatt cacccccatt tacaactgca atgatcatat tggcttctgt tatatcatca 840
actgtatcaa atgcagtact tggcgagaaa caggctttca cagtgcccac gtatgatatg 900
aaatctgctg ctgagcttcc attgtatctg atactgggga tgctgtgtgg agtagtaagt 960
gtggctttca ctcgattggt gtcctggttc accaaggggt ttcagttcct caaggaaaaa 1020
tttggacttc ctgatgttgt ctgccctgcc ttggggggtt taggagctgg tgtaatagct 1080
cttagatatc ctggaattct ctattggggt ttcactaatg ttgatgaaat ccttcatact 1140
gggaagactg catctgcacc tggaatcgga ttgctagccc aattagttgc tgctaaagtc 1200
gtggccactg ctttgtgcaa agggtctggc cttgttggtg gattgtatgc accaagttta 1260
atgataggtg ctgctgtagg tgctgtattt ggagggctag ctggggaact aataaattca 1320
gctattccag ggaatgctgc tattgcccag ccacaggcat atgcactggt gggaatggct 1380
gctacactag cttccgtttg ctcagtgcct ttgacttcag tgctcttatt gtttgagttg 1440
acaaaagatt atagaatttt gcttcctctc atgggtgctg ttggactggc aatatgggtg 1500
ccttctgtta cagaccagcc aaaggaaacg gaggtatcag aagcgaaatt tgcatcaaaa 1560
ggttactcaa ttctttcacc ggttgatgag aaaaatgaag ggaatgttcc gaggaaatct 1620
ggtgagggaa atgacttgga actattggtg attgggagtc ataatagtcg tgaatcattt 1680
gatgaaggtc tcattctgga agatctaaag gtttctcagg ccatgtcaaa tgattatttg 1740
aaggtctctc caagccaaac tgtgaaagaa gctttagagt gcatgcatga cggccaacag 1800
aattgcgttg ttgtggttga tgctgaaggt tacttggaag gaattttaac atatggtgac 1860
gtcaaaagaa gtttgtttaa gagccatggg gattcttcta acagtgattt atcagtcaca 1920
gatgcaaata cttgtcttgt gtcctctata tgcataagag gaataagcta tcgtggccaa 1980
gattgtggac tcctaacttg ttatcctgat acggatctag caactgcaaa gcaactaatg 2040
gaggccaaag gaattaaaca attgcctgtg gtcaaacgtg gtggagaatt cagaagagaa 2100
agaaagcgca gaactattgc tattttgcgt tatgattcaa tagaggagtc aatcaggttt 2160
tgcatctttt caatgtag 2178
<210> 2
<211> 2178
<212> DNA
<213> Artificial sequence (Artificial)
<400> 2
atgacgggag gcgagtacag cgatcacaat gttttattac gttctacttc atcggcgtca 60
gaaggcgatt tagaaagcca gtcgccgagg agaacgaata ccagaagcat taaggatcta 120
ttaaagcggt tggatcgagg gttttcgggt cggcgatcag agagggacca aaactcgtcg 180
tcttctcctt cttctaatcg cggtgtttcg gatgaagttc tcggcgatag tgctccaccg 240
gaatgggcga tgttgcttgt tggatgtctc cttggccttg ctactggcct ttgtgttgct 300
gcctttaacc gcggggtaca cgtaatacac gagtgggcgt gggctggtac tcctaatgat 360
ggtgctgctt ggcttcgttt gcaaaggcta gctgatactt ggcaccggat acttttaata 420
ccagttttgg gtggagtcat tgttggcatg ctgcatggtc tgcttgaaat attggaccaa 480
ataacacagt ccagctcttc tcagggacaa ggatttgatt tgattgctgg aatcttccct 540
acagtgaagg ccactcaggc tgctatcact ctgggtactg gttgttcttt gggtcctgaa 600
ggccctagtg tagatattgg gaagtcatgt gcctatggat gctccatgat gatggaaaac 660
aaccgggaaa ggagaatagc tctcattgca gctggtgcag ctgctggaat tgcttcaggt 720
ttcaatgcag cggtagcagg ttctttcttt gcgattgaaa cagttttaag accactccgt 780
