CN113774028A

CN113774028A - Genetically modified stem cell for cartilage repair treatment and application thereof

Info

Publication number: CN113774028A
Application number: CN202110932547.5A
Authority: CN
Inventors: 薛冰华; 于婷婷; 张振利
Original assignee: Beijing Jiyuan Biotechnology Co ltd
Current assignee: Beijing Jiyuan Biotechnology Co ltd
Priority date: 2021-08-06
Filing date: 2021-08-13
Publication date: 2021-12-10
Also published as: WO2023011489A1

Abstract

The invention discloses a genetically modified stem cell for cartilage repair treatment, a preparation method and application thereof, and also provides a pharmaceutical composition comprising the stem cell. The stem cells comprise nucleic acid for coding anti-inflammatory factors and nucleic acid for coding cartilage repair factors, the anti-inflammatory factors and the factors for promoting cartilage differentiation are adopted to simultaneously modify the mesenchymal stem cells, the differentiation of the mesenchymal stem cells into cartilage can be effectively promoted, and the mesenchymal stem cells comprehensively act on various immune cells through the combination of various factors to inhibit the activity of various immune cells, so that the problem of local inflammatory environment of cartilage repair at parts such as knee and the like is solved, and the swelling condition of clinical patients is reduced or reduced when the mesenchymal stem cells are applied to the bone knee repair.

Description

Genetically modified stem cell for cartilage repair treatment and application thereof

Technical Field

The invention relates to genetic engineering, in particular to the technical field of stem cell therapy, and specifically relates to a genetically modified stem cell for cartilage repair.

Background

Stem cells are a class of cells with self-renewal and differentiation potential, and are important means for the research or treatment of tumors and cardiovascular diseases and other malignant diseases. Stem cell therapy has great research and application values in the three fields of life science, new drug tests and disease research, is widely applied to the fields of regenerative medicine cell replacement therapy, drug screening and the like, and becomes the focus of world attention and research.

The indications related to stem cell medicines are mainly various knee osteoarthritis and diabetic feet. The research on diseases related to the whole body in clinical treatment of stem cells relates to the following diseases: acute myocardial infarction, infantile cerebral palsy, premature ovarian failure, psoriasis, interstitial lung disease, knee osteoarthritis, Parkinson's disease, retinitis pigmentosa, age-related macular degeneration, ulcerative colitis, bone repair, empty nose syndrome, infertility, lupus nephritis, neuromyelitis optica, thin endometrium, pulmonary hypertension caused by COPD, decompensated hepatitis B cirrhosis, neuropathic pain, meniscus injury, etc.

The types of stem cells used for stem cell therapy include: embryonic stem cell-derived cells, neural stem cells, mesenchymal stem cells of various origins (such as fat, umbilical cord, bone marrow, placenta and the like), and bronchial basal layer cells. The treatment modes comprise: the cells are used alone, the cells are used in combination with materials, and the cells are used in combination with drugs. The source of the cells involved: autologous and allogeneic.

Although the stem cell has great requirements and support for treating clinical diseases such as bone and knee joint repair and the like, at present, due to limited understanding of factors for regulating the activity of the mesenchymal stem cells and lack of understanding of complex interaction between the mesenchymal stem cells and components of ecological microenvironments of the mesenchymal stem cells, the effectiveness and safety of clinical application of the mesenchymal stem cells are limited, and therefore, a great exploration space is still left for research on related research of bone and knee joint repair of the mesenchymal stem cells.

Disclosure of Invention

In order to overcome the above problems, the present inventors have conducted intensive studies and, as a result, found that: the anti-inflammatory factor and the factor for promoting the cartilage differentiation are adopted to simultaneously modify the mesenchymal stem cells, so that the differentiation of the mesenchymal stem cells into the cartilage can be effectively promoted, and the activity of various immune cells is inhibited by comprehensively acting on various immune cells through the combination of various factors, so that the problem of local inflammatory environment in repairing the cartilage at the parts such as the knee and the like is solved, and the swelling condition of clinical patients is reduced or reduced when the mesenchymal stem cells are applied to repairing the knee and the like, thereby completing the invention.

Specifically, the present invention provides the following aspects:

in a first aspect, there is provided a genetically modified stem cell for use in cartilage repair therapy, the stem cell comprising a nucleic acid encoding an anti-inflammatory factor and a nucleic acid encoding a cartilage repair factor.

In a second aspect, there is provided a genetically modified stem cell for use in cartilage repair therapy as described above, wherein the anti-inflammatory factor is selected from the interleukin and TGF β receptor family, preferably the anti-inflammatory factor is selected from two or more of interleukin-3 (IL-3), interleukin-4 (IL-4), interleukin-5 (IL-5), interleukin-6 (IL-6), interleukin-10 (IL-10), interleukin-13 (IL-13) and interleukin-37 (IL-37)), more preferably interleukin 10 and interleukin 37.

In a third aspect, there is provided a genetically modified stem cell for use in a cartilage repair treatment as described above, wherein said cartilage repair factor is selected from the group consisting of fibroblast growth factor, FGF2a

FGF2b, FGF18, FGF23, preferably said cartilage repair factor is selected from fibroblast growth factor 18(FGF 18).

In a fourth aspect, there is provided a genetically modified stem cell for use in a cartilage repair treatment as described above, the nucleic acid encoding the anti-inflammatory factor being carried by a strong promoter that is susceptible to silencing in the stem cell, the nucleic acid encoding the cartilage repair factor being carried by a medium strength promoter that is not susceptible to silencing in the stem cell.

In a fifth aspect, there is provided a genetically modified stem cell for use in a cartilage repair treatment as described above, the nucleic acid encoding the anti-inflammatory factor and the nucleic acid encoding the cartilage repair factor being linked.

In a sixth aspect, there is provided a method for preparing a genetically modified stem cell for cartilage repair therapy, comprising linking a nucleic acid encoding an anti-inflammatory factor and a nucleic acid encoding a cartilage repair factor and introducing into a mesenchymal stem cell.

In a seventh aspect, there is provided a method of preparing a genetically modified stem cell for cartilage repair therapy as described above, comprising the steps of:

step 1, obtaining nucleic acid for coding an anti-inflammatory factor and nucleic acid for coding a cartilage repair factor, and connecting the nucleic acids with a vector plasmid after enzyme digestion to obtain a recombinant plasmid;

step 2, transfecting the recombinant plasmid and the packaging plasmid with a lentivirus packaging cell to obtain a recombinant lentivirus vector containing nucleic acid encoding an anti-inflammatory factor and nucleic acid encoding a cartilage repair factor;

and 3, transfecting the obtained recombinant lentiviral vector to mesenchymal stem cells to obtain the genetically modified stem cells for cartilage repair treatment.

In an eighth aspect, there is provided a genetically modified stem cell prepared by the above method.

In a ninth aspect, the invention provides a use of the genetically modified stem cell or the genetically modified stem cell prepared by the method in the preparation of a repair/treatment drug for cartilage diseases.

In a tenth aspect, there is provided the use as described above, wherein the cartilage disease includes degenerative arthritis, bursitis, synovitis, cervical spondylosis, lumbar spondylosis, scapulohumeral periarthritis, hyperosteogeny, rheumatoid arthritis, and the like. .

The invention has the advantages that:

(1) the genetically modified stem cell provided by the invention can simultaneously express an anti-inflammatory factor and a cartilage repair factor, has a good synergistic effect, can effectively promote the mesenchymal stem cell to be differentiated into cartilage, can inhibit the activity of various immune cells, and reduces or avoids local inflammation during cartilage repair;

(2) the genetically modified stem cell provided by the invention not only maintains the function of the mesenchymal stem cell, but also can well express the lipid anti-inflammatory factor and the cartilage repair factor, can be safely applied to a human subject, and does not cause immunogenic reaction;

(3) the genetically modified stem cell provided by the invention has the advantages that the inflammation of patients in knee and other cartilage repair is obviously improved, the problems of reduction/avoidance of swelling and the like in bone and knee repair by applying the mesenchymal stem cell are effectively relieved, and the clinical value is great.

Drawings

FIG. 1 shows the plasmid map of pCDH-103718 of the example;

FIG. 2 shows a graph of phenotypic results of MSC-103718 cells in experimental examples;

FIG. 3 is a graph showing the results of measurement of the expression amounts of IL10, IL37 and FGF18 in MSC-103718 cells in experimental examples;

FIG. 4 is a schematic diagram showing the results of measurement of adipogenic differentiation capacity of 21 days of induced differentiation culture of each sample in the experimental examples;

FIG. 5 is a schematic diagram showing the results of the osteogenic differentiation potency test of each sample in the experimental example after 21 days of induced differentiation culture;

FIG. 6 is an enlarged schematic view showing the results of examining the chondrogenic differentiation capacity of each sample after 21 days of induced differentiation culture in the experimental examples;

FIG. 7 is a schematic diagram showing the results of examining the chondrogenic differentiation potency of each sample in the experimental example after 21 days of induced differentiation culture;

FIG. 8 is a schematic diagram showing the results of the regulation of immune cells by MSC-103718 cells;

FIG. 9 shows a schematic representation of the results of the inhibition of TNF- α secretion by lymphocytes by MSC-103718 cells.

Detailed Description

The present invention will be described in further detail below with reference to preferred embodiments and examples. The features and advantages of the present invention will become more apparent from the description.

The word "exemplary" is used exclusively herein to mean "serving as an example, embodiment, or illustration. Any embodiment described herein as "exemplary" is not necessarily to be construed as preferred or advantageous over other embodiments.

Mesenchymal stem cells for gene repair

The inventor modifies the mesenchymal stem cells by resisting the nucleic acid coding the inflammatory factor and the nucleic acid coding the cartilage repair factor together, shows the remarkable synergistic effect of multiple genes, and has great clinical value.

The genetically modified stem cells provided according to the invention are resistant to nucleic acids encoding inflammatory factors and nucleic acids encoding cartilage repair factors.

In a preferred embodiment, the anti-inflammatory factor is selected from the interleukin and TGF β receptor family, preferably the anti-inflammatory factor is selected from two or more of interleukin-3 (IL-3), interleukin-4 (IL-4), interleukin-5 (IL-5), interleukin-6 (IL-6), interleukin-10 (IL-10), interleukin-13 (IL-13) and interleukin-37 (IL-37), preferably interleukin 10 and interleukin 37.

Preferably, the nucleic acid encoding interleukin 10 has the sequence of seq id no:1, and the nucleic acid encoding interleukin 37 has the amino acid sequence shown in SEQ ID NO:2, or a pharmaceutically acceptable salt thereof.

Interleukin 10(IL-10), a pleiotropic cytokine, can exert immunosuppressive or immunostimulatory effects in many types of cells. In the aspect of inflammatory reaction, the expression of the major histocompatibility antigen II (MHC II) on the surface of the monocyte can be reduced, the antigen presentation effect of the monocyte can be reduced, the activity of T lymphocyte can be reduced, and the activation, migration and adhesion of inflammatory cells can be inhibited; meanwhile, IL-10 can also inhibit the synthesis and release of inflammatory factors, and has an anti-inflammatory effect. As a negative regulator of cell-mediated immune response, IL-10 inhibits the production of prostaglandin E2 and inflammatory cytokines including TNF- α, IL-1, IL-6, and IL-8. IL-10 inhibits the proliferation of human THO, Th-1, Th-2-like T cell clones. Promote the proliferation of mast cells and thymocytes, and IL-10 is also a compound factor for the growth of lymph nodes and spleen cells. IL-10 inhibits inflammatory and cellular immune responses, enhances tolerance associated with adaptive immunity and clearance functions, and inhibits pro-inflammatory factors produced by monocytes and macrophages. Improve the survival rate of B cells, promote the proliferation of B cells, the expression of MHC II antigens and the secretion of immunoglobulin, and have synergistic effect with IL-4 and IL-5 generated by Th 2. Inhibiting the production of NK cytokines. The generation of nitrogen oxides is suppressed.

Interleukin 37(IL-37) is a newly discovered cytokine of the IL-1 family, and has inhibitory effects on both innate immunity and adaptive immunity. IL-37 is expressed predominantly on neutrophils, lymphocytes, macrophages, monocytes, tissue epithelial cells, keratinocytes and dendritic cells. IL-37 is induced in Peripheral Blood Mononuclear Cells (PBMC), epithelial cells, macrophages and DCs by stimulation with a variety of Toll-like receptors and inflammatory cytokines such as IL-1B, Tumor Necrosis Factor (TNF) alpha and gamma interferon.

The inventor finds that the combination of nucleic acid coding interleukin 10 and nucleic acid coding interleukin 37 can effectively inhibit the innate immune response, effectively regulate the adaptive immune response and maintain the immune tolerance of the organism, and the combination of the two can comprehensively inhibit the activation of various immune cells, thereby improving the inflammatory environment of the organism. .

In the present invention, the nucleic acid encoding interleukin 10 and the nucleic acid encoding interleukin 37 are contained in the same or different expression vectors, preferably in the same expression vector.

In a further preferred embodiment, the nucleic acid encoding interleukin 10 and the nucleic acid encoding interleukin 37 are linked by a sequence encoding a self-cleaving peptide, e.g. a sequence having the sequence as shown in seq id no:3, which encodes a nucleic acid having a sequence as set forth in seq id no:3, or a T2A polypeptide having the amino acid sequence shown in figure 3.

The sequence encoding the self-cleaving peptide is linked between the 3 'end of the nucleic acid encoding interleukin 10 and the 5' end of the nucleic acid encoding interleukin 37.

In a preferred embodiment of the present invention, the nucleic acid encoding the anti-inflammatory factor is carried by a strong promoter that is easily silenced in stem cells, mainly for the purpose of secreting a large amount of inflammatory suppressive factors in the early stage of stem cell transplantation to improve the inflammatory characteristics in the microenvironment of the body, and gradually silenced in the subsequent process by using the easy silencing characteristic, thereby avoiding excessive immunosuppression.

As a strong promoter, CMV is preferably used, which can efficiently and rapidly drive and induce the expression of anti-inflammatory factors, rapidly form an inflammatory inhibition environment and provide a good treatment environment.

The strong promoter is linked to the 5' end of a nucleic acid encoding interleukin 37.

In another preferred embodiment of the genetically modified stem cell provided according to the present invention, the cartilage repair factor is selected from fibroblast growth factors such as FGF2a, FGF2b, FGF18 or FGF23, etc., more preferably the cartilage repair factor is selected from fibroblast growth factor 18(FGF 18).

Preferably, the nucleic acid encoding fibroblast growth factor 18 has the sequence as shown in seq id no: 4.

Fibroblast Growth Factors (FGFs) are polypeptides consisting of about 150-200 amino acids, present in two closely related forms, basic fibroblast growth factor (bFGF) and acidic fibroblast growth factor (aFGF). Both FGFs stimulate DNA synthesis of isolated rat calvarial osteoblast-like cells, while bFGF stimulates colony formation of differentiated chondrocytes in agar, acting as mitogen and morphology. FGF increases the number of poorly differentiated preosteoblasts in vivo. FGF is added into chicken embryo to proliferate osteoblasts and chondrocytes and form bone matrix.

FGF18 is a highly conserved protein consisting of 207 amino acids with 30% -70% homology to other members of the FGFs found. The FGF18 protein plays an important role in the growth, development and development of bones, and is also involved in the activities of cortical neurons, the survival, differentiation and proliferation of adenohypophysis, and the regulation of hair growth and skin repair.

The inventor finds that during the treatment of the bone and knee joint, severe inflammatory reaction often exists at the treatment part, and particularly after the injury repair treatment is carried out by using stem cells, the symptoms of the injury part, namely the rigor and pain are more serious are more likely to appear in some patients. Clinically, blocking pain medications are often used to ameliorate the symptoms. In addition, the directed differentiation of stem cells is different according to microenvironment, and the existence of inflammatory environment does not facilitate the differentiation of stem cells to bone and cartilage. The inventor invents that the stem cells can be better differentiated towards the bone and the cartilage by continuously secreting anti-inflammatory factors such as IL10 and IL37 by the stem cells, improving the self-differentiation microenvironment, continuously relieving local injection inflammatory reaction and then combining with factors (FGF18) driving the stem cells to differentiate towards the cartilage, so that the influence of repeated stimulation of local parts by continuous in vitro administration is reduced. In a preferred embodiment of the present invention, the nucleic acid encoding the cartilage repair factor is carried using a medium-strength promoter that is not easily silenced in stem cells, which facilitates stable expression of the cartilage repair factor in an early, rapidly-formed inflammatory suppressive environment, resulting in stable cartilage repair.

As the medium strength promoter, EF1 α, SV40, PGK1 or Ubc, etc., are preferably used, and EF1 α promoter is preferred because it is a strong mammalian cell expression promoter derived from human elongation factor 1 α, and its expression level is sufficiently stable regardless of the cell type and the cell location.

The medium strength promoter is preferably linked 5' to the nucleic acid encoding the cartilage repair factor by an enhancer.

According to a preferred embodiment of the invention, the genetically modified stem cell further comprises an expression vector, the nucleic acid encoding the anti-inflammatory factor and the nucleic acid encoding the cartilage repair factor being contained in the same or different expression vectors, preferably in the same expression vector.