gcagaaaatt cacccccatt tacaactgca atgatcatat tggcttctgt tatatcatca 840
actgtatcaa atgcagtact tggcgagaaa caggctttca cagtgcccac gtatgatatg 900
aaatctgctg ctgagcttcc attgtatctg atactgggga tgctgtgtgg agtagtaagt 960
gtggctttca ctcgattggt gtcctggttc accaaggggt tttagttcct caaggaaaaa 1020
tttggacttc ctgatgttgt ctgccctgcc ttggggggtt taggagctgg tgtaatagct 1080
cttagatatc ctggaattct ctattggggt ttcactaatg ttgatgaaat ccttcatact 1140
gggaagactg catctgcacc tggaatcgga ttgctagccc aattagttgc tgctaaagtc 1200
gtggccactg ctttgtgcaa agggtctggc cttgttggtg gattgtatgc accaagttta 1260
atgataggtg ctgctgtagg tgctgtattt ggagggctag ctggggaact aataaattca 1320
gctattccag ggaatgctgc tattgcccag ccacaggcat atgcactggt gggaatggct 1380
gctacactag cttccgtttg ctcagtgcct ttgacttcag tgctcttatt gtttgagttg 1440
acaaaagatt atagaatttt gcttcctctc atgggtgctg ttggactggc aatatgggtg 1500
ccttctgtta cagaccagcc aaaggaaacg gaggtatcag aagcgaaatt tgcatcaaaa 1560
ggttactcaa ttctttcacc ggttgatgag aaaaatgaag ggaatgttcc gaggaaatct 1620
ggtgagggaa atgacttgga actattggtg attgggagtc ataatagtcg tgaatcattt 1680
gatgaaggtc tcattctgga agatctaaag gtttctcagg ccatgtcaaa tgattatttg 1740
aaggtctctc caagccaaac tgtgaaagaa gctttagagt gcatgcatga cggccaacag 1800
aattgcgttg ttgtggttga tgctgaaggt tacttggaag gaattttaac atatggtgac 1860
gtcaaaagaa gtttgtttaa gagccatggg gattcttcta acagtgattt atcagtcaca 1920
gatgcaaata cttgtcttgt gtcctctata tgcataagag gaataagcta tcgtggccaa 1980
gattgtggac tcctaacttg ttatcctgat acggatctag caactgcaaa gcaactaatg 2040
gaggccaaag gaattaaaca attgcctgtg gtcaaacgtg gtggagaatt cagaagagaa 2100
agaaagcgca gaactattgc tattttgcgt tatgattcaa tagaggagtc aatcaggttt 2160
tgcatctttt caatgtag 2178
<210> 3
<211> 24
<212> DNA
<213> Artificial sequence (Artificial)
<400> 3
ccattgtatc tgatactggg gatg 24
<210> 4
<211> 25
<212> DNA
<213> Artificial sequence (Artificial)
<400> 4
cattccctgg aatagctgaa tttat 25
Claims (3)
1. A tobacco NtCLC-f gene mutant is characterized in that: the tobacco NtCLC-f gene mutant is Ntclc-f, wherein C at the 1003 th site of the tobacco NtCLC-f gene is mutated into T to form a stop codon, so that the gene is stopped in advance; the nucleotide sequence of the gene mutant Ntclc-f is shown as SEQ ID N0.2.
2. The molecular identification method of the tobacco NtCLC-f gene mutant Ntclc-f, as claimed in claim 1, wherein the DNA fragment of the mutant Ntclc-f is obtained by amplifying the primer pair, the upstream primer of the primer pair is NtCLC-fF, and the nucleotide sequence is shown in SEQ ID N0.3; the downstream primer is NtCLC-fR, and the nucleotide sequence of the downstream primer is shown as SEQ ID N0.4.