In a further preferred embodiment, the nucleic acid encoding an anti-inflammatory factor and the nucleic acid encoding a cartilage repair factor are linked by a medium strength promoter.

In a preferred embodiment of the invention, the nucleic acid encoding the anti-inflammatory factor and the nucleic acid encoding the cartilage repair factor are linked, for example by a medium strength promoter.

More preferably, a medium strength promoter such as EF1a is linked to an enhancer which is in turn linked to the 5' end of the nucleic acid encoding the cartilage repair factor and a medium strength promoter is linked to the nucleic acid encoding the anti-inflammatory factor.

According to a preferred embodiment of the invention, the stem cells are mesenchymal stem cells, derived from adipose tissue, umbilical cord, bone marrow or cord blood, preferably derived from umbilical cord.

Wherein the Mesenchymal Stem Cell (MSC) is a pluripotent stem cell having all the commonalities of stem cells, i.e., self-renewal and multipotential differentiation capacity. In addition, it has immunoregulation function, and can inhibit T cell proliferation and immune reaction thereof by intercellular interaction and cytokine production, thereby playing the role of immune reconstitution; meanwhile, the mesenchymal stem cells have convenient sources, are easy to separate, culture, amplify and purify, still have the characteristics of the stem cells after multiple times of passage amplification, and have no immunological rejection.

The umbilical cord mesenchymal stem cells are derived from in vitro umbilical cord tissues, are convenient to obtain, wide in source and free from the debate and limitation of ethics, meanwhile, the obtained materials are non-invasive to a donor and are not influenced by the age factor of the donor, the in vitro separation culture is simple, the amplification is rapid, the immunogenicity is low, the tumorigenicity is avoided, and the umbilical cord mesenchymal stem cells can be used as a cell subcarrier for gene therapy. Under the specific induction condition in vivo or in vitro, the umbilical cord mesenchymal stem cells can be differentiated into various tissue cells, still have multidirectional differentiation potential after continuous subculture and cryopreservation, and are ideal seed cells for cell transplantation treatment.

Therefore, umbilical cord-derived mesenchymal stem cells are preferably used in the present invention.

Second, preparation method of mesenchymal stem cells related to gene repair

The present invention provides a method for preparing a genetically modified stem cell for cartilage repair therapy, comprising linking a nucleic acid encoding an anti-inflammatory factor and a nucleic acid encoding a cartilage repair factor and introducing the linked nucleic acids into a mesenchymal stem cell.

According to a preferred embodiment of the present invention, the preparation method comprises the steps of:

The methods of making the genetically modified stem cells are further described below:

step 1, obtaining nucleic acid for coding anti-inflammatory factor and nucleic acid for coding cartilage repair factor, connecting with vector plasmid after enzyme digestion to obtain recombinant plasmid.

Wherein, the nucleic acid coding the anti-inflammatory factor is nucleic acid coding a double anti-inflammatory factor, can code IL10 and IL37 simultaneously, and the part of the nucleic acid coding IL10 has the nucleotide sequence shown in SEQ ID NO: 1; the part of the recombinant human IL37 has the structure shown in SEQ ID NO: 2.

In the nucleic acid encoding the double anti-inflammatory factor, the nucleic acid encoding IL10 and the nucleic acid encoding IL37 are preferably connected through a T2A sequence, and the T2A sequence is shown as SEQ ID NO. 3.

The part of the nucleic acid encoding the double anti-inflammatory factor encoding IL10 is linked to the strong promoter CMV.

The nucleic acid encoding the cartilage repair factor is a nucleic acid encoding FGF18, and has the nucleotide sequence shown as SEQ ID NO: 4.

In a preferred embodiment, the 5 'end of the nucleic acid encoding FGF18 is linked to a medium strength promoter via an enhancer 5' LTR sequence, e.g. having a sequence as set forth in seq id no:7 under stringent conditions and the sequence EF1a of the nucleotide sequence shown in 7.

In a more preferred embodiment, the portion of the nucleic acid encoding an anti-inflammatory factor encoding IL37 is linked via promoter EF-1. alpha. to an enhancer 5'LTR sequence (having the nucleotide sequence shown in SEQ ID NO: 5), which 5' LTR sequence is in turn linked to a nucleic acid encoding a cartilage repair factor.

In the present invention, the method commonly used in the prior art is adopted to carry out enzyme digestion on a nucleic acid part encoding an anti-inflammatory molecule and a nucleic acid encoding a nucleic acid part encoding a cartilage repair factor, and carry out enzyme digestion on a vector plasmid, T4 ligase is used for overnight connection at 4 ℃, DH5 alpha competent cells are transformed, 100 mu L of bacterial liquid is taken and coated on an LB plate containing ampicillin resistance, overnight culture is carried out at 37 ℃, a single clone is selected for colony PCR, a positive clone is sent for sequencing, a clone with a correct sequencing result is stored, and a plasmid is extracted, wherein the map of the clone is shown in figure 1.

Wherein the vector plasmid is pCDH-CMV, the recombinant plasmid is pCDH-103718, and the enzyme used for enzyme digestion is preferably XbaI and SaII.

And 2, transfecting the recombinant plasmid and the packaging plasmid to obtain the recombinant lentiviral vector containing the nucleic acid for encoding the anti-inflammatory molecule and the nucleic acid for encoding the cartilage repair molecule.

Wherein, step 2 comprises the following substeps:

step 2-1, culturing the packaging cells

In the invention, the packaging cells are preferably 293T cells, the 293T cells are activated and then resuspended, the cells are inoculated into a culture dish for culture, and digestion is carried out when the confluency of the cells reaches over 90%; after termination of the digestion, the cells are centrifuged, resuspended and the cells are seeded in each coated culture dish for packaging the virus, preferably 1X10 cells per culture dish (150mm)⁷～1.5×10⁷Each cell, preferably 1.2X 10, is inoculated per culture dish⁷And (4) cells.

Wherein the culture medium of the 293T cells is 10% FBS +1mM sodium pyruvate +2mM glutamine + 1% non-essential amino acid + DMEM medium.

Step 2-2, transfection of packaging cells

Specifically, the packaging plasmid is mixed with the recombinant cloning plasmid (pCDH-103718) obtained in step 1, and after incubation, transfection reagent is added and incubated at room temperature to form a DNA-transfection reagent complex.

In the present invention, the packaging plasmid may be a lentiviral packaging helper plasmid commonly used in the art, such as pmd.2g and PSPAX available from Addgene, preferably the mass ratio of the pmd.2g plasmid to the PSPAX plasmid is 2:1, more preferably the mass ratio of the pmd.2g plasmid, the PSPAX plasmid and the pCDH-103718 plasmid is 2:1: 3.

The transfection reagent may be a reagent commonly used in the art, for example, PEI (commercially available from Polyscience) solution, and the transfection reagent is added dropwise to the plasmid mixing system after being mixed with DMEM medium.

And uniformly mixing the DNA-transfection reagent compound with the packaging cells, culturing, periodically changing the liquid in the culture process, collecting the supernatant after changing the liquid, and storing the supernatant at 4 ℃.

According to a preferred embodiment of the invention, the collected supernatant is concentrated and subjected to a virus titer determination,

the concentration is preferably performed by centrifugation of the supernatant at low temperature.

And 3, transfecting the obtained recombinant lentiviral vector to mesenchymal stem cells to obtain the genetically modified stem cells.

Preferably, the mesenchymal stem cells are isolated by using a climbing umbilical cord tissue block method.

Specifically, the method comprises the following steps: the isolated umbilical cord from normal labor is placed in PBS buffer containing 200U/mL penicillin and 200U/mL streptomycin, and in order to ensure the activity of the umbilical cord tissue, the fresh umbilical cord is separated within 6 h. Flushing residual hematocele in umbilical vein and umbilical artery with 20mL syringe, and cutting umbilical cord tissue into pieces of 1mm³Filtering the small umbilical cord tissue blocks with a 200-mesh filter screen, collecting umbilical cord tissue blocks on the 200-mesh filter screen, and removing the small umbilical cord tissue blocks to obtain umbilical cord tissue blocks with the diameter of 1-1.5 mm. Collecting tissue blocks with diameter of 1-1.5mm, directly inoculating the tissue blocks into culture flask, and directly placing in 5% CO₂And standing for 1-2h in an incubator at 37 ℃. After the tissue block adheres firmly, adding alpha-MEM culture solution containing 10% fetal calf serum, and placing in 5% CO₂Continuously culturing in a 37 ℃ culture box, and after five days, the proliferation of the umbilical cord tissue mesenchymal stem cells is fully paved by about 80 percent in a culture bottle; the cells obtained were primary cells after digestion with 0.25% trypsin (0.01% EDTA). MSC is isolated and cultured by an umbilical cord tissue block climbing method, a small amount of cells climb out around the umbilical cord tissue after 72 hours, the cells are free from the tissue after about 7 days and gradually form clone, and the prepared mesenchymal stem cells are frozen and stored.

Step 3 comprises the following substeps:

step 3-1, culturing and inoculating the stem cells

Resuscitating the pre-frozen stem cells, digesting the cells with 0.05% trypsin after the resuspension cells are full, terminating the digestion with a serum-containing medium, centrifuging and repeatingSuspending the cells. The cells are then seeded onto culture dishes, preferably 2X 10 cells per dish (150mm)⁶～2.5×10⁶Individual cells, the media was changed the next day after inoculation.

Step 3-2, adding a lentivirus vector, and continuing to culture

Adding Polybrene (Polybrene) into the inoculated cells, adding corresponding volume of lentiviral vector LV-103718 lentivirus according to the MOI value of the cells and the virus titer, and culturing.

Wherein, the added lentiviral vector volume is (MOI × cell number)/viral titer. The MOI refers to the ratio of virus to cell number during transduction, and in the invention, the MOI is preferably 10-50, such as 40.

At 37 deg.C, 5% CO₂Culturing for 6-8h at saturated humidity, removing culture medium containing virus, replacing with serum-free culture medium, and culturing at 37 deg.C and 5% CO2 at saturated humidity for 2-3 days.

Step 3-3, subculturing the cells

In the invention, when the genetically modified cells are full, 0.05 percent of trypsin is adopted to digest the cells, the digestion is stopped by a culture medium containing serum, the cell suspension is centrifuged at 800rpm for 5min, the centrifuged cells are resuspended by a serum-free culture medium, and the cells are subcultured according to the passage ratio of 1:6, the serum-free culture medium is 37 ℃ and the 5 percent CO₂Culturing for 3 days until the cells grow full to obtain the genetically modified stem cells, which are marked as MSC-103718.

Furthermore, the invention also provides the genetically modified stem cell prepared by the method.

The invention also provides the application of the genetically modified stem cell in preparing a medicament for repairing/treating cartilage diseases.

The cartilage diseases include acute cartilage injury, chronic articular cartilage abrasion, recurrent polychondritis and the like, and the chronic articular cartilage abrasion is preferred.

Typically, the cartilage-related disease is manifested by degenerative arthritis, bursitis, synovitis, cervical spondylosis, lumbar spondylosis, scapulohumeral periarthritis, hyperosteogeny, rheumatoid arthritis, and the like.

Still further, the present invention provides a pharmaceutical composition comprising the above genetically modified stem cell or the stem cell prepared by the above method.

The dosage form of the pharmaceutical composition can be any form known in the medical field, and is preferably tablets, pills, suspensions, emulsions, solutions, injections, gels, capsules, powders, granules or suppositories, and is more preferably an injection.

Preferably, the pharmaceutical composition further comprises a pharmaceutically acceptable carrier or excipient, preferably comprising a pharmaceutically acceptable sterile isotonic aqueous or non-aqueous solution (e.g., a balanced salt solution or physiological saline), dispersion, suspension or emulsion.

More preferably, the pharmaceutical composition may be transplanted in the form of a suspension, gel, colloid, slurry or mixture.

In the present invention, the pharmaceutical composition is formulated according to the principles of cellular drugs prescribed in the prior art, for example, according to hematopoietic stem cell therapy (hematopietic stem cell therapy), e.d. ball, j.list & p.law, churchlilllingstone, 2000.

According to a preferred embodiment of the present invention, the pharmaceutical composition may be administered to a subject by intradermal injection, subcutaneous injection, intramuscular injection, intravenous injection or oral administration,

the subject is a mammal, e.g., a human.

Examples

The present invention is further described below by way of specific examples, which are merely exemplary and do not limit the scope of the present invention in any way.

Example 1

Synthesis of human XbaI-IL10-T2A-IL37-EF1 alpha-5' LTR-FGF18-SaIl

Connecting IL10 encoding nucleotide (the nucleotide Sequence is shown as SEQ ID NO: 1) and IL37 encoding nucleotide (the nucleotide Sequence is shown as SEQ ID NO: 2) by using T2A (the nucleotide Sequence is shown as SEQ ID NO: 3), connecting 5'LTR Sequence (the Sequence is shown as SEQ ID NO: 5) and EF1 alpha promoter (the Sequence is shown as SEQ ID NO: 7) before FGF18 encoding nucleotide (the nucleotide Sequence is shown as SEQ ID NO: 4), connecting IL37 with EF1 alpha promoter, introducing enzyme cutting sites XbaI and SaII at two ends, synthesizing human XbaI-IL10-T2A-IL37-EF1 alpha-5' LTR-FGF18-SaIl, and naming as Sequence103718, wherein the Sequence is shown as SEQ ID NO: and 6.

EXAMPLE 2 construction of pCDH-103718 plasmid

The pCDH-CMV plasmid (Addgene) is cut by XbaI and SaII enzyme, and a 6195bp fragment is recovered from a product gel to be used as a vector.

Sequence103718 was digested with XbaI and SaII and the product gel recovered as a 2487bp fragment.

Taking a pCDH-CMV plasmid restriction enzyme product vector and a Sequence103718 restriction enzyme product fragment, carrying out overnight connection at 4 ℃ by using T4 ligase, transforming DH5 alpha competent cells, taking 100 mu L of bacterial liquid, coating the bacterial liquid on an LB plate containing ampicillin resistance, carrying out overnight culture at 37 ℃, selecting a single clone to carry out colony PCR, sending a positive clone to Sequence, storing the clone with a correct sequencing result, extracting a plasmid, and naming the clone as pCDH-103718, wherein the map is shown in figure 1.

EXAMPLE 3pCDH-103718 plasmid lentivirus packaging

(1) Preparation of 293T cells: 1 frozen 293T cell (purchased from ATCC) was rapidly placed in a 37 ℃ water bath from liquid nitrogen until ice disappeared, added dropwise to a 15ml centrifuge tube containing 5ml of a pre-warmed medium, centrifuged at 1200rpm for 3min, the supernatant discarded, the cells were re-suspended with 293T medium (10% FBS +1mM sodium pyruvate +2mM glutamine + 1% non-essential amino acid + DMEM) and inoculated into a 150mM petri dish, 37 ℃ with 5% CO₂And (5) culturing at saturated humidity. In the culture process, when the confluency of cells reaches more than 90%, subculturing, discarding the old culture medium, adding 5ml of sterilized PBS solution, gently shaking, washing the cells, discarding the PBS solution, adding 2ml of 0.25% Trypsin-EDTA digestive juice, and digesting for 1-2min until the cells are completely digested. The digestion was stopped by adding serum-containing medium, the cell suspension was centrifuged at 1200rpm for 3min, and the centrifuged cells were resuspended in medium. Each coated 150mm dish was seeded with 1.2X 107 cellsFor packaging lentivirus, 5% CO at 37 ℃₂Saturated humidity culture, 20ml medium/dish.

(2) Transfection of 293T cells: 2 hours before transfection, the 293T cell culture medium is replaced by 18ml of DMEM medium, 1ml of preheated DMEM medium is added into a sterilized centrifuge tube A, a mixture of packaged plasmids PMD.2G (Addgene), PSPAX (Addgene) and plasmid pCDH-103718 is added according to the mass ratio of 2:1:3, and the mixture is blown and uniformly mixed. 1ml of preheated DMEM medium was added to the B sterilized centrifuge tube, then 162. mu.l of PEI as a transfection reagent was added and mixed well. Tubes A and B were incubated at room temperature for 5 min. The liquid in tube B was added dropwise to tube A, mixed well and incubated at room temperature for 10min to form DNA-transfection reagent complexes. Transferring the DNA-transfection reagent complex to 293T cells with a pre-changed solution, mixing, and performing 5% CO at 37 deg.C₂And (5) culturing at saturated humidity. After 6-8h of incubation, the medium containing the transfection mixture was aspirated, and 20ml of preheated DMEM medium containing 5% FBS was added to each dish of cells, at 37 deg.C and 5% CO₂And (5) culturing at saturated humidity. After the medium change, the supernatants were collected for 24h and 48h respectively and stored at 4 ℃ and 20ml of fresh medium was changed.

(3) Collecting and concentrating the recombinant lentivirus: centrifuging the collected liquid at 4 ℃ and 3500rpm for 15min, discarding the precipitate, mixing the supernatant with 5XPEG, standing at 4 ℃ for 24h, centrifuging at 4 ℃ and 3000rpm for 30min, discarding the supernatant, resuspending the precipitate into 500 μ l DMEM medium, and performing virus titer determination, wherein the virus is named as LV-103718.

Example 4 isolated culture of mesenchymal Stem cells

The method for separating the mesenchymal stem cells by adopting the umbilical cord tissue block climbing method comprises the following specific steps:

the isolated umbilical cord from normal labor is placed in PBS buffer containing 200U/mL penicillin and 200U/mL streptomycin, and in order to ensure the activity of the umbilical cord tissue, the fresh umbilical cord is separated within 6 h. Flushing residual hematocele in umbilical vein and umbilical artery with 20mL syringe, cutting umbilical cord tissue into tissue blocks with size of 1mm3 with tissue scissors, filtering the obtained small umbilical cord tissue with 200 mesh filter screen, collecting umbilical cord tissue blocks on 200 mesh filter screen, removing small umbilical cord tissue blocks to obtain umbilical cord tissue blocks with diameterMultiple umbilical cord tissue blocks of 1-1.5 mm. Collecting tissue blocks with diameter of 1-1.5mm, directly inoculating the tissue blocks into culture flask, and directly placing in 5% CO₂And standing for 1-2h in an incubator at 37 ℃. After the tissue blocks adhered firmly, the culture medium of alpha-MEM (purchased from Gibco) containing 10% fetal bovine serum was added and placed in 5% CO₂Continuously culturing in a 37 ℃ culture box, and after five days, the proliferation of the umbilical cord tissue mesenchymal stem cells is fully paved by about 80 percent in a culture bottle; the cells obtained were primary cells after digestion with 0.25% trypsin (0.01% EDTA). MSC is isolated and cultured by an umbilical cord tissue block climbing method, a small amount of cells climb out around the umbilical cord tissue after 72 hours, the cells are free from the tissue after about 7 days and gradually form clone, and the prepared mesenchymal stem cells are frozen and stored.

Example 5 genetic modification of mesenchymal Stem cells

Resuscitating the pre-frozen P3 mesenchymal stem cells to a 150mm culture dish in 20ml serum-free medium at 37 deg.C and 5% CO₂And (5) culturing at saturated humidity. After the revived cells were confluent, the cells were digested with 0.05% trypsin, the digestion was stopped with serum-containing medium, the cell suspension was centrifuged at 800rpm for 5min, and the centrifuged cells were resuspended in MSC serum-free medium (purchased from Bioind). Inoculating 2-2.5X 10 cells per 150mm culture dish⁶Cells, the medium from which the cells were aspirated the next day after seeding was discarded, replaced with serum-free α -MEM medium, 20ml of medium/dish, 16 μ l of Polybrene (purchased from Sigma) was added, and LV-103718 lentivirus obtained in example 4 (titer 1X 10) was added at the same time according to 40MOIs multiplicity of infection⁸U/ml)，37℃、5％CO₂Culturing for 6-8h under saturated humidity. The virus-containing alpha-MEM medium was discarded after 6-8 hours and replaced with serum-free medium at 37 ℃ with 5% CO₂The cultivation is continued for 2-3 days under saturated humidity. Digesting the cells with 0.05% trypsin after the cells are full, terminating the digestion with a serum-containing medium, centrifuging the cell suspension at 800rpm for 5min, resuspending the centrifuged cells with a serum-free medium, and passaging at a passage ratio of 1:6, wherein the serum-free medium is at 37 ℃ and 5% CO₂The culture was carried out for 3 days. The resulting LV-103718 modified mesenchymal stem cell was named MSC-103718.

Examples of the experiments

Experimental example 1 identification of cell phenotype

Selecting cells before freezing, digesting with 0.05% pancreatin, washing twice with PBS, and labeling 5 × 10 with mouse anti-human CD11b-PE, CD45-PE, HLA-DR-PE, CD73-PE, CD90-PE, CD105-PE, CD34-FITC and CD19-FITC antibodies respectively⁵The MSCs were kept in the dark at room temperature for 30min, washed twice with PBS, fixed with 4% paraformaldehyde, and subjected to FACS detection. And (4) freezing the qualified cells in a liquid nitrogen tank, recovering when used and performing post-treatment. As shown in particular in fig. 2.

The results show that: the gene modification does not affect the dryness of MSC cells and has no obvious adverse effect on differentiation to bones and cartilages in later period.

Experimental example 2 detection of expression amounts of IL10, IL37 and FGF18 in MSC-103718 cells

Culturing different groups of cells in 100mm culture medium, respectively, removing original MSC serum-free medium, 10ml alpha-MEM medium, 37 deg.C, 5% CO when the cell confluence degree reaches 70% -80%₂The cultivation was continued for 48h at saturated humidity. The culture supernatants of the three cells were collected and stored at 4 ℃ for further use. The product can be stored in a refrigerator at-80 deg.C for a long time. The secretory amounts of IL10, IL37 and FGF18 factors in MSC-103718 cells were measured by using human IL10, IL37 and FGF18 assay kits (Xinbo Sheng Biotech Co., Ltd.) according to the instructions.

The results are shown in FIG. 3, the MSC after LV-103718 gene modification can highly express IL10, IL37 and FGF18 factors.

Experimental example 3 adipogenic differentiation, osteogenic differentiation and chondrogenic differentiation

(1) Induction of adipogenesis

Inoculation of hmscs with maintenance medium: pre-coating of 24-well plates with MSCATtachhmentsolution (BI; P/N:05-752-1, 1:100DPBS dilution), Per well add

6X104 cells (3X104cells/cm2) were seeded. Standing at 37 deg.C for 5% CO₂Culturing in a cell culture box.

Differentiation culture with adipogenicAnd (3) inducing differentiation: after 24h of culture, it was confirmed that the degree of cell fusion reached 80-90%, the maintenance medium was aspirated off, and 0.5ml of differentiation medium was added per well (24-well plate). Standing at 37 deg.C for 5% CO₂Culturing in cell culture box for 14-21 days. The medium change was performed as follows, using a complete differentiation medium for 6 to 8 days, during which the medium was changed every 3 to 4 days. After differentiation was complete, the medium was changed to maintenance medium. Mature adipocytes (i.e., lipid droplet formation) are observed, i.e., staining is possible.

Oilred-O staining procedure: the medium was aspirated and washed once with DPBS (1ml/well, 24-well plate). Fixing: DPBS was aspirated off and 10% formalin (4% formaldehyde; 1ml/well, 24-well plate) was added. Fixing for 30-60 minutes at room temperature. Formalin was aspirated and washed with 60% isopropanol for 2-3 minutes (1ml/well, 24-well plate). The isopropanol was aspirated off and Oilred-O staining working solution (1ml/well, 24-well plate) was added. Standing at room temperature for 10-30 min. Washing with distilled water to remove excess dye. The staining effect is shown in fig. 4, where sample 1 and sample 2 are two independent samples from different individuals.

(2) Osteogenic induction

Inoculating hMSC: pre-coating of 24-well plates with MSCATtachhmentsolution (BI; P/N:05-752-1, 1:100DPBS dilution), Per well add

Inoculation 6X10⁴Cell (3X 10)⁴cells/cm²). Standing at 37 deg.C for 5% CO₂Culturing in a cell culture box.

Inducing differentiation by an osteogenic differentiation medium: after 24h of culture, it was confirmed that the degree of cell fusion reached 80-90%, the maintenance medium was aspirated off, and 0.5ml of differentiation medium was added per well (24-well plate). Standing at 37 deg.C for 5% CO₂Culturing in incubator for 10-21 days, and changing culture medium every 2-3 days.

And (3) osteogenesis evaluation: the medium was aspirated and washed once (1ml/well) with DPBS (BI; 02-023-1). Fixing: DPBS was aspirated and 1ml of 70% EtOH was added per well. Fixing for 30-60 minutes at room temperature. EtOH was aspirated and washed 3 times with distilled water (1 ml/well). Distilled water was removed by suction and 1ml of 2% ARS staining solution was added to each well. Standing at room temperature for 30-60 min. The staining solution was aspirated off and washed 4 times with 1ml of distilled water (1 ml/well). 1ml of distilled water was added to each well to avoid drying of the cells. The osteogenic staining effect is shown in fig. 5, where sample 1 and sample 2 are two independent samples from different individuals.

(3) Chondrogenic induction

Inoculation of hmscs with maintenance medium: cells were cultured at 1X10⁵V (10. mu.l of medium) into a 96-well plate (non-TC-treated) with 1-well U-bottom placed at 37 ℃ in 5% CO₂After 2 hours in the cell incubator (to promote cell aggregation), 0.1ml of medium was carefully added. The culture of small micelles helps to form spherical cell mass, and the spherical cell mass is returned to 37 ℃ and 5% CO₂The cell culture box continues to culture.

Inducing differentiation by chondrogenic differentiation medium: after 24 hours of culture, the maintenance medium was aspirated off, and 0.2ml of differentiation medium was added per well (96-well plate), and a globular cell mass formed in 24-48 hours. Standing at 37 deg.C for 5% CO₂Culturing in cell culture box for 14-21 days. The differentiation medium was changed every 3-4 days. Longer culture times help to obtain more mature chondrocytes.

Alcainblue staining procedure: the medium was aspirated and washed once with DPBS (BI; 02-023-1, 0.2 ml/well). Fixing: DPBS was aspirated and 0.2ml of 10% formalin (4% formaldehyde) was added per well. Fixing for 30-60 minutes at room temperature. Formalin was aspirated and washed 2 times with 0.2ml distilled water per well. Distilled water was removed by suction, and 0.2ml of AlcianBlue dyeing working solution was added to each well. Protected from light overnight at room temperature. The staining solution was aspirated and washed 2-3 times with 0.2ml0.1NHCl per well. HCl was removed by suction and 0.2ml of distilled water was added per well. The staining results are shown in fig. 6 and 7, where samples 1-4 are four independent samples from different individuals.

As can be seen from fig. 4, 5, 6 and 7, MSC-103718, which is a stem cell modified with LV-103718, can rapidly differentiate into osteoblasts and chondroblasts with a higher efficiency than that of the unmodified MSC cell; LV-103718 modification had no significant effect on adipogenic differentiation.

Experimental example 4 Effect of MSC-103718 on recovery of inflammatory cartilage

(1) Immunological reaction detection

PBMC separation culture: transferring 10ml of whole blood into a 50ml centrifuge tube, adding 10ml of PBS solution for dilution, and gently mixing uniformly; two 15ml centrifuge tubes were taken and 5ml of lymphocyte separation (ficoll) solution was added first. Then, slightly adding the diluted blood to the upper layers of the ficoll of the two centrifuge tubes, wherein the two solutions are prevented from being mixed together, and 10ml of diluted blood is added into each centrifuge tube; 2,000rpm, 20min, note that the deceleration setting must be set to noblack, or only 1-2 brake. Finishing centrifugation; the cell layer of PBMC is white. The layer of cells can now be pipetted into another clean 15ml centrifuge tube. Adding PBS to 10-15ml, centrifuging at 1,500rpm for 10min, removing supernatant, and adding culture medium for cleaning; the cells were resuspended by adding 5-10ml of medium and subsequently counter-cultured or plated.

MSCs (MSC group, MSC-1037 group, and MSC-18 group) were co-cultured with PBMCs: each well-grown MSC group (MSC group, MSC-1037) (obtained by the method of examples 1-4, except that synthetic human source in example 1)XbaI-IL10- T2A-IL37-EF1α-SaIl) Group, MSC-18 (obtained by the method of examples 1-4, except that synthetic human source in example 1)XbaI-EF1α-5'LTR-FGF18-SaIl) Panel and MSC-103718 panel) were counted and centrifuged to adjust the cell concentration to 3 × 10⁵And/ml, the cells are respectively inoculated into a 6-well plate according to the ratio of 2ml/well, 3 wells are paralleled, the solution is changed after the cells are cultured for 16-18h at 37 ℃ by 5% CO2 and stably adhere to the walls according to the ratio of MSCs: mixing PBMC at a ratio of 1:5, standing at 37 deg.C with 5% CO₂The co-cultivation was continued in the incubator. After 48h, cell suspensions were collected and the corresponding immune cell phenotypes were examined by flow cytometry, and culture supernatants were collected and assayed for TNF-. alpha.cytokine content by ELISA.

As a result, as shown in fig. 8: compared with other groups, the MSC-103718 group can better inhibit the proliferation of total lymphocytes, inhibit the proliferation of Th1 type lymphocytes and Th17 type lymphocytes and promote the proliferation of Treg cells; as shown in fig. 9: the MSC-103718 group was able to better inhibit the expression of TNF-. alpha.cytokines than the other groups.

(2) Directional differentiation culture of cartilage repair ability to cartilage: p1 subculture until the cells are full of the bottom of the flask, adjusting the cell concentration after digestion, adding 10% fetal calf containing TGF beta 1(10ng/ml)Serum in high-sugar DMEM solution. Adjusting the concentration of cell suspension of MSC group, MSC-1037 group, MSC-18 group and MSC-103718 group, adding dropwise onto PLGA scaffold, and adding 5% CO at 37 deg.C₂And culturing in an incubator for 7-d. After the vein anesthesia is successful and the preparation of an operation area is finished after 10 healthy beagle dogs with 10-12 months of age are transplanted by the complex, taking an incision on the inner side of a knee joint, exposing the knee joint, and manufacturing a cylindrical cartilage defect area with the diameter of mm at a femoral pulley of the knee joint by using a hand drill to reach the subchondral bone. The materials are taken at 12 and 16 weeks after operation, and the growth condition of the cartilage in the defect area is observed.

As a result: the composite material shows that the adhesion, the extension and the proliferation of the MSCs cells on the PLGA stent are good, and the riveting effect of a matrix secreted by the cells and cell pseudopodia can be seen, which indicates that the stent material has good cell affinity.

12 weeks after surgery: the surfaces of the new tissues of the MSC-103718 group are flat and smooth, the boundary lines with the surrounding cartilages are fuzzy, and the end surfaces show that the thickness of the cartilages is similar to that of the normal cartilages; the repair height of the MSC and the MSC-1037 groups is similar to the level of the surrounding cartilage, but the thickness of the cartilage layer is obviously thinner and dull than that of the group A, and the boundary line between the cartilage layer and the surrounding cartilage is clear; the MSC-18 group had a partial near normal repair height, with the repaired tissue yellow and partially depressed. After 16 weeks of operation, tissues in the defect repair area of the MSC-103718 group are integrated with surrounding articular cartilage, and the cartilage defect area is covered by smooth white semitransparent tissues without difference from the appearance of the surrounding cartilage tissues; the repairing tissues of the defect areas of the MSC-Con and MSC-1037 groups are integrated with the peripheral cartilage part, and the luster is poor; the repairing tissue at the defect part of the MSC-18 group has soft and lusterless regeneration tissue, and is obviously different from the surrounding cartilage tissue.

SEQ ID NO. 1 nucleotide sequence (534bp) for encoding IL10

atgcacagcagcgctctgctgtgctgcctggtgctgctgacaggagtgagagcctcccctggacagggaacacagtccgaaaactcctgcacccacttccccggaaacctgcctaacatgctgagagacctgagagatgccttctcccgggtgaaaaccttcttccagatgaaggaccagctggacaacctgctgctgaaagagagcctgctggaggacttcaagggctacctggggtgccaggctctgtcagaaatgatccagttctatctggaggaggtgatgccacaggccgagaaccaggaccctgacatcaaggcccacgtgaacagcctgggcgaaaacctgaaaaccctgagactgcggctgagacggtgccataggttcctgccatgcgagaacaagagcaaggccgtggagcaggtgaaaaacgccttcaacaagctgcaggagaagggaatctacaaggccatgagcgaatttgacatcttcattaactacatcgaagcctacatgaccatgaaaatcagaaat

Nucleotide sequence (654bp) of SEQ ID NO. 2 coding IL37

atgagcttcgtgggcgaaaacagcggggtgaagatgggaagcgaggactgggaaaaggacgagcctcagtgctgcctggaggaccctgctggatctcctctggaacctggacctagcctgccaactatgaacttcgtgcacacaagccccaaggtgaaaaacctgaaccccaaaaagttctccatccatgaccaggaccacaaagtgctggtgctggacagcggaaacctgatcgctgtgcctgacaaaaactacatcagacccgaaatcttcttcgccctggccagctcactgagctctgcttctgctgagaagggcagccctatcctgctgggagtgtctaagggcgagttctgcctgtattgcgacaaggacaagggccagtcccacccttctctgcagctgaaaaaggagaagctgatgaagctggccgctcagaaagagtccgccagaagaccattcattttctatagagcccaggtgggaagctggaacatgctggaaagcgccgctcatccaggctggtttatttgcaccagctgcaactgcaatgagcccgtgggagtgaccgacaagtttgagaacagaaagcacatcgagttttccttccagcccgtgtgcaaggccgagatgtcaccttctgaggtgagcgac

SEQ ID NO. 3T2A nucleotide sequence (54bp)

gagggcagaggaagtctgctaacatgcggtgacgtcgaggagaatcctggacct

SEQ ID NO. 4 nucleotide sequence (621bp) encoding FGF18

atgtattcagcgccctccgcctgcacttgcctgtgtttacacttcctgctgctgtgcttccaggtacaggtgctggttgccgaggagaacgtggacttccgcatccacgtggagaaccagacgcgggctcgggacgatgtgagccgtaagcagctgcggctgtaccagctctacagccggaccagtgggaaacacatccaggtcctgggccgcaggatcagtgcccgcggcgaggatggggacaagtatgcccagctcctagtggagacagacaccttcggtagtcaagtccggatcaagggcaaggagacggaattctacctgtgcatgaaccgcaaaggcaagctcgtggggaagcccgatggcaccagcaaggagtgtgtgttcatcgagaaggttctggagaacaactacacggccctgatgtcggctaagtactccggctggtacgtgggcttcaccaagaaggggcggccgcggaagggccccaagacccgggagaaccagcaggacgtgcatttcatgaagcgctaccccaaggggcagccggagcttcagaagcccttcaagtacacgacggtgaccaagaggtcccgtcggatccggcccacacaccctgcc

SEQ ID NO: 55' LTR nucleotide sequence (269bp)

ggggctcgcatctctccttcacgcgcccgccgccctacctgaggccgccatccacgccggttgagtcgcgttctgccgcctcccgcctgtggtgcctcctgaactgcgtccgccgtctaggtaagtttaaagctcaggtcgagaccgggcctttgtccggcgctcccttggagcctacctagactcagccggctctccacgctttgcctgaccctgcttgctcaactctacgtctttgtttcgttttctgttctgcgccgttacagatc

6XbaI-IL10-T2A-IL37-EF-1 alpha-5' LTR-FGF18-SaIl nucleotide sequence (2506bp)

tctagagctagcgccaccatgcacagcagcgctctgctgtgctgcctggtgctgctgacaggagtgagagcctcccctggacagggaacacagtccgaaaactcctgcacccacttccccggaaacctgcctaacatgctgagagacctgagagatgccttctcccgggtgaaaaccttcttccagatgaaggaccagctggacaacctgctgctgaaagagagcctgctggaggacttcaagggctacctggggtgccaggctctgtcagaaatgatccagttctatctggaggaggtgatgccacaggccgagaaccaggaccctgacatcaaggcccacgtgaacagcctgggcgaaaacctgaaaaccctgagactgcggctgagacggtgccataggttcctgccatgcgagaacaagagcaaggccgtggagcaggtgaaaaacgccttcaacaagctgcaggagaagggaatctacaaggccatgagcgaatttgacatcttcattaactacatcgaagcctacatgaccatgaaaatcagaaatgagggcagaggaagtctgctaacatgcggtgacgtcgaggagaatcctggacctatgagcttcgtgggcgaaaacagcggggtgaagatgggaagcgaggactgggaaaaggacgagcctcagtgctgcctggaggaccctgctggatctcctctggaacctggacctagcctgccaactatgaacttcgtgcacacaagccccaaggtgaaaaacctgaaccccaaaaagttctccatccatgaccaggaccacaaagtgctggtgctggacagcggaaacctgatcgctgtgcctgacaaaaactacatcagacccgaaatcttcttcgccctggccagctcactgagctctgcttctgctgagaagggcagccctatcctgctgggagtgtctaagggcgagttctgcctgtattgcgacaaggacaagggccagtcccacccttctctgcagctgaaaaaggagaagctgatgaagctggccgctcagaaagagtccgccagaagaccattcattttctatagagcccaggtgggaagctggaacatgctggaaagcgccgctcatccaggctggtttatttgcaccagctgcaactgcaatgagcccgtgggagtgaccgacaagtttgagaacagaaagcacatcgagttttccttccagcccgtgtgcaaggccgagatgtcaccttctgaggtgagcgactaagaatttaaatcggatccgcggccgcgaaggatctgcgatcgctccggtgcccgtcagtgggcagagcgcacatcgcccacagtccccgagaagttggggggaggggtcggcaattgaacgggtgcctagagaaggtggcgcggggtaaactgggaaagtgatgtcgtgtactggctccgcctttttcccgagggtgggggagaaccgtatataagtgcagtagtcgccgtgaacgttctttttcgcaacgggtttgccgccagaacacagctgaagcttcgaggggctcgcatctctccttcacgcgcccgccgccctacctgaggccgccatccacgccggttgagtcgcgttctgccgcctcccgcctgtggtgcctcctgaactgcgtccgccgtctaggtaagtttaaagctcaggtcgagaccgggcctttgtccggcgctcccttggagcctacctagactcagccggctctccacgctttgcctgaccctgcttgctcaactctacgtctttgtttcgttttctgttctgcgccgttacagatccaagctgtgaccggcgcctacgctagatggagagcgacgagagcggcctgcccgccgccaccatgtattcagcgccctccgcctgcacttgcctgtgtttacacttcctgctgctgtgcttccaggtacaggtgctggttgccgaggagaacgtggacttccgcatccacgtggagaaccagacgcgggctcgggacgatgtgagccgtaagcagctgcggctgtaccagctctacagccggaccagtgggaaacacatccaggtcctgggccgcaggatcagtgcccgcggcgaggatggggacaagtatgcccagctcctagtggagacagacaccttcggtagtcaagtccggatcaagggcaaggagacggaattctacctgtgcatgaaccgcaaaggcaagctcgtggggaagcccgatggcaccagcaaggagtgtgtgttcatcgagaaggttctggagaacaactacacggccctgatgtcggctaagtactccggctggtacgtgggcttcaccaagaaggggcggccgcggaagggccccaagacccgggagaaccagcaggacgtgcatttcatgaagcgctaccccaaggggcagccggagcttcagaagcccttcaagtacacgacggtgaccaagaggtcccgtcggatccggcccacacaccctgcctgagtcgac

SEQ ID NO. 7EF1a nucleotide sequence (212bp)

gggcagagcgcacatcgcccacagtccccgagaagttggggggaggggtcggcaattgaacgggtgcctagagaaggtggcgcggggtaaactgggaaagtgatgtcgtgtactggctccgcctttttcccgagggtgggggagaaccgtatataagtgcagtagtcgccgtgaacgttctttttcgcaacgggtttgccgccagaacacag

The invention has been described in detail with reference to specific embodiments and illustrative examples, but the description is not intended to be construed in a limiting sense. Those skilled in the art will appreciate that various equivalent substitutions, modifications or improvements may be made to the technical solution of the present invention and its embodiments without departing from the spirit and scope of the present invention, which fall within the scope of the present invention.

Sequence listing

<110> Beijing Jiyuan Biotechnology Ltd

<120> genetically modified stem cell for cartilage repair therapy and use thereof

<130> 2021

<160> 7

<170> SIPOSequenceListing 1.0

<210> 1

<211> 441

<212> RNA

<213> nucleotide sequence (Artificial sequence)

<400> 1

agcacagcag cgccgcggcg ccgggcgcga caggaggaga gccccccgga cagggaacac 60

agccgaaaac ccgcacccac ccccggaaac cgccaacagc gagagaccga gagagccccc 120

cggggaaaac ccccagagaa ggaccagcgg acaaccgcgc gaaagagagc cgcggaggac 180

caagggcacc gggggccagg ccgcagaaag accagcacgg aggagggagc cacaggccga 240

gaaccaggac ccgacacaag gcccacggaa cagccgggcg aaaaccgaaa acccgagacg 300

cggcgagacg ggccaaggcc gccagcgaga acaagagcaa ggccgggagc agggaaaaac 360

gcccaacaag cgcaggagaa gggaacacaa ggccagagcg aagacaccaa acacacgaag 420

ccacagacca gaaaacagaa a 441

<210> 2

<211> 528

<212> RNA

<213> nucleotide sequence (Artificial sequence)

<400> 2

agagccgggg cgaaaacagc gggggaagag ggaagcgagg acgggaaaag gacgagccca 60

ggcgccggag gacccgcgga ccccggaacc ggaccagccg ccaacagaac cggcacacaa 120

gccccaaggg aaaaaccgaa ccccaaaaag cccaccagac caggaccaca aaggcgggcg 180

gacagcggaa accgacgcgg ccgacaaaaa cacacagacc cgaaacccgc ccggccagcc 240

acgagccgcc gcgagaaggg cagcccaccg cgggaggcaa gggcgagcgc cgagcgacaa 300

ggacaagggc cagcccaccc ccgcagcgaa aaaggagaag cgagaagcgg ccgccagaaa 360

gagccgccag aagaccacac aagagcccag ggggaagcgg aacagcggaa agcgccgcca 420

ccaggcggag caccagcgca acgcaagagc ccggggagga ccgacaagga gaacagaaag 480

cacacgagcc ccagcccggg caaggccgag agcacccgag ggagcgac 528

<210> 3

<211> 45

<212> RNA

<213> nucleotide sequence (Artificial sequence)

<400> 3

gagggcagag gaagcgcaac agcgggacgc gaggagaacc ggacc 45

<210> 4

<211> 517

<212> RNA

<213> nucleotide sequence (Artificial sequence)

<400> 4

agacagcgcc cccgccgcac gccggacacc cgcgcggccc aggacagggc gggccgagga 60

gaacgggacc cgcaccacgg gagaaccaga cgcgggccgg gacgaggagc cgaagcagcg 120

cggcgaccag ccacagccgg accaggggaa acacaccagg ccgggccgca ggacaggccc 180

gcggcgagga ggggacaaga gcccagccca gggagacaga cacccggagc aagccggaca 240

agggcaagga gacggaacac cggcagaacc gcaaaggcaa gccgggggaa gcccgaggca 300

ccagcaagga ggggcacgag aaggcggaga acaacacacg gcccgagcgg caagacccgg 360

cggacggggc caccaagaag gggcggccgc ggaagggccc caagacccgg gagaaccagc 420

aggacggcac agaagcgcac cccaaggggc agccggagcc agaagcccca agacacgacg 480

ggaccaagag gcccgcggac cggcccacac acccgcc 517

<210> 5

<211> 198

<212> RNA

<213> nucleotide sequence (Artificial sequence)

<400> 5

ggggccgcac ccccacgcgc ccgccgccca ccgaggccgc caccacgccg ggagcgcgcg 60

ccgcccccgc cggggccccg aacgcgccgc cgcaggaaga aagccaggcg agaccgggcc 120

gccggcgccc cggagccacc agaccagccg gccccacgcg ccgacccgcg ccaaccacgc 180

gcgcgcgcgc cgacagac 198

<210> 6

<211> 2034

<212> RNA

<213> nucleotide sequence (Artificial sequence)

<400> 6

cagagcagcg ccaccagcac agcagcgccg cggcgccggg cgcgacagga ggagagcccc 60

ccggacaggg aacacagccg aaaacccgca cccacccccg gaaaccgcca acagcgagag 120

accgagagag ccccccgggg aaaaccccca gagaaggacc agcggacaac cgcgcgaaag 180

agagccgcgg aggaccaagg gcaccggggg ccaggccgca gaaagaccag cacggaggag 240

ggagccacag gccgagaacc aggacccgac acaaggccca cggaacagcc gggcgaaaac 300

cgaaaacccg agacgcggcg agacgggcca aggccgccag cgagaacaag agcaaggccg 360

ggagcaggga aaaacgccca acaagcgcag gagaagggaa cacaaggcca gagcgaagac 420

accaaacaca cgaagccaca gaccagaaaa cagaaagagg gcagaggaag cgcaacagcg 480

ggacgcgagg agaaccggac cagagccggg gcgaaaacag cgggggaaga gggaagcgag 540

gacgggaaaa ggacgagccc aggcgccgga ggacccgcgg accccggaac cggaccagcc 600

gccaacagaa ccggcacaca agccccaagg gaaaaaccga accccaaaaa gcccaccaga 660

ccaggaccac aaaggcgggc ggacagcgga aaccgacgcg gccgacaaaa acacacagac 720

ccgaaacccg cccggccagc cacgagccgc cgcgagaagg gcagcccacc gcgggaggca 780

agggcgagcg ccgagcgaca aggacaaggg ccagcccacc cccgcagcga aaaaggagaa 840

gcgagaagcg gccgccagaa agagccgcca gaagaccaca caagagccca gggggaagcg 900

gaacagcgga aagcgccgcc accaggcgga gcaccagcgc aacgcaagag cccggggagg 960

accgacaagg agaacagaaa gcacacgagc cccagcccgg gcaaggccga gagcacccga 1020

gggagcgaca agaaaaacgg accgcggccg cgaaggacgc gacgcccggg cccgcagggg 1080

cagagcgcac acgcccacag ccccgagaag ggggggaggg gcggcaagaa cggggccaga 1140

gaaggggcgc ggggaaacgg gaaaggagcg gacggcccgc ccccgagggg ggggagaacc 1200

gaaaaggcag agcgccggaa cgccgcaacg gggccgccag aacacagcga agccgagggg 1260

ccgcaccccc acgcgcccgc cgcccaccga ggccgccacc acgccgggag cgcgcgccgc 1320

ccccgccggg gccccgaacg cgccgccgca ggaagaaagc caggcgagac cgggccgccg 1380

gcgccccgga gccaccagac cagccggccc cacgcgccga cccgcgccaa ccacgcgcgc 1440

gcgcgccgac agaccaagcg gaccggcgcc acgcagagga gagcgacgag agcggccgcc 1500

cgccgccacc agacagcgcc cccgccgcac gccggacacc cgcgcggccc aggacagggc 1560

gggccgagga gaacgggacc cgcaccacgg gagaaccaga cgcgggccgg gacgaggagc 1620

cgaagcagcg cggcgaccag ccacagccgg accaggggaa acacaccagg ccgggccgca 1680

ggacaggccc gcggcgagga ggggacaaga gcccagccca gggagacaga cacccggagc 1740

aagccggaca agggcaagga gacggaacac cggcagaacc gcaaaggcaa gccgggggaa 1800

gcccgaggca ccagcaagga ggggcacgag aaggcggaga acaacacacg gcccgagcgg 1860

caagacccgg cggacggggc caccaagaag gggcggccgc ggaagggccc caagacccgg 1920

gagaaccagc aggacggcac agaagcgcac cccaaggggc agccggagcc agaagcccca 1980

agacacgacg ggaccaagag gcccgcggac cggcccacac acccgccgag cgac 2034

<210> 7

<211> 170

<212> RNA

<213> nucleotide sequence (Artificial sequence)

<400> 7

gggcagagcg cacacgccca cagccccgag aaggggggga ggggcggcaa gaacggggcc 60

agagaagggg cgcggggaaa cgggaaagga gcggacggcc cgcccccgag gggggggaga 120

accgaaaagg cagagcgccg gaacgccgca acggggccgc cagaacacag 170

Claims

1. A genetically modified stem cell for use in cartilage repair therapy, the stem cell comprising a nucleic acid encoding an anti-inflammatory factor and a nucleic acid encoding a cartilage repair factor.

2. The genetically modified stem cell for cartilage repair treatment according to claim 1, wherein the anti-inflammatory factor is selected from the interleukin and TGF β receptor family, preferably the anti-inflammatory factor is selected from two or more of interleukin-3 (IL-3), interleukin-4 (IL-4), interleukin-5 (IL-5), interleukin-6 (IL-6), interleukin-10 (IL-10), interleukin-13 (IL-13) and interleukin-37 (IL-37), preferably interleukin 10 and interleukin 37.

3. The genetically modified stem cell for cartilage repair treatment according to claim 1, wherein the cartilage repair factor is selected from fibroblast growth factors, such as FGF2a, FGF2b, FGF18 or FGF23, preferably the cartilage repair factor is selected from fibroblast growth factor 18(FGF 18).

4. The genetically modified stem cell for use in a cartilage repair treatment according to claim 1, wherein the nucleic acid encoding an anti-inflammatory factor is carried by a strong promoter that is susceptible to silencing in the stem cell and the nucleic acid encoding a cartilage repair factor is carried by a medium strength promoter that is not susceptible to silencing in the stem cell.

5. The genetically modified stem cell for cartilage repair treatment according to claim 1, wherein the nucleic acid encoding an anti-inflammatory factor and the nucleic acid encoding a cartilage repair factor are linked.

6. A method for preparing a genetically modified stem cell for cartilage repair therapy, comprising linking a nucleic acid encoding an anti-inflammatory factor and a nucleic acid encoding a cartilage repair factor and introducing into a mesenchymal stem cell.

7. The method for preparing the genetically modified stem cell for cartilage repair therapy according to claim 6, comprising the steps of:

8. A genetically modified stem cell produced by the method of claim 6 or 7.

9. Use of the genetically modified stem cell of any one of claims 1 to 5 or the genetically modified stem cell prepared by the method of claim 6 or 7 for the preparation of a medicament for the repair/treatment of cartilage disorders.

10. The use as claimed in claim 9, wherein the cartilage-related diseases include degenerative arthritis, bursitis, synovitis, cervical spondylosis, lumbar spondylosis, scapulohumeral periarthritis, hyperosteogeny, rheumatoid arthritis, etc.