3. Use of the tobacco NtCLC-f gene mutant ntcclc-f according to claim 1 for reducing the chloride ion content in tobacco leaves.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111293671.8A CN113774069A (en) | 2021-11-03 | 2021-11-03 | Tobacco NtCLC-f gene mutant and molecular identification method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111293671.8A CN113774069A (en) | 2021-11-03 | 2021-11-03 | Tobacco NtCLC-f gene mutant and molecular identification method and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN113774069A true CN113774069A (en) | 2021-12-10 |
Family
ID=78873606
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111293671.8A Pending CN113774069A (en) | 2021-11-03 | 2021-11-03 | Tobacco NtCLC-f gene mutant and molecular identification method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113774069A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111662912A (en) * | 2020-06-01 | 2020-09-15 | 云南省烟草农业科学研究院 | Tobacco NtARF6 gene mutant and molecular identification method and application |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107365777A (en) * | 2017-09-08 | 2017-11-21 | 云南省烟草农业科学研究院 | One grows tobacco nicotine content controlling gene NtCLC b and its cloning process and application |
| CN111662912A (en) * | 2020-06-01 | 2020-09-15 | 云南省烟草农业科学研究院 | Tobacco NtARF6 gene mutant and molecular identification method and application |
| CN112760329A (en) * | 2021-03-11 | 2021-05-07 | 河南中烟工业有限责任公司 | Tobacco chloride channel protein gene NtCLC-F and application thereof |
-
2021
- 2021-11-03 CN CN202111293671.8A patent/CN113774069A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107365777A (en) * | 2017-09-08 | 2017-11-21 | 云南省烟草农业科学研究院 | One grows tobacco nicotine content controlling gene NtCLC b and its cloning process and application |
| CN111662912A (en) * | 2020-06-01 | 2020-09-15 | 云南省烟草农业科学研究院 | Tobacco NtARF6 gene mutant and molecular identification method and application |
| CN112760329A (en) * | 2021-03-11 | 2021-05-07 | 河南中烟工业有限责任公司 | Tobacco chloride channel protein gene NtCLC-F and application thereof |
Non-Patent Citations (1)
| Title |
|---|
| NCBI: "ACCESSION XM_016621910.1", 《GENBANK》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111662912A (en) * | 2020-06-01 | 2020-09-15 | 云南省烟草农业科学研究院 | Tobacco NtARF6 gene mutant and molecular identification method and application |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Nwuche et al. | Effect of co-existing plant specie on soil microbial activity under heavy metal stress | |
| CN113832165A (en) | Tobacco NtSLAH3 gene mutant and molecular identification method and application thereof | |
| CN104152375B (en) | One strain deamination deodorization bacterial strain QDN01 and the application in biological deodorizing thereof | |
| CN108913702B (en) | Method for improving tobacco black shank resistance, specific primer and kit | |
| CN110628678A (en) | Heavy metal-resistant cupronickel bacterium, preparation method and application of bacterium agent | |
| CN111690661A (en) | Tobacco NtbHLH13 gene mutant and molecular identification method and application | |
| CN113774069A (en) | Tobacco NtCLC-f gene mutant and molecular identification method and application thereof | |
| CN113930432B (en) | Tobacco NtSLAC1 gene mutant and molecular identification method and application | |
| CN111662912A (en) | Tobacco NtARF6 gene mutant and molecular identification method and application | |
| CN116144529A (en) | Rice saxophone OOR3-1 strain and application thereof | |
| CN114107091B (en) | Copper basophilic strain KY678 with heavy metal cadmium passivation and plant growth promotion functions and application thereof | |
| CN111826292B (en) | Yeast RY-6 and application thereof | |
| CN109738610A (en) | A kind of method of Fast Evaluation lignocellulose castoff compost rotten degree | |
| CN106119167B (en) | A method of utilizing Triadimenol in novel microorganism bacterial strain degradation soil | |
| CN113980974B (en) | Tobacco NtCCC1 gene mutant and molecular identification method and application | |
| CN107475384A (en) | A kind of screening technique of manganese/Cd uptake efficient ecological type dyers' grapes | |
| CN109439668B (en) | Tobacco chloride ion absorbing gene NtSLAC2 and cloning method and application thereof | |
| Lebeda et al. | Peroxidase isozyme polymorphism as a potential marker for detection of field resistance in Cucumis sativus to cucumber downy mildew (Pseudoperonospora cubensis (Berk. et Curt.) Rostov)/Polymorphismus der Peroxidase-Isoenzyme als ein potentieller Marker für die Detektion von Feldresistenz bei Cucumis sativus gegen den Falschen Mehltau an Gurken (Pseudoperonospora cubensis (Berk. et Curt.) Rostov) | |
| CN113913341B (en) | Bacillus parachudahliae G2-13 with functions of nicotine degradation and plant growth promotion and application thereof | |
| CN105248452B (en) | Alfalfa is kept a full stand of seedings type seed coat agent and preparation method and application | |
| CN116064589B (en) | Tobacco NtPht1-7 gene mutant and application thereof | |
| CN114774280B (en) | Screening method of heterotrophic nitrification aerobic denitrifying bacteria in soil of acid paddy field | |
| CN112284853B (en) | Forest N relieving function2Method for O emission | |
| CN114436392B (en) | Water body ecological restoration method guided by directionally removing algae in water body | |
| Major et al. | Estimating Nodule Activity of Sainfoin, Alfalfa, and Cicer Milkvetch Seedlings 1 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |